نوع مقاله: مقاله پژوهشی

نویسندگان

1 دانشگاه آزاد واحد رشت

2 دانشگاه تربیت مدرس

3 دانشگاه آزاد اسلامی واحد تهران پزشکی

چکیده

هدف: دندروزومها دسته ای از ناقل های پلیمری غیر ویروسی نسبتاً جدید هستند که باعث افزایش حلالیت داروهای نامحلول یا با حلالیت ضعیف در محیط های زیستی می شوند. کورکومین یک ترکیب ضد سرطانی با حلالیت بسیار کم در محیط های آبی است که در این پژوهش با استفاده از دندروزوم به عنوان یک ناقل، انتقال آن به سلولهای سرطانی آدنوکارسینومای معده (AGS) صورت گرفته است.
مواد و روش ها: در مطالعه حاضر، کورکومین فرموله شده در دندروزوم به رده سرطانی آدنوکارسینومای معده منتقل شد و تأثیر آن بر مرگ سلولی با رنگ آمیزی به کمک رنگ پروپیدیوم آیوداید (PI) و بررسی میزان بیان ژنهای Survivin وhTERT به روش RT-PCR نیمه کمی صورت گرفت.
نتایج: افزایش مرگ سلولی تحت القاء کورکومین دندروزومی در مقایسه با کورکومین آزاد در سلولهای هدف به روش فلوسایتومتری و با رنگ آمیزی PI مشاهده شد. همچنین نتایج RT-PCRنیمه کمی، کاهش نسبی بیان ژن های hTERT و Survivin که از ژن های دخیل در افزایش تکثیر و بقای سلول های سرطانی می باشند، را نشان داد.
بحث: از آنجاییکه در این مطالعه کورکومین دندروزومی در مقایسه با کورکومین آزاد تأثیر بیشتری بر وقوع مرگ برنامه ریزی شده در سلولهای آدنوکارسینومای معده انسان (AGS) نشان داد. بنابراین دندروزوم ناقل مناسبی برای انتقال کورکومین نامحلول به سلول بوده و از این نانوذره می توان جهت درمان و از بین بردن سلول های سرطانی بهره برد .
.

کلیدواژه‌ها

عنوان مقاله [English]

Investigation of Survivin and hTERT gene expression in gastric adenocarcinoma cell line (AGS) treated by nano Curcumin

نویسنده [English]

  • najmeh ranji 1

چکیده [English]

Objective: Dendrosomes are a family of rather new polymers that enhance solubility of insoluble or low soluble drugs in biological media. Curcumin is anti-cancer component by very low solubility in water that in this research transferred with dendrosome as a carrier to human Caucasian gastric adenocarcinoma cell line (AGS).
Materials & methods: In the present study, we transferred dendrosome formulation of curcumin to AGS cells. Then, apoptosis induction was investigated by propidium iodide staining. Also, transcript level of Survivin and hTERT genes was determined by semi-quantitative RT-PCR.
Results: Dendrosomal curcumin increased apoptosis induction in AGS cells in compared to free curcumin. Also, Semi-Q RT-PCR results exhibited the relative decrease of hTERT and survivin gene expression, which involved in cell proliferation and survival increasing.
Conclusion: In this study was showed that dendrosomal curcumin induced apoptosis more than free curcumin in AGS cells. Therefore, dendrosome is a sufficient carrier for curcumin delivery to cells and this nanoparticle can be used for treatment and extinguish of cancer cells.

کلیدواژه‌ها [English]

  • Key words: apoptosis
  • dendrosome
  • nanocurcumin
  • survivin and hTERT

بررسی بیان ژنهای hTERT و Survivin در رده سلولی آدنوکارسینومای معده انسان (AGS) تحت تیمار با نانوکورکومین

