نوع مقاله: مقاله پژوهشی

چکیده

امروزه کنترل بیماریهای گیاهی یکی از اهداف مهم اقتصاد جهانی است. پاتوژنهای قارچی با گسترش وسیع و سریعی که دارند خسارت زیادی به محصولات گیاهی وارد می کنند و به همین دلیل مبارزه با پاتوژنهای قارچی جزء برنامه های اصلی مبارزه با بیماریهای گیاهی در بسیاری از آزمایشگاههای تحقیقاتی می باشد. بیشترین آنزیمهای قارچی تجزیه کننده دیواره سلولی گیاهی که مطالعه شده اند پلی گالاکتوروناز ها (PG/polygalacturonase) می باشند که پیوند بین دی گالاکتورونیک اسید ها که جزء اصلی پکتین ها می باشند را می شکنند. آنزیمهای پلی گالاکتورونازی توسط اغلب قارچهای فیتوپاتوژنیک با اشکال ایزو آنزیمی مختلف تولید می شوند. در مقابل گیاهان نیز دارای PGIP های متنوعی هستند که علیه بسیاری از آنزیمهای پلی گالاکتورونازی تولید شده توسط قارچها، توانایی تشخیص و مهار اختصاصی دارند. با توجه به عملکرد اختصاصی PGIP ها علیه آنزیمهای پلی گالاکتوروناز قارچی در این تحقیق از ژنهای pgip1 و pgip2 استخراج شده از رقم ناز گیاه لوبیا جهت طراحی و ساخت یک سازه واجد هر دو ژن مذکور که به صورت کایمریک طراحی شده اند استفاده گردید. در طی مراحل ساخت این سازه ها، از ناقلی که دارای دو جایگاه آنزیمهای برشی XbaI و  PacIبرای همسانه سازی ژنهای مورد نظر بین پروموتر CaMV 35S و ترمیناتور  NOSمی باشد استفاده گردید. از سازه ساخته شده در این تحقیق می توان برای پروژه های انتقال ژن به گیاهان مدل و زراعی جهت بررسی اثرات این ژنها و تولید گیاهان تراریخته مقاوم در برابر قارچها استفاده کرد.

کلیدواژه‌ها

عنوان مقاله [English]

Construction of plant expression cassette for production of chimeric protein containing PGIP1 and PGIP2

چکیده [English]

Polygalacturonase inhibiting proteins (PGIPs) selectively inhibit the polygalacturonases (PGs) secreted by the invading plant pathogenic fungi. The PGIPs display the differential inhibiting towards the PGs from different fungi, also towards the different isoforms of the PGs originating from the specific pathogen. In this study an expression cassette was constructed to produce a chimeric protein containing PGIP1 and PGIP2 as a fused protein using three alanine as linker. The chimeric gene is under the control of  CaMV 35S promoter and NOS as terminator. Pgip1 and pgip2 genes have been amplified from Naz cultivar of bean. All the intermediate and final constructs were confirmed by PCR and restriction digestion patterns. In addition, the final construct also was confirmed by sequencing. The Chimeric construct from this study can be used to produce transgenic plants resistant to fungal pathogenes. 

کلیدواژه‌ها [English]

  • polygalactronase inhibition protein (PGIP)
  • plant expression cassette
  • polygalactronase enzyme

طراحی و ساخت سازه بیانی گیاهی جهت تولید پروتئین کایمری حاوی PGIP1 و PGIP2

رضا محمدزاده1، مصطفی مطلبی*،2 و محمدرضا زمانی2

1 دانشگاه مراغه، گروه بیولوژی سلولی و مولکولی 

2 تهران، پژوهشگاه ملی مهندسی ژنتیک و زیست فناوری 

تاریخ دریافت: 10/7/91               تاریخ پذیرش: 20/9/91 

چکیده

امروزه کنترل بیماریهای گیاهی یکی از اهداف مهم اقتصاد جهانی است. پاتوژنهای قارچی با گسترش وسیع و سریعی که دارند خسارت زیادی به محصولات گیاهی وارد می کنند و به همین دلیل مبارزه با پاتوژنهای قارچی جزء برنامه های اصلی مبارزه با بیماریهای گیاهی در بسیاری از آزمایشگاههای تحقیقاتی می باشد. بیشترین آنزیمهای قارچی تجزیه کننده دیواره سلولی گیاهی که مطالعه شده اند پلی گالاکتوروناز ها (PG/polygalacturonase) می باشند که پیوند بین دی گالاکتورونیک اسید ها که جزء اصلی پکتین ها می باشند را می شکنند. آنزیمهای پلی گالاکتورونازی توسط اغلب قارچهای فیتوپاتوژنیک با اشکال ایزو آنزیمی مختلف تولید می شوند. در مقابل گیاهان نیز دارای PGIP های متنوعی هستند که علیه بسیاری از آنزیمهای پلی گالاکتورونازی تولید شده توسط قارچها، توانایی تشخیص و مهار اختصاصی دارند. با توجه به عملکرد اختصاصی PGIP ها علیه آنزیمهای پلی گالاکتوروناز قارچی در این تحقیق از ژنهای pgip1 و pgip2 استخراج شده از رقم ناز گیاه لوبیا جهت طراحی و ساخت یک سازه واجد هر دو ژن مذکور که به صورت کایمریک طراحی شده اند استفاده گردید. در طی مراحل ساخت این سازه ها، از ناقلی که دارای دو جایگاه آنزیمهای برشی XbaI و  PacIبرای همسانه سازی ژنهای مورد نظر بین پروموتر CaMV 35S و ترمیناتور  NOSمی باشد استفاده گردید. از سازه ساخته شده در این تحقیق می توان برای پروژه های انتقال ژن به گیاهان مدل و زراعی جهت بررسی اثرات این ژنها و تولید گیاهان تراریخته مقاوم در برابر قارچها استفاده کرد.

