نوع مقاله: مقاله پژوهشی

نویسندگان

اصفهان، دانشگاه اصفهان، دانشکده علوم، گروه زیست شناسی

چکیده

حذف گوگرد از ترکیبات تیوفنی یکی از مسائل مهم در پالایشگاه ها و کنترل آلودگی های زیست محیطی محسوب می شود. یک سویه باکتریایی غنی شده در خاک حاوی MTBE قادر به گوگردزدایی از ترکیب تیوفن می باشد که با آنالیز فیلوژنتیکی انجام شده بر اساس توالی ژن 16S rRNA، این سویه به عنوان Pseudomonas stutzeri شناسایی شد. آزمایش های گوگردزدایی با سلول های فعال بدون رشد این باکتری در حضور ترکیب گوگرددار مدل تیوفن و در فاز آبی انجام شد که نتایج به دست آمده با روش اسپکتروفتومتری UV در طول موج 230 نانومتر نشان داد که بیش از 95% از تیوفن با غلظت اولیه 4/12 میلی مولار پس از 15 ساعت حذف شده است. آنالیز انجام شده با روش کروماتوگرافی گازی (GC) نیز همین میزان کاهش تیوفن را نشان داد. هم چنین به منظور بررسی فعالیت گوگردزدایی سلول های فعال بدون رشد این باکتری در محیط دوفازی حاوی نفت خام ، میزان کاهش گوگرد از طریق اندازه گیری میزان سولفات آزاد شده با روش کدورت سنجی مورد بررسی قرار گرفت.

کلیدواژه‌ها

عنوان مقاله [English]

Desulfurization of thiophene by Pseudomonas stutzeri SEE-1

نویسندگان [English]

  • mohammad sadegh shirsalimian
  • zahra etemadifar
  • giti emtiazi

Department of Biology, Faculty of Science, University of Isfahan, Isfahan

چکیده [English]

Desulfurization of thiophenic compounds is one of the important issues in refineries and environmental pollutions control. A bacterium was isolated from MTBE enriched soil was able to desulfurize of the thiophene. It was identified as Pseudomonas stutzeri based on phylogenetic analysis of 16S rRNA gene sequence. Desulfurization reactions from thiophene as the model of thiophenic compounds in aqueous phase by resting cells of this strain carried out and the concentration of thiophene was determined by UV-visible spectrophotometer in 230 nm wavelength. The results showed that the reduction of thiophene was 95% (from 12.4 mM to 0.3 mM) after 15 hours. Gas chromatography analysis showed the same results of thiophene desulfurization. Furthermore, The desulfurization activity of resting cells in a biphasic system containing crude oil by determination of released sulfate content turbidimetrically with BaCl2 was investigated.

کلیدواژه‌ها [English]

  • Biodesulfurization
  • Thiophene
  • Resting cell
  • crude oil
  • Pseudomonas stutzeri

گوگردزدایی از تیوفن توسط باکتری Pseudomonas stutzeri SEE-1 

محمد صادق شیرسلیمیان، زهرا اعتمادی فر* و گیتی امتیازی

اصفهان، دانشگاه اصفهان، دانشکده علوم، گروه زیست شناسی

تاریخ دریافت: 3/7/90                 تاریخ پذیرش: 11/4/91 

چکیده

حذف گوگرد از ترکیبات تیوفنی یکی از مسائل مهم در پالایشگاه ها و کنترل آلودگیهای زیست محیطی محسوب می شود. یک سویه باکتریایی غنی شده در خاک حاوی MTBE قادر به گوگردزدایی از ترکیب تیوفن می باشد که با آنالیز فیلوژنتیکی انجام شده بر اساس توالی ژن 16S rRNA، این سویه به عنوان Pseudomonas stutzeri شناسایی شد. آزمایشهای گوگردزدایی با سلولهای فعال بدون رشد این باکتری در حضور ترکیب گوگرددار مدل تیوفن و در فاز آبی انجام شد که نتایج به دست آمده با روش اسپکتروفتومتری UV در طول موج 230 نانومتر نشان داد که بیش از 95 درصد از تیوفن با غلظت اولیه 4/12 میلی مولار پس از 15 ساعت حذف شده است. آنالیز انجام شده با روش کروماتوگرافی گازی (GC) نیز همین میزان کاهش تیوفن را نشان داد. همچنین به منظور بررسی فعالیت گوگردزدایی سلولهای فعال بدون رشد این باکتری در محیط دوفازی حاوی نفت خام، میزان کاهش گوگرد از طریق اندازه گیری میزان سولفات آزاد شده با روش کدورت سنجی مورد بررسی قرار گرفت.