نجمه رنجی1*، عباس پادگانه2، دینا صادقی زاده3 و مجید صادقی زاده2

1 رشت، دانشگاه آزاد اسلامی واحد رشت، دانشکده علوم، گروه ژنتیک 

2 تهران، دانشگاه تربیت مدرس، دانشکده علوم زیستی، گروه ژنتیک

3 تهران، دانشگاه آزاد اسلامی واحد تهران پزشکی، گروه ژنتیک 

تاریخ دریافت: 17/8/90               تاریخ پذیرش: 8/5/91

چکیده

دندروزومها دسته ای از ناقلهای پلیمری غیر ویروسی نسبتاً جدید هستند که باعث افزایش حلالیت داروهای نامحلول یا با حلالیت ضعیف در محیطهای زیستی می شوند. کورکومین یک ترکیب ضد سرطانی با حلالیت بسیار کم در محیطهای آبی است که در این پژوهش با استفاده از دندروزوم به عنوان یک ناقل، انتقال آن به سلولهای سرطانی آدنوکارسینومای معده (AGS) صورت گرفته است. کورکومین فرموله شده در دندروزوم به رده سرطانی آدنوکارسینومای معده منتقل و تأثیر آن بر مرگ سلولی با رنگ آمیزی رنگ پروپیدیوم آیوداید (PI) و بررسی میزان بیان ژنهای Survivin وhTERT به روش RT-PCR نیمه کمی صورت گرفته است. افزایش مرگ سلولی تحت القای کورکومین دندروزومی در مقایسه با کورکومین آزاد در سلولهای هدف به روش فلوسایتومتری و با رنگ آمیزی PI مشاهده می گردد. همچنین کاهش نسبی بیان ژنهای hTERT و Survivin  که از ژنهای دخیل در افزایش تکثیر و بقای سلولهای سرطانی می باشند، از نتایج RT-PCR نیمه کمی است. از آنجایی که کورکومین دندروزومی در مقایسه با کورکومین آزاد تأثیر بیشتری بر وقوع مرگ برنامه ریزی شده در سلولهای آدنوکارسینومای معده انسان (AGS) نشان می دهد بنابراین دندروزوم ناقل مناسبی برای انتقال کورکومین نامحلول به سلول بوده و از این نانوذره می توان جهت درمان و از بین بردن سلولهای سرطانی بهره برد .

واژه های کلیدی: مرگ برنامه ریزی شده سلول، دندروزوم ، نانوکورکومین، hTERT و Survivin  .

* نویسنده مسئول، تلفن: 09119412174 ، پست الکترونیکی:  najmehranji@gmail.com

مقدمه

 

امروزه از نانوذرات زیست تخریب پذیر، جهت انتقال انواع داروهای محلول و نامحلول در آب با توان افزایش پایداری در بدن استفاده می شود (18). داروهای فرموله شده با نانوذرات باعث کاهش سمیت دارو، کاهش هزینه های درمان، افزایش تأثیر، اختصاصیت و تحمل دارو می گردند (9). این ناقلین باعث افزایش نفوذپذیری و بقای دارو همچنین انتقال انتخابی دارو در بدن می شوند. بر این اساس نانوذرات خصوصیاتی نظیر زیست سازگاری، انحلال پذیری بالا، پایداری، توان حمل مقدار بالای دارو و توان الحاق شدن به مولکول هدف را دارا می باشند (25).