واژه های کلیدی: پروتئینهای مهار کننده پلی گالاکتوروناز (PGIP)، سازه بیانی گیاهی، آنزیم پلی گالاکتوروناز (PG)

* نویسنده مسئول، تلفن: 02144580363 ، پست الکترونیکی:  motallebi@nigeb.ac.ir

مقدمه 

 

متداول ترین روش برای مبارزه با بسیاری از بیماریهای قارچی استفاده از انواع قارچ کشهای شیمیایی است. اما این گونه مواد نه تنها از نظر اقتصادی مقرون به صرفه نمی باشند، بلکه باعث آلوده شدن محیط زیست و نیز ایجاد گونه های بیماری زای مقاوم به قارچ کش می شوند. تلاش جهت یافتن جایگزینی مناسب برای این ترکیبات شیمیایی، منجر به استفاده از روشهای مختلف کنترل بیولوژیک این گونه بیماریها شده است (25 و 37).

کاربرد روشهای مولکولی به منظور انتقال ژنهای مقاومت علیه بیماریهای گیاهی، به گیاهان زراعی می تواند به عنوان یک روش تکمیلی مورد استفاده قرار گیرد.

دیواره سلول گیاهی با داشتن ساختار پایدار، اولین سد دفاعی در مقابل پاتوژنها است. از میان ترکیبات سازنده این دیواره، پلی ساکاریدهای پکتینی جزء اصلی دیواره اولیه دولپه ایها (9، 14 و20) و برخی از تک لپه ایها (13) می باشند. قارچها بسته به پتانسیل آنزیمی خود قادر به تخریب این سد دفاعی می باشند. پکتینازها جزء اولین آنزیمهایی هستند که در قارچها جهت نفوذ به سلول گیاهی ترشح می شوند. از میان پکتینازها، پلی گالاکتورونازها (polygalacturonase/PG)، نقش مهمی در تجزیه دیواره سلول گیاهی دارند (21، 31، 40، 42، 43 و 44). این آنزیمها توسط پاتوژن بر روی بافت میزبان ترشح می شوند. تأثیر این آنزیمها باعث ایجاد و رهاسازی قطعات اولیگوگالاکتورونیدی (Oligogalacturonide) می گردد که این قطعات ضمن تأمین منبع کربنی لازم برای رشد قارچ، نفوذ و کلونیزاسیون پاتوژن قارچی را نیز تسهیل می نمایند (39).

پروتئینهای مهار کننده آنزیم پلی گالاکتوروناز (polygalacturonase-inhibiting proteins/PGIP) در به تأخیر انداختن پیشرفت هیف قارچی، کاهش پوسیدگی بافت میزبان، تحریک دیگر پاسخهای دفاعی گیاه و در نهایت توقف کلونیزاسیون قارچی نقش دارند (2، 9، 11 و 20). این مهار کننده ها مولکولهای گلیکوپروتئینی با وزن مولکولی 55-40 کیلودالتون می باشند که به ماتریکس خارج سلولی گیاه با پیوندهای یونی متصل شده اند (23، 35).

ژنهای کد کننده PGIP به صورت خانواده ژنی سازمان دهی شده اند. اعضای مختلف هر خانواده ممکن است پروتئینهایی با صفات تقریباً مشابه کد کنند اما ویژگی و عمل تنظیمی آنها متفاوت است (7 و 17). به عنوان مثال چهار عضو فامیلی PGIP لوبیا PG های قارچهای Botrytis cinerea و Colletotrichum lupini را با میزان اثر بخشی متفاوتی  مهار می کنند و PG قارچ سویه Fusarium moniliforme FC-10 تنها به وسیله PVPGIP2 ممانعت می گردد (14 و 17). گزارشات متعددی نشان می دهد که بیان پروتئینهای مهارکننده فعالیت آنزیم پلی گالاکتوروناز در گیاهان تراریخت جهت کنترل بیماریهای قارچی مورد استفاده قرار گرفته است (22، 24، 26، 34 و 41). در این تحقیق سازه حاوی دو ژن  pgippgip1 به صورت کایمر که به وسیله لینکر حاوی 3 کدون آلانین به هم متصل شده اند جهت تولید پروتئین کایمر  SP-PGIP2-AAA-PGIP1طراحی و سنتز می گردد. از سازه به دست آمده جهت تولید پروتئین کایمری برای مهار همزمان چندین PG با توجه به تنوع و اختصاصی بودن آنها می توان استفاده نمود.

مواد و روشها 

باکتریها و ناقلهای مورد استفاده: در این تحقیق از باکتریE. Coli  سویه DH10B XL1 استفاده گردید.

سازه های مورد استفاده در این تحقیق شامل pBIAH17 و pBIAH23 به ترتیب شامل ژنهای pgip1 و pgip2 با منشاء لوبیا رقم ناز می باشند. همچنین از ناقل pBI121MOD دارای جایگاه برشی آنزیم PacI و نشانگر انتخابی مقاومت به کانامایسین و نیز ناقل pGAPZαA واجد نشانگر انتخابی مقاومت به زئوسین استفاده گردید. آنزیمها، محلولها و بافر های مورد نیاز از شرکت Bio Rad تهیه گردید. تهیه باکتریهای مستعد، واکنش اتصال و انتقال محصول به باکتریهای مستعد، استخراج DNA پلاسمیدی و هضم آنزیمی طبق دستورالعمل (36) انجام شد.