واژه های کلیدی: گوگردزدایی زیستی، تیوفن، سلول فعال بدون رشد، نفت خام، سودوموناس استوتزری

* نویسنده مسئول، تلفن: 37932367-031، پست الکترونیکی: z_etemadifar@yahoo.com

مقدمه

 

میزان گوگرد در نفتهای خام از  ppm 3000 - 1000 متغیر است و مهم‌ترین ترکیب آلوده کننده نفتی محسوب می‌شود (9). احتراق مواد سوختنی حاصل از نفت خام مثل گازوئیل و بنزین موجب تولید و انتشار اکسیدهای متفاوت گوگرد (SOX) و بیش از همه به صورت SO2 می شود که با ایجاد بارانهای اسیدی موجب حل شدن مواد ساختمانی، از بین رفتن جنگلها و سمی شدن دریاچه ها می گردد. همچنین افزایش غلظت گوگرد موجود در اتمسفر با تشکیل آئروسلهای سولفات سبب بروز ناراحتیهای تنفسی و قلبی-عروقی در انسان می شود. از طرف دیگر، هر ساله قوانین و استانداردهای موجود برای کنترل میزان گوگرد مجاز سوختهای فسیلی سخت تر می شود. به عنوان مثال، سازمان حفاظت محیط زیست آمریکا (EPA) مرز میزان گوگرد مجاز در سوختهای دیزلی و گازوئیل را تا سال 2010 ، ppm 15 تعیین کرد (1 و 11).

در حال حاضر همه پالایشگاهها برای حذف گوگرد از سوختهای فسیلی متکی بر تکنیک پر هزینه گوگردزدایی هیدروژنی (Hydrodesulfurization) می باشند، یک فرآیند کاتالیتیکی در فشار بالا (250-150 پوند بر اینچ مربع) و حرارت بالا (425-200 درجه سانتی گراد) که در آن از گاز هیدروژن برای احیای گوگرد به سولفید هیدروژن استفاده می شود. حجم وسیعی از ترکیبات غیر آلی گوگردی و همچنین ترکیبات آلی گوگردی ساده از طریق این فرآیند حذف می شوند، اما بیش از 70 درصد از گوگرد موجود در نفت خام ترکیبات آروماتیکی گوگردی بر پایه حلقه تیوفن می باشند که نسبت به عمل گوگردزدایی این روش مقاوم هستند (11). از این رو، توسعه روشهای جدید مثل گوگردزدایی زیستی یا بیوکاتالیتیک به یکی از جاذبه های مهم بیوتکنولوژی در صنعت نفت تبدیل شده است.

روش گوگردزدایی زیستی به دلیل شرایط عملیاتی متعادل، هزینه های پایین و ویژگی مسیرهای متابولیکی به عنوان یک روش مکمل برای فرآیند گوگردزدایی هیدروژنی در نظر گرفته می شود. از این رو تغییر زیستی ترکیبات تیوفنی توسط انواعی از سویه‌های باکتریایی از قبیل رودوکوکوس، گوردونیا، میکوباکتریوم، پانی‌باسیلوس، سودوموناس و غیره مورد مطالعه قرار گرفته است (8، 9 و 11).

سودوموناس استوتزری یک باکتری با قابلیتهای ژنتیکی و فیزیولوژیکی بالا، در تجزیه بسیاری از هیدروکربنهای آلیفاتیک و آروماتیک نقش دارد (7). در این تحقیق به بررسی فعالیت گوگردزدایی یک سویه باکتریایی بر روی تیوفن پرداخته شده است که به مقدار فراوانی در گازوئیل وجود دارد. در فرآیند گوگردزدایی هیدروژنی، مولکول تیوفن از طریق سیس- یا ترانس- 1- بوتن به بوتان و گاز سولفید هیدروژن تبدیل می شود (3). تا به امروز، یک مکانیسمی که گوگرد را از تیوفن غیر استخلاف شده به طور انتخابی جدا کند مانند مسیر S4 برای دی بنزوتیوفن شناسایی نشده است (10).    