دندروزومها دسته ای از پلیمرهای نسبتاً  جدید هستند  که باعث افزایش انتقال DNA و اولیگونوکلئوتیدها به سلول می شوند. در واقع دندریمرها را به عنوان اجداد دندروزوم ها در نظر می گیرند (14 و 16). دندریمرها ماکرومولکولهای مصنوعی دارای ساختار درخت مانند با انشعابات زیاد، کروی و با جرم مولکولی مشخص می باشند. این مولکولها طی چندین مرحله از واحد های تک پار انشعاب دار ساخته شده و به این ترتیب از نظر خصوصیات مولکولی نظیر اندازه، شکل، ابعاد، چگالی، قطبیت، انعطاف پذیری و حلالیت با توجه به نوع واحدهای ساختاری یا انشعابی و گروههای عملکردی سطحی قابل کنترل می باشند. همچنین  دارای منافذ داخلی جهت کپسوله شدن داروهای هیدروفوب می باشند. وجود گروههای عملکردی سطحیِ بیشتر در دندریمرها در مقایسه با ماکرومولکولهای مرسوم، باعث افزایش حلالیت داروها توسط این نانوذرات می گردد (25). کورکومین با نام علمی دی فرولووئیل متان یا 1,6-heptadiene-3,5-dione-1,7-bis(4-hydroxy-3-methoxyphelyl)-(1E,6E) جزء زردرنگ گیاه زردچوبه است که در غذاها، داروها و لوازم آرایشی رنگی مورد استفاده قرار می گیرد (21). اثرات ضد التهابی، آنتی اکسیدان، ضد سرطان، ضد ترومبوز و حفاظت کنندگی قلب و عروق را داراست. طی تحقیقات به عمل آمده مشخص شده که بکارگیری آن در درمان آرتریت روماتوئید، التهاب بعد از جراحی و بیماری التهابی روده ای باعث کسب نتایج مطلوبی در بیمار می شود (24) همچنین در کشت سلولی، قادر به افزایش تأثیر سایر داروهای شیمیایی ضدسرطان و تشعشع گاما می باشد (1 و 10). لازم به ذکر است که کورکومین به صورت in vivo به جهت جلوگیری و درمان بسیاری از سرطانها به کار رفته است. کورکومین در حلالهای آلی چون متانول و اتانول پایدار است ولی در محلولهای آبی حلالیت کمی دارد. در محیطهای آبی در شرایط بازی و خنثی ناپایدار است و به اسید فرولیک و فرولوئیل متان تجزیه می گردد (6). در حالی که الحاق آن به لیپوزوم، نانوذرات و دندریمر باعث افزایش حلالیت، پایداری و فعالیت زیستی آن می شود. اما تأثیر و مقدار منتقل شده کورکومین به واسطه این ناقلین کم می باشد (20). در مورد ترکیبات به شدت هیدروفوب، مانند کورکومین، کاربرد نانوذرات، به جهت افزایش حلالیت آبی دارو از اهمیت ویژه  ای  برخوردار می باشد (11). با این وجود، بررسیهای اندکی در زمینه نانوذرات حاوی کورکومین تا کنون صورت گرفته است و تحقیقات درراستای تولید و کاربرد سیستمهای مبتنی بر نانوذرات جهت رسانش کورکومین در ابتدای مسیر خود قرار دارد (2) .

در این مطالعه با استفاده از دندریمر، کورکومین به رده سلولی آدنوکارسینومای معده منتقل گردید و اثرات ضد سرطانی آن با کاهش تکثیر سلولی از طریق بررسی میزان مرگ سلولی به کمک رنگ PI و بررسی بیان ژنهای Survivin و hTERT  به صورت نیمه کمی مشاهده شد.

مواد و روشها

کشت سلولی : رده سلولی آدنوکارسینومای معده انسان AGS (NCBI C131) از بانک سلولی انستیتو پاستور ایران خریداری و در محیط کشت کامل RPMI-1640 حاوی آنتی بیوتیکهای پنی­سیلین/ استرپتومایسین و 10 درصد سرم جنین گوساله (FBS) کشت داده شد. 

افزودن کورکومین دندروزومی و آزاد به سلولها : غلظت 20 میکروگرم در میلی لیتر از کورکومین فرموله با دندریمر بر روی رده سلولی آدنوکارسینومای معده انسان تأثیر داده شد. به این منظور 105×2 سلول در هر خانه پلیت 6 خانه به همراه محیط کشت کامل در دمای 37 درجه سانتی گراد و CO2=5% قرار گرفت. بعد از تکثیر سلولی و رسیدن سلولها به تراکم مناسب و تعویض محیط، کورکومین فرموله با دندرزوم و یا به صورت آزاد به آن افزوده شد.

آنالیز چرخه سلولی با کمک تکنیک فلوسایتومتری: جهت بررسی اثر کورکومین به صورت آزاد یا فرموله با دندرزوم در القای مرگ سلولی(آپوپتوز)، پس از گذشت 4 تا 18 ساعت از شروع تیمار دارویی، سلولها با پروپیدیوم  آیوداید(PI)  رنگ آمیزی و در دستگاه فلوسایتومتر، مورد بررسی قرار گرفت.