بررسیهای بیوانفورماتیک: با استفاده از نرم افزارهای بیوانفورماتیکی برخی خصوصیات ژنهای pgip2 و pgip1 نظیر میزان درصد AT و GC (http://www.genscript.com/cgi-bin/tools/rare_codon _analysis) و نوع و محل برش آنزیمهای محدود الاثر مشخص گردید. در این آنالیز حضور جایگاه برش برای آنزیمهای XbaI و PacI که جهت همسانه سازی ژن درون ناقل pBI121MOD و آنزیمهای AvrII و NotI جهت همسانه سازی ژن درون ناقل pGAPZαA مد نظر بودند، بررسی شدند. توالیهای کدکننده دو پروتئین PGIP1 و PGIP2 با استفاده از یک لینکر حاوی 3 اسید آمینه آلانین به منظور جلوگیری از تداخل شکل فضایی هریک از پروتئینها به هم متصل شدند. سازه دو ژنی از جهت عدم وجود ترادفهای ناپایدار کننده RNA همچنین انواع ساختارهای دوم mRNA، و نیز از جهت پایداری در سیستم گیاهی با مراجعه به سایتRNA mfold به نشانی اینترنتی (http://mfold.bioinfo.rpi.edu/cgi-bin/rna-form1.cgi) بررسی گردید (19 و 30) پیش بینی ساختار فضایی پروتئین کایمریک مورد مطالعه با استفاده از سایت I-tasser (http://zhanglab.ccmb.med.umich.edu/I-TASSER) به صورت online انجام پذیرفت (1). همچنین نواحی هیدروفوب، هیدروفیل و احتمال گلیکوزیله شدن پروتئین مورد نظر با استفاده از نرم افزارها و داده های موجود در بانک اطلاعات پروتئین (Swiss-Prot و TrEMBL) پیش بینی گردید.

ساخت سازه بیانی:pBIRMpp  ساخت سازه دو ژنی واجد ژنهای pgip1 و pgip2 طبق مراحل زیر انجام شد:

الف- ژن pgip2 که در ناقل pBIAH23 همسانه سازی شده بود با واکنش PCR با استفاده ازآغازگرهای اختصاصی AvrIIpgip2Fw و NotIpgip2Rv (حاوی جایگاه برش آنزیم NotI که با توالی لینکر 3 اسید آمینه آلانین همپوشانی دارد) (جدول 1) و شرایط 94 درجه سانتی گراد به مدت 2 دقیقه، 28 چرخه 94 درجه سانتی گراد به مدت 45 ثانیه، 54 درجه سانتی گراد به مدت 45 ثانیه، 72 درجه سانتی گراد به مدت 60 ثانیه و نهایتاً 5 دقیقه 72 درجه سانتی گراد با آنزیم Pfu پلیمراز (شرکتRoche ) تکثیر شد. محصول  PCRبا آنزیمهای AvrII و NotI هضم شد. همچنین ناقل pGAPZαA نیز با همین آنزیمها هضم گردید. پس از هضم آنزیمی، هر دوقطعه (محصول PCR مربوطه و بدنه ناقل pGAPZαA) روی ژل آگارز یک درصد جداسازی و خالص سازی شدند. پس از واکنش اتصال، محصول به سلولهای مستعد باکتری  E. coliسویه DH10B XL1 با استفاده از الکترو پوریشن منتقل شد. پس ازکشت باکتریها بر روی محیطLB  با نمک پایین و 25 میکروگرم در میلی لیتر آنتی بیوتیک زئوسین به عنوان نشانگر انتخابی، از کلونیهای به دست آمده جهت تأیید ساخت سازه واجد ژن pgip2 توسط تعیین توالی مورد استفاده قرار گرفت.

 

جدول 1- لیست پرایمرهای مورد استفاده برای کلونینگ، تکثیر، تأیید و شناسایی ژنهای pgip1 وpgip2

Primers

Sequence 5¢ to 3¢ 

Orientation

5¢ Poly cloning site

AvrIIpgip2Fw

5'-GCCCTAGG TTAATTAAATGACTCAATTCAATATC

Sense

AvrII XbaI

NotIpgip2Rv

5'-GCGCGGCCGCAGTgcaggcagga

Anti-sense

NotI 

NotIpgip1Fw

5'-CACTATGCGGCCGCAGAGCTATGCAACCCACAAG

Sense

NotI 

PacIpgip1Rv

5'-CACTTGTTAATTAATTAAGTGCAGGAAGGAAGAGGAG

Anti-sense

PacI 

PGIP2linkerF

5' -CTGCCTGCACTGCGGCC

Sense

-

CaMV 35s

5'-GGCGAACAGTTCATACAGATGCT

Sense

 

nosR

5'CGC GAT AAT TTA TCC TAG TTT GC

Anti-sense

 

Aox1Rv

5’-GCAAATGGCATTCTGACATCC-’3

Anti-sense

-

 

 

ب- ژن pgip1 که در ناقل pBIAH17 همسانه سازی شده بود با واکنش PCR با استفاده از آغازگرهای اختصاصی NotIpgip1Fw (حاوی جایگاه برش آنزیم NotI که با توالی لینکر 3 اسید آمینه آلانین همپوشانی دارد) و PacIpgip1Rv (حاوی جایگاه برش آنزیم PacI) (جدول 1) و شرایط 94 درجه سانتی گراد به مدت 2 دقیقه، 28 چرخه 94 درجه سانتی گراد به مدت 45 ثانیه، 54 درجه سانتی گراد به مدت 45 ثانیه، 72 درجه سانتی گراد به مدت 60 ثانیه و نهایتاً 5 دقیقه 72 درجه سانتی گراد با آنزیم Pfu پلیمراز (شرکتRoche ) تکثیر شد. محصول  PCR با آنزیمهای PacI و NotI هضم شد. همچنین پلاسمید نوترکیب به دست آمده از مرحله "الف" نیز با همین آنزیمها هضم گردید. پس از انجام واکنش اتصال، محصول به وسیله الکتروپوریشن به سلولهای E.coli DH10B XL1 منتقل گردید. باکتریهای تراریخت بر روی محیط LB با نمک پایین و 25 میکروگرم در میلی لیتر آنتی بیوتیک زئوسین به عنوان نشانگر انتخابی رشد داده شدند.