مواد و روشها

مواد شیمیایی: تیوفن از شرکت مرک آلمان با درجه خلوص بالا خریداری شد. کیت استخراج DNA (DNPTM Kit) و کیت واکنش PCR از شرکت داخلی سیناژن تهیه شد. پرایمرهای مورد استفاده برای تعیین توالی از شرکت تگ کپنهاگ دانمارک خریداری شد.

مشخصات باکتری: باکتریSEE-1 که از خاک آلوده به MTBE جداسازی شده بود مورد استفاده قرار گرفت. این باکتری گرم منفی با تست کاتالاز و اکسیداز مثبت، فاقد اسپور و باسیل می باشد که کلنیهای این باکتری بر روی محیط کشت جامد آگار مغذی (نوترینت آگار) به رنگ زرد رنگ پریده، گرد و صاف دیده می شوند. کلنیهای تازه جداسازی شده این باکتری خشن و خشک با یک ظاهر خاص چروکیده به همراه لبه‌های برآمده بود که پس از برداشتن، محل اثر برداشتن کلنی باقی می‌ماند. پس از پاساژهای مکرر در محیطهای کشت آزمایشگاهی کلنیها به حالت صاف و گرد تبدیل شدند (شکل 1).

تعیین ترادف ژن 16S rRNA : به منظور شناسایی مولکولی باکتری مورد نظر، DNA ژنومی آن طبق دستورالعمل کیت مورد استفاده استخراج شد، سپس واکنش PCR با دو پرایمر رفت 01RW و برگشت 74DG انجام شد که توالی پرایمرها به صورت زیر است: پرایمر رفت 01RW (5'AACTGGAGGAAGGTGGGGAT3') و پرایمر برگشت 74DG (5'AGGAGGTGATCCAACCGCA3'). محصول به دست آمده توسط این دو پرایمر حاوی bp 370 بود. برنامه PCR به صورت یک سیکل دناتوراسیون اولیه با دمای 95 درجه سانتی گراد به مدت 5 دقیقه، 30 سیکل با دمای 94 درجه سانتی گراد به مدت 45 ثانیه، 54 درجه سانتی گراد به مدت 30 ثانیه، 72 درجه سانتی گراد به مدت 45 ثانیه و یک سیکل نهایی  72 درجه سانتی گراد به مدت 5 دقیقه تنظیم شد.

محصول PCR پس از مشاهده بر روی ژل 1 درصد آگارز، جهت تعیین توالی به شرکت ماکروژن در کره جنوبی فرستاده شد. توالی به دست آمده با دیگر توالیهای شناخته شده موجود در بانک ژنی مرکز NCBI با استفاده از برنامه BLASTn مقایسه گردید (5).

تهیه سلولهای فعال بدون رشد: کشت اولیه باکتری SEE-1 در ارلن حاوی 50 میلی لیتر از محیط کشت لوریا برتانی (LB) در دمای 30 درجه سانتی گراد انجام شد. پس از آنکه باکتری به انتهای فاز لگاریتمی رشد خود نزدیک گردید، سلولهای باکتری توسط سانتریفیوژ (دور g 1800 به مدت 10 دقیقه) ته نشین شدند. رشد سلولی توسط دستگاه اسپکتروفتومتر (مدل SECOMAM XS 5 ساخت فرانسه) در طول موج 600 نانومتر اندازه گیری شد. سپس سلولها توسط محلول 9/0 درصد کلرور سدیم دو بار شستشو داده شدند و مجدداً همین محلول اضافه شد تا سوسپانسیون سلولی تشکیل گردد که چگالی سلولی آن در طول موج 600 نانومتر به 30 برسد (30 = 600OD) (6).