بررسی بیان ژنهای Survivin و hTERT در رده سلولی آدنوکارسینومای معده انسان با استفاده از تکنیک RT-PCR : برای بررسی بیان ژن با استفاده  از تکنیک RT-PCR، ابتداRNA  تام سلولی ، قبل و در زمانهای معینی بعد از تیمار دارویی از سلولها استخراج شد و پس از حصول اطمینان از سالم بودن RNA ، واکنش رونویسی معکوس (reverse transcriptase) انجام گرفت و cDNA تولید شده به عنوان DNA الگو برای انجام واکنش PCR  به کار رفت.

استخراج RNA تام سلولی: سلولها با استفاده از محلول RNX از کیت RNX plus شرکت سیناژن تجزیه و طبق دستورالعمل، RNA استخراج گردید. جهت بررسی کمی و کیفی RNA استخراج شده، از روش UV اسپکتروفتومتری و الکتروفورز ژل آگارز استفاده گردید.

واکنش رونویسی معکوس: در این تحقیق جهت سنتز cDNA از mRNA ، از کیت لیوفلیزه ی سنتز  cDNAی شرکت (AccuPower TM RT-PreMix) Bioneer و پرایمر  Oligo-dT استفاده شد. مخلوط واکنش به مدت 60 دقیقه در دمای 42 درجه سانتیگراد برای انجام واکنش و به مدت 10 دقیقه در دمای 70 درجه سانتی گراد، جهت غیر فعال­سازی آنزیم RT  و دناتوره  شدن کمپلکس RNA-cDNA در دستگاه ترمال سایکلر انکوبه گردید.

 

 

شکل 1- درصد سلولهای موجود در فاز G1 تحت تیمار با کورکومین آزاد یا دندروزومی. افزایش تدریجی در میزان سلولهای وارد شده به فاز G1 بین 4 تا 12 ساعت پس از شروع تیمار  مشاهده شد. اما پس از 18 ساعت، کاهش چشمگیری در سلولهای تیمار شده با کورکومین دندروزومی در این فاز به دلیل وقوع آپوپتوز رخ داد.

جدول 1- ترادف و سایر مشخصات پرایمرهای به کار گرفته شده در واکنش PCR

ژن

پرایمر

ترادف

دمای آنیلینگ

(C°)

طول قطعة

حاصل(جفت باز)

hTERT

F

CGGAAGAGTGTCTGGAGCAA

59

600

R

TCCGTGAGCCTGTCCTGG

GAPDH

F

CCCACTCCTCCACCTTTGAC

54

380

R

CATACCAGGAAATGAGCTTGACAA

Survivin

 

F

TGGCAGCCCTTTCTCAAG

54

623

R

GAGAGAGAGAAGCAGCCAC


واکنش PCR : پرایمرهای مورد استفاده در واکنش PCR با استفاده از نرم افزار Gene Runner طراحی و توسط شرکت Bioneer  سنتز گردید (جدول 1). ژن GAPDH به عنوان ژن کنترل مورد استفاده قرار گرفت.

انجام واکنش PCR : پس از انجام واکنش رونویسی معکوس، به منظور تکثیر قطعة مورد نظر واکنشPCR  انجام گرفت. بدین منظور از کیت  Titan  HotTaq 10x PCR Mix  از شرکت BioAtlas استفاده شد. واکنش PCR طبق برنامه ذیل صورت گرفت: در ابتدا مخلوط واکنش به مدت  15 دقیقه در دمای 95 درجه سانتی گراد گرمادهی شد. سپس در 31 چرخه و در هرچرخه به ترتیب در دمای95 درجه سانتی گراد 45 ثانیه، در دمای آنیلینگ ذکر شده در جدول در درجه سانتی گراد 45 ثانیه و در دمای 72 درجه سانتی گراد 60 ثانیه واکنش انجام گرفت. در پایان به منظور تکمیل سنتز قطعات نیمه کامل به مدت 10 دقیقه در دمای 72 درجه سانتی گراد قرار گرفت. محصول PCR تمامی ژنها بر روی ژل آگارز 1 درصد  تفکیک و با اتیدیوم بروماید رنگ آمیزی شد. جهت کمی کردن داده ها (تبدیل باندهای مشاهده شده در ژل آگارز به اعداد قابل اندازه گیری) از نرم افزار UVtec استفاده شد.