ج- جهت انتقال قطعات از پلاسمید نوترکیب به دست آمده از مرحله "ب" به پلاسمید بیانی گیاهی pBI121MOD (pBI121 حاوی جایگاه برش برای آنزیم pacI)، پلاسمید نوترکیب (حاوی ژنهایpgip2  و pgip1 که به وسیله لینکر 3 اسید آمینه ای آلانین به هم متصلند) و پلاسمید pBI121MOD با استفاده از آنزیمهای XbaI/PacI هضم شدند. پس از انجام واکنش اتصال، محصول به دست آمده جهت تکثیر به وسیله الکتروپوریشن به سلولهای E.coli DH10B XL1  منتقل شدند. باکتریهای تراریخت بر روی محیط LB با نمک پایین و 50 میکروگرم در میلی لیتر آنتی بیوتیک کانامایسین به عنوان نشانگر انتخابی رشد داده شدند. کلنیهای حاصل پس از استخراج پلاسمید با استفاده از الگوی PCR و هضم آنزیمی به منظور تأیید ساخت سازه مورد بررسی قرار گرفت.

 

ATGACTCAATTCAATATCCCAGTAACCATGTCTTCAAGCTTAAGCATAATTTTGGTCATT 60
CTTGTATCTTTGAGAACTGCACTCTCAGAGCTATGCAACCCACAAGACAAGCAAGCCCTT 120
CTCCAAATCAAGAAAGACCTTGGCAACCCAACCACTCTCTCCTCATGGCTTCCAACCACC 180
GACTGTTGCAACAGAACCTGGCTAGGTGTTTTATGCGACACCGACACCCAAACATATCGC 240
GTCAACAACCTCGACCTCTCCGGCCTTAACCTCCCAAAACCCTACCCTATCCCTTCCTCC 300
CTCGCCAACCTCCCCTACCTCAATTTTCTATACATTGGTGGCATCAATAACCTCGTCGGT 360
CCAATCCCCCCCGCCATCGCTAAACTCACCCAACTCCACTATCTCTATATCACCCACACC 420
AATGTCTCCGGCGCAATACCCGATTTCTTGTCACAGATCAAAACCCTCGTCACCCTCGAC 480
TTCTCCTACAACGCCCTCTCCGGCACCCTACCTCCCTCCATCTCTTCTCTCCCCAACCTC 540
GTCGGAATCACATTCGACGGCAACCGAATCTCCGGCGCCATCCCCGACTCCTACGGCTCA 600
TTTTCGAAGCTGTTCACGTCGATGACCATCTCCCGCAACCGCCTCACCGGGAAGATTCCG 660
CCGACGTTTGCGAATCTGAACCTGGCGTTCGTTGACTTGTCTCGAAACATGCTGGAGGGT 720
GACGCGTCGGTGTTGTTCGGATCAGATAAGAACACGCAGAAGATACATCTGGCGAAGAAC 780
TCTCTTGCCTTTGATTTGGGGAAAGTGGGGTTGTCAAAGAACTTGAACGGGTTGGATCTG 840
AGGAACAACCGTATCTATGGGACGCTACCGCAGGGACTGACGCAGCTAAAGTTTCTGCAC 900
AGTTTAAATGTGAGCTTCAACAATCTGTGCGGTGAGATTCCTCAAGGTGGGAACTTGCAA 960
AGATTTGACGTTTCTGCTTATGCCAACAACAAGTGCTTGTGTGGTTCTCCTCTTCCTGCC 1020
TGCACTGCGGCCGCAGAGCTATGCAACCCACAAGATAAGCAAGCCCTTCTCCAAATCAAG 1080
AAAGACCTTGGCAACCCAACCACTCTCTCTTCATGGCTTCCAACCACCGACTGTTGTAAC 1140
AGAACCTGGCTAGGTGTTTTATGCGACACCGACACCCAAACATATCGCGTCAACAACCTC 1200
GACCTCTCCGGCCATAACCTCCCAAAACCCTACCCTATCCCTTCCTCCCTCGCCAACCTC 1260
CCCTACCTCAATTTTCTATACATTGGCGGCATCAATAACCTCGTCGGTCCAATCCCCCCC 1320
GCCATCGCTAAACTCACCCAACTCCACTATCTCTATATCACTCACACCAATGTCTCCGGC 1380
GCAATACCCGATTTCTTGTCACAGATCAAAACCCTCGTCACCCTCGACTTCTCCTACAAC 1440
GCCCTCTCCGGCACCCTCCCTCCCTCCATCTCTTCTCTCCCCAACCTCGGAGGAATCACA 1500
TTCGACGGCAACCGAATCTCCGGCGCCATCCCCGACTCCTACGGCTCGTTTTCGAAGCTG 1560
TTTACGGCGATGACCATCTCCCGCAACCGCCTCACCGGGAAGATTCCACCGACGTTTGCG 1620
AATCTGAACCTGGCGTTCGTTGACTTGTCTCGGAACATGCTGGAGGGTGACGCGTCGGTG 1680
TTGTTCGGGTCAGATAAGAACACGAAGAAGATACATCTGGCGAAGAACTCTCTTGCTTTT 1740
GATTTGGGGAAAGTGGGGTTGTCAAAGAACTTGAACGGGTTGGATCTGAGGAACAACCGT 1800
ATCTATGGGACGCTACCTCAGGGACTAGCGCAGCTAAAGTTTCTGCAAAGTTTAAATGTG 1860
AGCTTCAACAATCTGTGCGGTGAGATTCCTCAAGGTGGGAACTTGAAAAGGTTTGACGTT 1920
TCTTCTTATGCCAACAACAAGTGCTTGTGTGGTTCTCCTCTTCCTTCCTGCACTTAA

 

 

 

شکل 1- ترادف اسید نوکلئیک ژن کایمری حاوی pgip1 و pgip2 و رابط حاوی کدون 3 اسید آمینه ای آلانین و نمایش شماتیک دو قطعه مورد نظر که با استفاده از رابط به یکدیگر متصل شده است. توای 1 الی 87 سیگنال پپتید، توالی 88 الی 1026 ژن pgip2، توالی 1027 الی 1035 لینکر، توالی

 1028 الی 1977 ژن pgip1.