سنجش تیوفن در فاز آبی با روش اسپکتروفتومتر UV : مقدار 2/0 میلی لیتر از سوسپانسیون سلولی تهیه شده به 5 میلی لیتر محلول 9/0 درصد کلرور سدیم حاوی 4/12 میلی مولار تیوفن در لوله درب دار اضافه گردید و بر روی شیکر (120 دور در دقیقه) با دمای 30 درجه سانتی گراد به مدت 15 ساعت انتقال داده شد. به منظور اندازه گیری میزان گوگردزدایی، رقت های متفاوت تیوفن در محلول 9/0 درصد کلرور سدیم از غلظت 4/12 میلی مولار تیوفن آماده گردید و حداکثر جذب تیوفن در طول موج 230 نانومتر توسط دستگاه اسپکتروفتومتر UV (مدل A160-UV شرکت شیمادزو ژاپن) اندازه گیری شد. معادله منحنی استاندارد تیوفن به صورت 021/0 – x 437/3 = y، 998/0 = R2 با استفاده از نرم افزار Excel به دست آمد (y : جذب، x : مقدار تیوفن بر حسب میلی مولار).

سنجش تیوفن در فاز گازی با روش کروماتوگرافی گازی (GC) : مقدار 5/0 میلی لیتر از سوسپانسیون سلولی تهیه شده به 5 میلی لیتر محلول 9/0% کلرور سدیم حاوی 62 میلی مولار تیوفن در شیشه درب دار با درب پلاستیکی اضافه گردید. پس از 20 ساعت گرماگذاری در دمای 30 درجه سانتی گراد بر روی شیکر (120 دور در دقیقه)، با سوراخ کردن درب پلاستیکی شیشه‌ها توسط سرنگ 1 میلی لیتری، میزان 200 میکرولیتر از هوای بالای سطح مایع جهت شناسایی تیوفن به دستگاه کروماتوگرافی گازی (مدل Agilent 6890N ساخت آمریکا) تزریق شد. ستون مورد استفاده 5-HP با طول 30 متر، قطر داخلی 32/0 میلی متر و ضخامت لایه 25/0 میکرومتر بود. برنامه دمایی نیز بدین ترتیب بود: دمای آون 35 درجه سانتی گراد و توقف در این دما 7 دقیقه، افزایش دما تا 75 درجه سانتی گراد با شیب دمایی 10 درجه سانتی گراد در هر دقیقه و در نهایت افزایش دما تا 100 درجه سانتی گراد و توقف در این دما به مدت 2 دقیقه می باشد. دمای محل تزریق و آشکارساز، 200 و 250 درجه سانتی گراد بود. از گاز هلیوم با سرعت جریان 2 میلی لیتر در دقیقه به عنوان گاز حامل استفاده شد. درصد تیوفن با استفاده از مساحت پیک حاصل از آشکارساز یونیزاسیون شعله ای (FID) محاسبه گردید (12).   

تاثیر عصاره آنزیمی فاقد سلول در حذف تیوفن: به منظور تهیه عصاره آنزیمی فاقد سلول، سلولهای رشد یافته در 250 میلی لیتر محیط لوریا برتانی از انتهای فاز لگاریتمی توسط سانتریفیوژ (دور g 1800 به مدت 10 دقیقه) جمع آوری شدند، سلولها توسط بافر فسفات استریل (1/7 = pH) دو بار شستشو داده شدند و مجدداً در 5 میلی لیتر بافر فسفات حاوی 4/12 میلی مولار تیوفن به منظور القای آنزیمهای درگیر در تجزیه آن سوسپانسیون گردیدند. پس از 2 ساعت، سلولها با بافر فسفات شستشو داده شدند و مجدداً در همین بافر تا رسیدن 600OD به 20 به حالت سوسپانسیون تبدیل شدند. در مرحله بعد، سلول‌های باکتری با استفاده از دستگاه اولتراسونیک (dr.hielscher GmbH مدل VP 200H ساخت آلمان) 10 بار بر روی یخ (هر بار 1 دقیقه سونیکیت و 30 ثانیه استراحت) شکسته شدند و عصاره آنزیمی پس از جداسازی اجساد خرد شده سلولی با سانتریفیوژ (دور g 10000 در 4 درجه سانتی گراد به مدت 10 دقیقه) به دست آمد (4). مقدار پروتئین عصاره آنزیمی حاصل با استفاده از معرف برادفورد و منحنی استاندارد پروتئین، 3/30 میکروگرم در میلی لیتر محاسبه گردید (2). 1 میلی لیتر از عصاره آنزیمی به 5 میلی لیتر محلول 9/0 درصد کلرور سدیم حاوی 4/12 میلی مولار تیوفن اضافه گردید و پس از گذشت 90 دقیقه، جذب UV تیوفن خوانده شد و با نمونه حاوی همین مقدار تیوفن بدون عصاره آنزیمی به عنوان کنترل مقایسه گردید.