نتایج

تیمار سلولهای آدنوکارسینومای معده انسان (AGS) با کورکومین آزاد و دندروزوم و آنالیز فلوسایتومتری چرخه سلولی: جهت بررسی چرخه سلولی، غلظت 20  میکروگرم در میلی لیتر از کورکومین آزاد و دندروزومی ، به پلیت حاوی سلول اضافه گردید و در فواصل زمانی مختلف فلوسایتومتری صورت گرفت. در سلولهای تیمار شده با کورکومین آزاد، پس از 6 ساعت از زمان تیمار، کاهش چشمگیری در سلولهای موجود در فاز G1 مشاهده شد که به دلیل ورود تدریجی کورکومین و آغاز تأثیر آن بر چرخه سلولی می باشد. همچنین با افزایش زمان تیمار، به دلیل ادامه تأثیر دارو بر فازهای دیگر چرخه سلولی، مجدداً به سلولهای موجود در این فاز افزوده شد. در سلولهای تیمار شده با کورکومین دندروزومی ، از شروع زمان نمونه گیری (4 ساعت پس از تیمار) تا ساعت 12، افزایش تدریجی در درصد سلولهای موجود در فاز G1 مشاهده شد و پس از 18 ساعت، به دلیل ورود درصد بالایی از این سلولها به فاز مرگ، کاهش چشمگیری در سلولهای این فاز مشاهده شد(شکل 1). از سوی دیگر روند افزایشی درصد سلولهای وارد شده به فاز آپوپتوز (Sub-G1) از آغاز زمان تیمار (4 ساعت) تا پایان تیمار (18 ساعت) نشان دهنده تأثیر وابسته به زمان کورکومین در هردو گروه تیمار شده می باشد. همچنین مشاهده شد که در مقایسه با کورکومین آزاد، درصد بالاتری از سلولها در اثر تیمار با کورکومین دندریمری دچار مرگ سلولی شدند(شکل 2). در سلولهای تیمار شده با کورکومین آزاد، بیشترین درصد سلولها در فاز G1 و پس از آن فاز پیش-G1 (فاز آپوپتوز) می باشد، در حالی که در سلولهای تیمار شده با  کورکومین دندریمری، بیشترین تجمع در سلولهای وارد شده به فاز آپوپتوز (پیش- (G1 و پس از آن فازG1  مشاهده می شود(شکل 3).

بررسی مقایسه ای بیان ژنهای hTERT و   Survivinقبل و بعد از تیمار دارویی : 8 ساعت پس از تیمار سلولها با کورکومین آزاد ودندریمری، استخراج RNA صورت گرفت و به ترتیب واکنش رونویسی معکوس و سپس واکنش PCR با استفاده از پرایمرهای اختصاصی هر ژن انجام شد. میزان بیان هر یک از ژنهای مورد بررسی قبل و بعد از تیمار دارویی در شکل 4 مشاهده می شود. شدت باند هر محصول PCR با نرم افزار Uvtech مورد آنالیز قرار گرفت. مطابق شکلهای 5 و 6 کاهش اندک در سطح بیان  mRNA زیر واحد کاتالیتیکی تلومراز (hTERT) و survivin  رخ داده است.

 

 

 

 

شکل 2- درصد سلولهای موجود در فاز پیش-G1 تحت تیمار با کورکومین. روند افزایشی میزان سلولهای وارد شده به فاز آپوپتوز (پیش-G1) در ساعتهای مختلف پس از شروع تیمار مشاهده گردید. درصد بالاتری از سلولهای تیمارشده با کورکومین دندریمری نسبت به کورکومین آزاد، دچار مرگ سلولی شدند.

 

شکل 3- درصد سلولهای تیمار شده با کورکومین دندروزومی و آزاد در فازهای مختلف چرخه سلولی پس از 18 ساعت. درصد آپوپتوز در سلولهای تیمار شده با کورکومین دندروزومی 48.2 درصد و در سلولهای تیمار شده با کورکومین آزاد 20.3 درصد گزارش گردید.

 

شکل 4- تأثیر  کورکومین دندریمری بر بیان ژنهای Survivin  و hTERT قبل و بعد از تیمار دارویی. کاهش اندک در سطح بیان  mRNAی زیر واحد کاتالیتیکی تلومراز (hTERT) و survivin  به روشRT-PCR  نیمه کمی رخ داده است.