 

شکل 2- بررسی میزان درصد GC ژن کایمریک با استفاده از سایت GenScript به صورت online انجام شد ، درصد GC برابر 70/51 محاسبه گردید که برای بیان در میزبان گیاهی توتون مناسب می باشد.


نتایج

بررسی ساختار mRNA و پروتئین کایمری PGIP2-AAA-PGIP1: برای تولید پروتئین کایمریPGIP1  و PGIP2 از لینکر 3 اسید آمینه ای آلانین استفاده گردید. توالی نوکلئوئیدی این 3 اسید آمینه با توالی آنزیمNotI  همپوشانی دارد. از این مشابهت جهت طراحی پرایمرهای مناسب برای اتصال این دو ژن در فرآیند همسانه سازی استفاده گردید. توالی پیشنهادی کایمری sp-pgip2-AAA-pgip1 در شکل 1 ارائه شده است. از آنجا که در این تحقیق هدف انتقال این ژن کایمری به گیاه توتون می باشد لذا محتوی GC آن مورد بررسی قرار گرفت. نتایج به دست آمده نشان داد که میزان GC این ژن 7/51 در صد می باشد. با توجه به پیش بینی بیوانفورماتیکی انجام شده که طیف GC را بین 30 تا 70 نشان می دهد، بنابراین توالی کایمری از محتوای GC مناسبی جهت بیان در گیاه توتون بر خوردار می باشد (شکل 2).

ساختار ثانویه mRNA کایمری pgip2-AAA-pgip1 از لحاظ میزان حداقل انرژی که نشان دهنده میزان پایداری آن می باشد و نیز عدم داشتن ساختار های نامناسب مورد بررسی و ارزیابی قرار گرفت. نتایج نشان داد که در نقطه شروع mRNA کایمری ساختار نامناسبی دیده نمی شود (شکل 3). میزان حداقل انرژی (G∆) این ساختار برابر -177.82 کیلوکالری بر مول می باشد. این میزان، انرژی قابل قبولی برای یک mRNA به منظور ترجمه در سیستم گیاهی می باشد. همچنین ساختار پروتئین حاصل از این ژن مصنوعی مورد مطالعه قرار گرفت. نتایج مربوط به پیش بینی ساختارهای پروتئینی نشان داد که پروتئینهای PGIP1 و PGIP2 به خوبی از یکدیگر متمایز بوده که این امر نشان دهنده عملکرد مناسب لینکر 3 اسید آمینه ای آلانین می باشد (شکل 4). با توجه به متمایز بودنPGIP1  و PGIP2 در پروتئین کایمر، این پروتئین نوترکیب می تواند فعالیت مهارکنندگیPGIP1  و PGIP2 را به طور همزمان داشته باشد.

 

شکل 3- :پیش بینی ساختار ثانویه mRNA مربوطه به ژن کایمری

در نقطه شروع '5 ( آغاز ترجمه)  ساختارهای نامناسب وجود ندارد. علاوه بر آن میزان حداقل انرژی این ساختار ها، حاوی انرژی قابل قبولی برای یک mRNA و به منظور ترجمه در سیستم گیاه توتون می باشد ( پایداری مناسب).

ساخت سازه بیانی  pBIRMpp حاوی ژن کایمری pgip2-AAA-pgip1: به منظور ساخت سازه بیانی حاوی ژن کایمری توالیهای DNA ژنهای pgip1 و pgip2 با توالی لینکر حاوی 3 کدون اسید آمینه آلانین طی فرآیند همسانه سازی (شکل 5) با ترتیب pgip2-AAA-pgip1 در وکتور بیانی pBI121MOD بر اساس مراحل زیر همسانه سازی شد.

 

  

شکل 4- ساختار سوم پروتئین کایمر (sp-pgip2-AAA-pgip1) بر اساس روش  ab initio به وسیله سایت I-tasser پیش بینی شده است. پیش بینی ساختار پروتئینی نشان می دهد که جایگاه فعال دو توالی پروتئینی PGIP1 و  PGIP2در ساختار فضایی به خوبی از یکدیگر متمایز هستند.A ) ساختار فضایی پروتئین کایمر از زاویه ای نمایش داده شده که آزاد و متمایز قرار گرفتن جایگاه فعال پروتئین PGIP2 را نشان می دهد. B) ساختار فضایی پروتئین کایمر از زاویه ای نمایش داده شده که آزاد و متمایز قرار گرفتن جایگاه فعال پروتئین PGIP1 را نشان می دهد.

 

 

الف- ساخت سازه pGAPZαAΔsppgip2 : برای همسانه سازی ژن pgip2 محصول PCR این ژن پس از هضم با آنزیمهای AvrII و NotI در ناقل pGAPZαA هضم شده بااین دو آنزیم وارد شد (شکل 5). جایگاه برش آنزیم NotI تعبیه شده در انتهای '5 آغازگر Reverse، با توالی لینکر 3 اسید آمینه ای همپوشانی دارد لذا می توان برای کد نمودن لینکر 3 اسید آمینه ای آلانین از آن استفاده نمود. واکنش اتصال به سلولهایE.coli  سویه DHB10 منتقل گردید. باکتریهای تراریخت بر روی محیط LB حاوی زئوسین به عنوان نشانگر انتخابی رشد داده شدند. سازه استخراج شده از کلونیهای به دست آمده به نام pGAPZαAΔsppgip2 نامگذاری شده و در مرحله بعدی فرآیند همسانه سازی مورد استفاده قرار گرفت (شکل 5).