انجام عمل گوگردزدایی زیستی سلولهای فعال بدون رشد در یک محیط نفتی: جمع آوری سلولها از انتهای فاز لگاریتمی و آماده سازی سوسپانسیون سلولی با 600OD برابر 20 مطابق قسمت قبل انجام شد. میزان 3 میلی لیتر از این سوسپانسیون سلولی به یک ارلن شامل 100 میلی لیتر محلول بافر فسفات (1/7 = pH) و 25 میلی لیتر نفت خام به دست آمده از پالایشگاه اصفهان اضافه گردید. یک ارلن حاوی همین مقادیر از بافر فسفات و نفت خام بدون اضافه کردن باکتری به عنوان کنترل در نظر گرفته شد. بعد از 24 ساعت گرماگذاری در دمای 30 درجه سانتی گراد بر روی شیکر (160 دور در دقیقه)، سلولها با سانتریفیوژ (g 6000 به مدت 10 دقیقه) جمع آوری و میزان سولفات مایع رویی بر حسب میلی گرم در لیتر با روش کدورت سنجی در طول موج 420 نانومتر مورد بررسی قرار گرفت (13). معادله منحنی استاندارد سولفات سدیم به منظور اندازه گیری میزان سولفات به صورت 475/0 + x 165/0 = y، 989/0 = R2 با استفاده از نرم افزار Excel به دست آمد (y : جذب، x : غلظت سولفات بر حسب میلی گرم در لیتر).

 

 

 

 

 

 

شکل 1- تصویر کلنی باکتری SEE-1 بر روی محیط آگار مغذی (تصویر چپ مربوط به کلنیهای خشن با ظاهر چروکیده خاص، تصویر راست مربوط به کلنیهای صاف و گرد پس از پاساژهای مکرر) و سلول‌های آن در زیر میکروسکوپ


نتایج و بحث

شناسایی سویه مورد استفاده: نتایج به دست آمده نشان داد باکتری مورد استفاده در این تحقیق بیشترین شباهت (%99>) را با گونه سودوموناس استوتزری (شماره دسترسی: 063219.1Af) نشان می‌دهد. این باکتری پس از شناسایی، در بانک ژنی NCBI با شماره دسترسی 438282HQ به ثبت رسید. تصویر کلنیهای مربوط به این سویه در شکل (1) نشان داده شده است.

 

 

 

 

شکل 2- جذب UV تیوفن در طول موج 230 نانومتر توسط سلول‌های فعال بدون رشد باکتری پس از 15 ساعت گرماگذاری در دمای 30 درجه سانتی گراد: A) نمونه کنترل بدون باکتری با رقت 50⁄1 B) نمونه حاوی باکتری با رقت 2⁄1، C) نمونه حاوی باکتری با رقت 10⁄1. (محور افقی: طول موج بر حسب نانومتر، محور عمودی: میزان جذب UV)

 

جدول 1-  درصد کاهش تیوفن با غلظت اولیه 4/12 میلی مولار توسط سلول‌های فعال بدون رشد (آزمایش برای هر نمونه با سه تکرار صورت گرفت که میانگین جذب آنها آورده شده‌ است)

شماره

رقت

جذب در 230 نانومتر

مقدار تیوفن باقیمانده (میلی مولار)

درصد کاهش تیوفن (%)

شکل 2 قسمت B

2⁄1

547/0

33/0

4/97 %

شکل 2 قسمت C

10⁄1

116/0

39/0

8/96 %

نمونه کنترل (قسمت A)

50⁄1

807/0

04/12

91/2 %

 


ارزیابی فعالیت باکتری بر روی تیوفن : از نمونه‌های حاوی سلولهای فعال بدون رشد این باکتری پس از رسوب دادن توده سلولی، رقتهای  2⁄1 و 10⁄1 از مایع رویی حاوی تیوفن آماده شد و از میزان جذب UV به دست آمده در طول موج 230 نانومتر (شکل 2) و استفاده از معادله خط منحنی استاندارد تیوفن ، مقدار تیوفن به صورت جدول (1) محاسبه گردید. کاهش جزئی درصد تیوفن در نمونه کنترل به دلیل ماهیت فرار بودن آن می‌باشد. 