 

شکل 5- دیاگرام مقایسه ای بیان ژن hTERT قبل و بعد از تیمار سلولی با کورکومین دندریمری. کاهش بیان این ژن 8 ساعت پس از تیمار با کورکومین دندریمری در مقایسه با سلولهای کنترل مشاهده گردید.

 

شکل 6- دیاگرام مقایسه ای بیان ژن Survivin  قبل و بعد از تیمار سلولی با کورکومین دندریمری. کاهش اندک بیان این ژن 8 ساعت پس از تیمار با کورکومین دندریمری در مقایسه با سلولهای کنترل مشاهده گردید.


بحث

بیشتر ترکیبات گیاهی مورد استفاده در شیمی درمانی همانند تاکسول(taxol)  و وین کریستینvincristin)) ، نه تنها القاگر مرگ برنامه ریزی شده در سلولهای سرطانی بوده، بلکه به سلولهای طبیعی میزبان نیز آسیبهای مخربی وارد می نمایند. به طور مثال ممکن است ترکیبات مورد استفاده به سیستم ایمنی فرد آسیبهای بسیار مهلکی وارد نماید(23). کورکومین، جزئی از عادات غذایی روزانه محسوب می شود و استفاده آن در مقادیر زیاد از زمانهای قدیم، بی خطر بودن این ترکیب را اثبات نموده است(15). این ترکیب به طور انتخابی سبب القای شدید تر مرگ برنامه ریزی شده در سلولهای توموری (سلولهای به شدت تکثیر شونده) در مقایسه با سلولهای طبیعی می گردد (4). یکی از اهداف اصلی در زمینه  طراحی، تولید و کشف داروهای ضد سرطان، بدست آوردن ترکیباتی با توانایی تأثیر بر نقاط کنترل چرخه سلولی می باشد(13).  این نقاط در واقع مسئول تنظیم پیشرفت فازهای مختلف چرخه سلولی بوده و در نتیجه قادر به کنترل کیفیت و سرعت تقسیم سلول می باشند(7). امروزه مشخص شده که بسیاری از ترکیبات فیتوشیمیایی، رشد سلولهای توموری را با توقف چرخه سلولی و القای مرگ برنامه ریزی شده مهار می نمایند. به عنوان مثال، فلاووپیریدول به واسطه مکانیسم های مختلفی از قبیل مهار انواعCdk  ها، قادر به القای توقف چرخه سلولی در نقاط کنترلیG1 و G2 می باشد (3 و 7). همچنین ترکیب موسوم به سیلیبینین (silibinin) به همراه دوکسوروبیسین (doxorubicin) قادر به کاهش سطح بیان Cdc25C، cdc2/p34 و پروتئین B1 بوده و باعث توقف در مرزG2/M می گرد(22). بخشی از اثرات دارویی کورکومین را نیز می توان به مهار تکثیر سلولی و القای مرگ برنامه ریزی شده سلول نسبت داد. کورکومین در واقع مهار کننده مراحل مختلف در شبکه رونویسی بوده  و بدین صورت از تکثیر سلولی جلوگیری می نماید. این ترکیب دارویی در بسیاری از رده های توموری سبب القای مرگ برنامه ریزی شده سلول می گردد (5 و 12).

Survivin یک فاکتور مهار کنندة مرگ برنامه ریزی شده سلول است (19) که بیان آن در انواع سلولهای سرطانی گزارش شده ، اما در بافتهای نرمال (به غیر از سلولهای در حال تقسیم) بسیار کم بوده و یا اصلاً بیان نمی­گردد (8). در کنار نقش ضد آپوپتوزی Survivin اخیراً نقشهای پراهمیت تری نیز برای این ژن در کنترل چرخة سلولی و فرآیند میتوز شناسایی شده است. سطح بیان Survivin تابعی از وضعیت چرخة سلولی می باشد، به طوری که با آغاز G2/M افزایش یافته و با آغاز G1 کاهش می­یابد(8) و لذا در این مطالعه قابل انتظار بود که با کاهش سلولهای موجود در فاز G2/M و افزایش سلولهای موجود در فاز G1، بیان Survivin  نیز روند کاهشی را آغاز نماید. کاهش 10 درصدی سطح mRNA ی Survivin  در این ساعت، پیشنهاد می کند که مهار تدریجی مسیر های ضد اپوپتوزی (که از اثرات مشخص کورکومین می باشد)، در حال آغاز است.