ب-ساخت سازه pGAPZαAΔsppgip2aaapgip1 : به منظور همسانه سازی ژن pgip1 در پایین دست ژن pgip2 در سازهpGAPZαAΔsppgip2  (به دست آمده از مرحله قبلی)، محصول PCR این ژن که با استفاده از آغازگرهای اختصاصی NotIpgip1Fw و PacIpgip1Rv به دست آمده بود و همچنین سازه pGAPZαAΔsppgip2 با آنزیمهایNotI  وPacI  هضم شده و ژن مذکور در جایگاه مورد نظر همسانه سازی گردید (شکل 5). سازه pGAPZαAΔsppgip2aaapgip1 به دست آمده حاوی ژنهای pgip2 وpgip1 که به وسیله لینکر 3 اسید آمینه ای آلانین به هم متصل شده اند با استفاده از تعیین توالی مورد تأیید قرار گرفت (شکل 1).

ج- ساخت سازه pBIRMpp : جهت انتقال قطعه کایمری از سازهpGAPZαAΔsppgip2aaapgip1  (به دست آمده از مرحله ب) به ناقل بیانی گیاهی pBI121MOD (pBI121 حاوی جایگاه برش برای آنزیم pacI)، سازه pGAPZαAΔsppgip2aaapgip1 و ناقل pBI121MOD با استفاده از آنزیمهای  XbaPacI هضم شدند. قطعه کایمری مورد نظر در جایگاه  Xba PacI ناقل pBI121MOD هضم شده با این دو آنزیم همسانه سازی گردید (شکل 5).

 

 

 

 

 

 

 

شکل5- شماتیک استراتژی کلونینگ توأم ژنهای pgip1 وpgip2  در ناقل بیانی گیاهی pBI121

 

سازه pBIMODsppgip2aaapgip1 به دست آمده با استفاده از الگوی هضم آنزیمی وPCR  مورد تأیید قرار گرفت (شکل 6). برای سهولت استفاده از نام سازه مذکور، این سازه به نام  pBIRMpp (حاوی ژن کایمری pgip2 و pgip1 که به وسیله لینکر 3 اسید آمینه ای آلانین به هم متصل شده اند) نامگذاری گردید (شکل 5).

بحث

مطالعات مختلف نشان می دهد که در طول کشت گیاهان زراعی کاهش محصول ناشی از حمله قارچهای پاتوژن به گیاهان همواره به عنوان اصلی‏ترین عامل زیانهای اقتصادی محسوب می شود (3 و 43). ژنهای دخیل در مکانیسمهای دفاعی گیاهان بعد از تماس گیاه با یک عامل زنده و یا غیر زنده فعال شده و پروتئینهایی که در ایجاد مقاومت در گیاه نقش دارند را کد می کنند (3، 10، 17، 32 و 38). در آپوپلاست بسیاری از گیاهان دو لپه ای و معدودی از گیاهان تک لپه ای غنی از پکتین (نظیر پیاز، لوبیا، تره و همچنین در آرابیدوپزیز و گل اطلسی) پروتئینهای مهار کننده اندو پلی گالاکتوروناز که از مهم ترین گروه مهار کننده آنزیمهای پکتینازی می باشند، شناسایی شده اند (8 و 9). PGIPها یکی از مهم ترین ژنهای دفاعی گیاهان در مقابل حملات پاتوژنها می باشند (10، 15 و 39). که به صورت اختصاصی قادر به مهار فرمهای ایزوآنزیمی آنزیم پلی گالاکتوروناز می باشند (39). از آنجا که پروتئینهای PGIP با مهار فعالیت آنزیم پلی گالاکتوروناز، قادرند مانع نفوذ قارچ و کلونیزاسیون آن در گیاه میزبان گردند (10، 12 و 17) و با توجه به اینکه که بیان PGIP در گلابی، تنباکو، آرابیدوپسیس، برنج، گوجه فرنگی، سیب زمینی و انگور ترانس ژنیک، گسترش بیماری توسط تعدادی از قارچهای مختلف را کاهش می دهد (16،33 و 41). بنابراین انتقال ژنهای مقاومت در برابر بیماریها از جمله انتقال ژنهای pgip به گیاهان از طریق روشهای بیوتکنولوژی راه مؤثری برای کنترل بیماریها بوده و از اهمیت اقتصادی بالایی برخوردار می باشد (27 و 37).

 

 

  

                        A         

 

B  

شکل 6-A- شکل شماتیک کاست بیانی کایمری ، محل آغازگرها و همچنین جایگاه آنزیمهای برشی مشخص شده است.

B) تأیید سازه pBIRMpp توسط هضم آنزیمی و PCR. 1: محصول PCR با جفت پرایمرهای 35SFw/NosRv. 2: محصول PCR با جفت پرایمرهای .pgip2linkerFw/NosRv 3: الگوی هضم آنزیمی سازه pBIRMpp با آنزیمهای (PacI و XbaI). 4: الگوی هضم آنزیمی سازه pBIRMpp با آنزیمهای (PacI و NotI).M : نشانگر مولکولیplus   Ladder 1Kb. 

 

در این تحقیق سازه واجد ژن کایمری pgip1 sp-pgip2–AAA- حاوی ژنهای pgip1 و pgip2 که به وسیله لینکر 3 اسید آمینه ای آلانین به هم متصل شده اند جهت انتقال به گیاه طراحی و ساخته شد. این طراحی به نحوی است که به طور همزمان هر دو نوع پروتئین خاصیت مهاری خود را اعمال خواهند کرد.

 لینکر های آلانین در تولید پروتئینهای کایمری به طور معمول استفاده می گردد، مطالعه تأثیر طول لینکر آلانین در پایداری و فعالیت پروتئین به وسیله Clifford et al (1998) انجام شده است. این لینکرها به دلیل هیدروفوب بودن باعث متمایز و مجزا قرار گرفتن دو پروتئین به هم متصل شده می گردد و لذا دو پروتئین متصل شده می توانند فعالیت بیولوژیکی خود را حفظ کنند (5، 28 و 29). آنالیز های بیوانفورماتیکی در این تحقیق هم نشان داد که پروتئینهای متصل شده به وسیله لینکر آلانین از نظر ساختار فضایی از هم کاملاً متمایز می باشند به نحوی که در پروتئین کایمر هر دو پروتئین می تواند فعالیت مهارکنندگی خود را حفظ نموده و پس از تولید به صورت بخشهای جدا از هم فعالیت مهاری داشته باشند.