همچنین نمودارهای گاز کروماتوگرام حاصل از عملکرد گوگردزدایی باکتری‌ مورد استفاده بر روی تیوفن و همچنین نمونه‌ کنترل حاوی تیوفن بدون باکتری در شکل (3) نشان داده شده است. کروماتوگرام‌ مربوط به نمونه‌ کنترل دو پیک اصلی را نشان می‌دهد، پیک در زمان بازداری 9/1 دقیقه که با توجه به کاهش این پیک در نمونه‌ حاوی باکتری‌ به عنوان پیک معرف تیوفن در نظر گرفته می شود. همچنین در نمونه‌ کنترل پیک دومی در زمان بازداری 2/3 دقیقه مشاهده گردید که مربوط به وجود ناخالصی به همراه تیوفن می‌باشد. با توجه به اطلاعات مربوط به سطح زیر منحنی و ارتفاع پیک تیوفن در زمان بازداری 9/1 دقیقه، درصد کاهش تیوفن توسط این باکتری 82/93  درصد به دست آمد.

 

 

 

شکل 3- نمودارهای GC نمونه‌ کنترل و نمونه‌ حاوی باکتری‌ مورد مطالعه پس از 20 ساعت گرماگذاری در دمای 30 درجه سانتی گراد: A) نمونه کنترل حاوی تیوفن بدون باکتری، B) نمونه حاوی باکتری. (محور افقی: زمان بازداری بر حسب دقیقه، محور عمودی: پیکوآمپر بر ثانیه)


استفاده از کاتالیزور آنزیمی برای حذف تیوفن: با تهیه رقت 50⁄1، جذب UV تیوفن نمونه حاوی 1 میلی لیتر از عصاره آنزیمی باکتری و نمونه حاوی تیوفن بدون عصاره آنزیمی به عنوان کنترل به دست آمد (شکل 4). کاهش جذب UV در طول موج 230 نانومتر توسط عصاره آنزیمی استخراج شده از باکتری نسبت به نمونه کنترل نشان دهنده تجزیه آنزیمی تیوفن می باشد. با توجه به اطلاعات مربوط به جذب UV در طول موج 230 نانومتر، درصد کاهش تیوفن توسط عصاره آنزیمی این باکتری 49/28 درصد به دست آمد.

 

 

شکل 4- تأثیر عصاره آنزیمی فاقد سلول در کاهش جذب UV تیوفن: A) نمونه کنترل حاوی 4/12 میلی مولار تیوفن بدون عصاره آنزیمی با رقت 50⁄1، B) نمونه حاوی عصاره آنزیمی باکتری و 4/12 میلی مولار تیوفن با رقت 50⁄1. (محور افقی: طول موج بر حسب نانومتر، محور عمودی: میزان جذب UV)


فعالیت گوگردزدایی باکتری در محیط نفتی: پس از جدا کردن فاز آبی و نفت، از مایع رویی جهت تخمین فعالیت گوگردزدایی از طریق اندازه گیری میزان سولفات با روش کدورت سنجی استفاده شد و با معادله به دست آمده از منحنی استاندارد سولفات سدیم، مقدار سولفات بر حسب میلی گرم در لیتر به دست آورده شد. با توجه به جدول (2)، میزان سولفات اندازه گیری شده در نمونه حاوی باکتری نسبت به نمونه کنترل بدون باکتری بیشتر است که نشان دهنده توانایی باکتری در آزاد کردن اتم گوگرد به شکل سولفات از ترکیبات گوگردی آلی موجود در نفت خام می‌باشد.