از سوی دیگر میزان بیان ژن hTERT در پدیده تومورزایی و پیشرفت آن نقش اساسی دارد. بیان  hTERT(زیر واحد کاتالیتیکی تلومراز انسانی) در سطح  mRNA ارتباط مستقیمی با فعایت تلومرازی در سلولهای سرطانی دارد (17) و مهار بیان آن منجر به تخریب تلومر و در نتیجه کاهش رشد سلولهای سرطانی می گردد. این ژن در سلولهای سوماتیک بیان نمی گردد و در سلولهای جنینی و سرطانی فعال می شود. لذا استراتژیهای درمانی که قادر به کاهش بیان این ژن باشند، از قابلیت بالایی جهت کاهش رشد و القای مرگ برنامه ریزی شده در این سلولها برخوردار می باشند. گرچه مکانیسم تأثیر کورکومین بر تغییر بیان تلومراز نامشخص است، اما به نظر می رسد که کاهش بیان hTERT ، از تأثیرات فیزیولوژیک این ماده دارویی بوده که در القاء مرگ برنامه ریزی شده در سلولهای سرطانی نقش دارد. کورکومین، سبب کاهش فعالیت تلومراز شده و به این شکل از تکثیر و نامیرایی سلولهای سرطانی جلوگیری می نماید.  سلولهای تیمار شده با کورکومین علاوه بر کاهش فعالیت تلومراز، دچار مرگ برنامه ریزی شده نیز می شوند (11). نشان داده شده که مهار رشد تومور با افزایش مرگ برنامه ریزی شده و کاهش عملکرد تلومراز مرتبط می باشد(2). لذا، تصور بر این است که کورکومین از طریق کاهش بیان تلومراز و سپس القای مرگ برنامه ریزی شده از رشد سلولهای سرطانی جلوگیری می نماید. در تحقیق حاضر پس از 8 ساعت از زمان تیمار، کاهش 20 درصدی در بیان زیر واحد کاتالیتیکی تلومراز یعنی hTERT مشاهده گردید که نمایانگر تأثیر کورکومین بر بیان mRNA ی این ژن می باشد و با نتایج بدست آمده مطابقت دارد.

تشکر وقدردانی: از معاونت پژوهشی دانشگاه آزاد اسلامی واحد رشت و معاونت پژوهشی دانشگاه تربیت مدرس  به جهت تأمین امکانات و هزینه های این تحقیق کمال تشکر و قدردانی می گردد.

1.Aggarwal, B.B., et al., Curcumin suppresses the paclitaxel-induced nuclear factor-kappaB pathway in breast cancer cells and inhibits lung metastasis of human breast cancer in nude mice. Clin Cancer Res, 2005. 11(20): p. 7490-8.

2. Anand, P., et al., Bioavailability of curcumin: problems and promises. Mol Pharm, 2007. 4(6): p. 807-18.

3. Carlson, B., et al., Down-regulation of cyclin D1 by transcriptional repression in MCF-7 human breast carcinoma cells induced by flavopiridol. Cancer Res, 1999. 59(18): p. 4634-41.

4. Choudhuri, T., et al., Curcumin induces apoptosis in human breast cancer cells through p53-dependent Bax induction. FEBS Lett, 2002. 512(1-3): p. 334-40.

5. Choudhuri, T., et al., Curcumin selectively induces apoptosis in deregulated cyclin D1-expressed cells at G2 phase of cell cycle in a p53-dependent manner. J Biol Chem, 2005. 280(20): p. 20059-68.

6. Goel, A., A.B. Kunnumakkara, and B.B. Aggarwal, Curcumin as "Curecumin": from kitchen to clinic. Biochem Pharmacol, 2008. 75(4): p. 787-809.2.               Kobayashi, K., et al., Expression of a murine homologue of the inhibitor of apoptosis protein is related to cell proliferation. Proc Natl Acad Sci U S A, 1999. 96(4): p. 1457-62.