همچنین در این تحقیق ساختار ثانویه mRNA کایمری pgip2-AAA-pgip2 از لحاظ میزان حداقل انرژی که نشان دهنده میزان پایداری آن می باشد و نیز عدم داشتن ساختار های نامناسب مورد بررسی و ارزیابی قرار گرفت و مشخص گردید که میزان حداقل انرژی (G∆) این ساختار، انرژی قابل قبولی برای یک mRNA به منظور ترجمه در سیستم گیاهی می باشد.

فن آوری دستیابی به پروتئینهای کایمری یک استراتژی کارآمد با صرفه اقتصادی و پرسرعت برای بیان پروتئینهایی است که بتوانند به طور همزمان فعالیت داشته باشند. ساخت این نوع پروتئینها در تولید داروهای چند منظوره بیشتر مورد توجه قرار گرفته است (4، 5 و 18). پروتئینهای کایمریک نوترکیب بیشتری امروزه تحت اهداف و عناوین مختلفی مانند واکسن، دارو و غیره طراحی و تولید شده است. مانند پروتئین کایمریک GA733-Fc که به عنوان کاندیدای واکسن برای سرطان کلورکتال می باشد نام برد (45) و پروتئین کایمریک مهارکننده ویروس HIV-1 است که گلیکوپروتئین gp41 ویروسی را با پتانسیل و پایداری بالا مورد هدف قرار می دهد (6).

با استفاده از سازه به دست آمده در این تحقیق می توان جهت تولید پروتئین کایمری حاوی دو ژن pgip1 و pgip2 در گیاهان مورد نظر برای مهار فعالیت فرمهای مختلف آنزیم پلی گالاکتوروناز قارچهای بیماری زا استفاده نمود.

تشکر و قدردانی: بدین وسیله از همکاری علمی پروفسور Giulia De Lorenzo از دانشگاه Sapienza Università di Roma در اجرای این تحقیق سپاسگزاری می گردد. همچنین از پژوهشگاه ملی مهندسی ژنتیک و زیست فناوری به دلیل تأمین بوجه پژوهشی این تحقیق (طرح 353) تشکر و قدردانی به عمل می آورد.

1. Ambrish, R., Alper, K., and Yang, Z. (2010). I-TASSER: a unified platform for automated protein structure and function prediction. Nat Protoc. 5(4), 725–738.

2. Boller, T., Felix G. (2009). A renaissance of elicitors: perception of microbe-associated molecular patterns and danger signals by pattern-recognition receptors. Annual Review of Plant Biology 60, 379-406.

3. Bolton, M.D., Thomma, B.P., Nelson, B.D. (2006). Sclerotinia sclerotiorum (Lib.) de Bary: Biology and molecular traits of a cosmopolitan pathogen. Mol Plant Pathol 7, 1–16.

4. Center, R.J., Kobe, B., Wilson, K.A., Teh, T., Howlett, G.J., Kemp, B.E., and Poumbourios, P. )1998(. Crystallization of a trimeric human T cell leukemia virus type 1 gp21 ectodomain fragment as a chimera with maltose-binding protein. Protein Sci. 7, 1612–1619.

5. Clifford, R., Robinson and Robert, T., Sauer (1998). Optimizing the stability of single-chain proteins by linker length and composition mutagenesis. Proc. Natl. Acad. Sci. USA. Vol. 95, pp. 5929–5934.

6. Chungen, P., Lifeng, C., Hong, L., Lu, L., and Shibo, J. (2011). A Novel Chimeric Protein-based HIV-1 Fusion Inhibitor Targeting gp41 Glycoprotein with High Potency and Stability. J Biol Chem. 12; 286(32): 28425–28434.

7. Cook, B.J., Clay, R.P., Bergmann, C.W., Albersheim, P., Darvill, A.G. (1999). Fungal polygalacturonases exhibit different substrate degradation patterns and differ in their susceptibilities to polygalacturonaseinhibiting proteins. Mol. Plant Microbe In. 12, 703–711.

8. De Lorenzo, G., D'Ovidio, R., Cervone, F. (2001). The role of polygacturonase-inhibiting proteins (PGIPs) in defense against pathogenic fungi. Annual Review of Phytopathology 39, 313-335.

9. De Lorenzo, G., F. Cervone, D. Bellicampi, C. Caprari,  A.J. Clark, A. Desiderio, A. Devoto, R. Forrest, F. Leckie, L. Nuss and G. Salvi. (1994). Polygalacturonase, PGIP and oligogalacturonides in cell–cell communication. Biochem. Sci. Trans. 22, 396–399.

10. De Lorenzo, G., Ferrari S. (2002). Polygalacturonase-inhibiting proteins in defense against phytopathogenic fungi. Current Opinion in Plant Biology 5, 295-299.

11. De Lorenzo, G., R. Castoria, D. Bellincampi and F. Cervone. (1997). Fungal invasion enzymes and their inhibition. in: Carrol, G. and P. Tudzynski. Eds., The Mycota. V. Plant Relationships Part B. Springer, Berlin, pp. 61–83.

12. Desiderio, A., Aracri, B., Leckie, F., Mattei, B., Salvi, G., Tigelaar, H., Van Roekel JSC., Baulcombe, D.C., Melchers, L.S., De Lorenzo, G., Cervone ,F. (1997).  Polygalacturonase-inhibiting proteins (PGIPs) with different specificities are expressed in Phaseolus vulgaris. Mol Plant-Microbe Interact 10, 852–860.

13. Dixon, M., D. Jones, J. Keddie, C. Thomas, K. Harison and J. Jones. (1996). The tomato Cf-2 disease resistance locus comprises two functional genes encoding leucine-rich repeats proteins. Cell. 84, 457–459.