 

جدول 2- نتایج حاصل از فعالیت گوگردزدایی باکتری در محیط حاوی نفت خام و میزان سولفات اندازه گیری شده بر حسب mg/l

نمونه

میزان جذب در 420 نانومتر

غلظت سولفات (mg/l)

ارلن کنترل بدون باکتری

061/1

15/355

ارلن حاوی باکتری

223/1

33/453

 

نتیجه گیری کلی

در اکثر مقالات موجود از دی بنزوتیوفن به عنوان ترکیب مدل برای مطالعات گوگردزدایی زیستی استفاده می‌شود و اکثر مطالعات بر روی تیوفن به بررسی رشد سویه‌های جداسازی شده بر روی تیوفن به عنوان تنها منبع گوگرد و اندازه‌گیری رشد سویه محدود می‌شود (8  و 11).

از ارزیابی نتیجه های به دست آمده چنین استنباط می شود که باکتری سودوموناس استوتزری SEE-1 شناسایی شده در این تحقیق توانایی اختصاصی بسیار مطلوبی در گوگردزدایی از ترکیب تیوفن دارد. بدیهی است به منظور شناسایی متابولیت‌های حدواسط و مسیر متابولیکی تجزیه تیوفن نیاز به مطالعات بیشتر با استفاده از روش کروماتوگرافی گازی - اسپکتروفتومتری جرمی (GC-MS) می باشد.

سپاسگزاری :نگارندگان بدین وسیله از همکاری گروه زیست شناسی به ویژه بخش میکروبیولوژی دانشگاه اصفهان که در اجرای این طرح کمک نمودند قدردانی می نمایند. 

1- اعتمادی فر، ز.، امتیازی، گ.، نحوی، ا. 1387. بررسی رشد، تنفس و تشکیل بیوفیلم در مخمر Trichosporon sp.  مصرف کننده دی بنزو تیوفن با روش میکروتیتر پلیت. مجله زیست شناسی ایران. ج 21 (5): ص 899-891 .

 

2- Bradford, M. M. 1976. A rapid and sensitive method for the quantitation of  microgram quantities of protein utilizing the principle of protein-dye binding Analytical biochemistry. 72, 248-254.

3- Brunet, S., Mey, D., Perot, G., Bouchy, C., and Diehl, F. 2005. On the   hydrodesulfurization of FCC gasoline: a review. Applied catalysis A: General. 278, 143-172.

4- Emtiazi, G. Harirchi, S. and Soroush Noghabi, M. 2008. The Effect of grown cell and cell free extract of Rhodococcus sp. and Paenibacillus sp. on dimethyl disulfide (DMDS) and diethyl disulfide (DEDS) removal. World Applied Sciences Journal. 5, 499-506.

5- Etemadifar, Z. Emtiazi, G. and Christofi, N. 2008. Enhanced desulfurization activity in protoplast transformed Rhodococcus erythropolis. American-Eurasian journal of agricultural & environmental science. 3, 795-801.

6- Etemadifar, Z. Emtiazi, G. and Peimanfar, S. 2006. Removal of dibenzothiophene, biphenyl and phenol from waste by Trichosporon sp. Scientific Research and Essay. 1, 72-76.

7- Lalucat, J., Bennasar, A., Bosch, R., Garcia-Valdes, E. and Palleroni, N. J. 2006. Biology of Pseudomonas stutzeri. Microbiology and molecular biology reviews. 70, 510.

8- Mohebali, G. and Ball, A. S. 2008. Biocatalytic desulfurization (BDS) of petrodiesel fuels. Microbiology. 154, 2169.

9- Monticello, D. J. 2000. Biodesulfurization and the upgrading of petroleum distillates. Current opinion in biotechnology. 11, 540-546.

10- Prayuenyong, P. 2002. Coal biodesulfurization processes. Songklanakarin Journal of Science and Technology. 24, 493-507.

11- Soleimani, M., Bassi, A. and Margaritis, A. 2007. Biodesulfurization of refractory organic sulfur compounds in fossil fuels. Biotechnology advances. 25, 570-596.

12- Wu, Z. and Ondruschka, B. 2006. Aquasonolysis of thiophene and its derivatives. Ultrasonics sonochemistry. 13, 86-91.

13- 1985. Standard methods for the examination of water and wastewater. APHA-AWWA-WPCF.