7. Hirose, E. and A. Murakami, Microscopic anatomy and pigment characterization of coral-encrusting black sponge with cyanobacterial symbiont, Terpios hoshinota. Zoolog Sci, 2011. 28(3): p. 199-205.

8. Kobayashi, K., et al., Expression of a murine homologue of the inhibitor of apoptosis protein is related to cell proliferation. Proc Natl Acad Sci U S A, 1999. 96(4): p. 1457-62.

9. Kumari, A., S.K. Yadav, and S.C. Yadav, Biodegradable polymeric nanoparticles based drug delivery systems. Colloids Surf B Biointerfaces, 2010. 75(1): p. 1-18.

10. Kunnumakkara, A.B., et al., Curcumin potentiates antitumor activity of gemcitabine in an orthotopic model of pancreatic cancer through suppression of proliferation, angiogenesis, and inhibition of nuclear factor-kappaB-regulated gene products. Cancer Res, 2007. 67(8): p. 3853-61.

11. Mishra, V., R. Verma, and R. Raghubir, Neuroprotective effect of flurbiprofen in focal cerebral ischemia: the possible role of ASIC1a. Neuropharmacology, 2010. 59(7-8): p. 582-8.

12. Moos, P.J., et al., Curcumin impairs tumor suppressor p53 function in colon cancer cells. Carcinogenesis, 2004. 25(9): p. 1611-7.

13. Sa, G. and T. Das, Anti cancer effects of curcumin: cycle of life and death. Cell Div, 2008. 3: p. 14.

14. Sarbolouki, M.N., K. Mahnam, and H.A. Rafiee-Pour, Determination of pore/protein size via electrophoresis and slit sieve model. Electrophoresis, 2004. 25(17): p. 2907-11.

15. Sharma, P., et al., Angiotensin-converting enzyme inhibitors and angiotensin receptor blockers for adults with early (stage 1 to 3) non-diabetic chronic kidney disease. Cochrane Database Syst Rev, 2011. 10: p. CD007751.

16. Shavandi, M., et al., Genomic structure and promoter analysis of the dsz operon for dibenzothiophene biodesulfurization from Gordonia alkanivorans RIPI90A. Appl Microbiol Biotechnol, 2010. 87(4): p. 1455-61.

17. Shay, J.W. and W.E. Wright, Telomeres and telomerase in normal and cancer stem cells. FEBS Lett, 2010. 584(17): p. 3819-25.

18. Shenoy, D.B. and M.M. Amiji, Poly(ethylene oxide)-modified poly(epsilon-caprolactone) nanoparticles for targeted delivery of tamoxifen in breast cancer. Int J Pharm, 2005. 293(1-2): p. 261-70.

19. Tamm, I., et al., IAP-family protein survivin inhibits caspase activity and apoptosis induced by Fas (CD95), Bax, caspases, and anticancer drugs. Cancer Res, 1998. 58(23): p. 5315-20.

20. Tang, H., T. Sadaoka, and Y. Mori, [Human herpesvirus-6 and human herpesvirus-7 (HHV-6, HHV-7)]. Uirusu, 2010. 60(2): p. 221-35.

21. Tomren, M.A., et al., Studies on curcumin and curcuminoids XXXI. Symmetric and asymmetric curcuminoids: stability, activity and complexation with cyclodextrin. Int J Pharm, 2007. 338(1-2): p. 27-34.

22. Tyagi, A., et al., Silibinin modulates TNF-alpha and IFN-gamma mediated signaling to regulate COX2 and iNOS expression in tumorigenic mouse lung epithelial LM2 cells. Mol Carcinog, 2011.

23. Vial, Y., et al., In vitro influence of fatty acids and bilirubin on binding of mycophenolic acid to human serum albumin. J Pharm Biomed Anal, 2011. 54(3): p. 607-9.

24. Wongcharoen, W. and A. Phrommintikul, The protective role of curcumin in cardiovascular diseases. Int J Cardiol, 2009. 133(2): p. 145-51.

25. Yang, Y. and N. Calakos, Munc13-1 is required for presynaptic long-term potentiation. J Neurosci, 2011. 31(33): p. 12053-7.