14. Favaron, F., R. D’ovidio, E. Porceddu and P. Alghisi.(1994). Purification and molecular characterization of a soybean polygalacturonase-inhibiting protein. Planta. 195, 80–87.

15. Federici, L., Di Matteo, A., Fernandez Recio, J., Tsernoglou, D., Cervone, F. (2006). polygalacturonase inhibiting proteins: players in plant innate immunity? Trends in Plant Science 11, 65-70.

16. Ferrari, S., Sella, L., Janni, M., De Lorenzo, G., Favaron, F., D’Ovidio, R. (2012). Transgenic expression of polygalacturonase-inhibiting proteins in Arabidopsis and wheat increases resistance to the flower pathogen Fusarium graminearum. Plant Biology 14(1), 31-38.

17. Ferrari, S., Vairo, D., Ausubel, F.M., Cervone, F., De Lorenzo, G. (2003). Tandemly duplicated Arabidopsis genes that encode polygalacturonase-inhibiting proteins are regulated coordinately by different signal transduction pathways in response to fungal infection. The Plant Cell 15, 93-106.

18. Giavedoni, L.D., Jones, L., Gardner, M.B et al. (1992) Vaccinia virus recombinants expressing chimeric proteins of human immunodeficiency virus and ginterferon are attenuated for nude mice. Proc Natl Acad Sci USA, 89, 3409–13.

19. Gustafsson, C., Govindarajan S and Minshull, J. (2004). Codon bias and heterologous protein expression. TRENDS in Biotechnology Vol.22 No.7 July

20. Hahn, M.G., P. Buchell, F. Cervone, S.H. Doares, R.A. O’Neill, A. Darvill and P. Albersheim. (1989). Roles of cell wall constituents in plant pathogen interactions. in: E. Nester and T. Kosuge, Eds., Plant–Microbe Interactions. McGraw-Hill, New York, pp 131–181.

21. Huang, Q., and C. Allen. (2000). Polygalacturonases are required for rapid colonization and full virulence of Ralstonia solanacereaum on tomato plants. Physiol. Mol. Plant Pathol. 57, 77–83.

22. Janni, M., Sella, L., Favaron, F., Blechl, A.E., De Lorenzo, G., D'Ovidio, R. (2008). The expression of a bean polygalacturonase-inhibiting protein in transgenic wheat confers increased resistance to the fungal pathogen Bipolaris sorokiniana. Molecular Plant-Microbe Interactions 21, 171-177.

23. Johnston, D.J., B. Williamson and G.P. Mcmillan. (1994). The interactions in planta of polygalacturonases from Botrytis cinerea with a wall-bound polygalacturonase-inhibiting protein (PGIP) in raspberry fruits. J. Exp. Bot. 45: 1837–1843.

24. Joubert, D.A., Kars, I., Wagemakers, L., Bergmann, C., Kemp, G., Vivier, M.A., van Kan, J.A.L. (2007). A polygalacturonase-inhibiting protein from grapevine reduces the symptoms of the endopolygalacturonase BcPG2 from Botrytis cinerea in Nicotiana benthamiana leaves without any evidence for in vitro interaction. Molecular Plant-Microbe Interactions 20, 392-402.

25. Kubicek C.P., Mach R.L., Peterbauer C.K., and Lorito M. (2001). Trichoderma: from genes to biocontrol. Journal of Plant Pathology. 83(2), 11-23.

26. Manfredini, C., Sicilia, F., Ferrari, S., Pontiggia, D., Salvi, G., Caprari, C., Lorito, M., De Lorenzo, G. (2005). Polygalacturonase-inhibiting protein 2 of Phaseolus vulgaris inhibits BcPG1, a polygalacturonase of Botrytis cinerea important for pathogenicity, and protects transgenic plants from infection. Physiological and Molecular Plant Pathology 67, 108-115.

27. Martin, A., Camacho, M., Portaels, F. & Palomino, J. C. (2003). Resazurin microtiter assay plate testing of Mycobacterium tuberculosis susceptibilities to second-line drugs: rapid, simple, and inexpensive method. Antimicrob Agents Chemother 47, 3616–3619.

28. Masahiro, W., Yumiko, M., Ichiro, Y., Sam-Yong, P., Jeremy, R.H.,  and Jonathan G,. H. (2008). Intersubunit linker length as a modifier of protein stability: Crystal structures and thermostability of mutant TRAP. Protein Sci. 17(3), 518–526.

29. McWherter, C.A., Feng, Y., Zurfluh, L., Klein, B.K., Baganoff M.P., Polazzi, J.O., Hood, W.F., Paik, K., Abegg, A.L., Grabbe E.S et Al. (1999). Circular permutation of the granulocyte colony-stimulating factor receptor agonist domain of myelopoientin. Biochemistery. 38, 4564-4571.

30. Michael, Z. (2003). Mfold web server for nucleic acid folding and hybridization prediction. Nucleic Acids Research Vol. 31, No. 13.

31. Motallebi, M., M.R. Zamani and A. Hosseinzadeh Colagar. (2003). Relationship between polygalacturonase activity and pathogenicity among Iranian isolates of Ascochyta rabiei. J.Sci & Technol. Agric & Natur. Resour., Winter 2003, Ifahan. Univ. Technol. Isfahan. Iran.  6(4), 159-169.

32. Newman, M.A et al. (1994). Defense related gene induction in Brassica campestris in response to defined mutants of Xanthomonas campestris with altered pathogenicity. Mol. Plant Microbe Interact, 7, 553–563.

33. Oelofse, D. et al. (2006). Apple polygalacturonase inhibiting protein1 expressed in transgenic tobacco inhibits polygalacturonases from fungal pathogens of apple and the anthracnose pathogen of lupins. Phytochemistry 67, 255–263.

34. Powell, A.L.T., van Kan, J., ten Have, A., Visser, J., Greve, L.C., Bennett, A.B., Labavitch, J.M. (2000). Transgenic expression of pear PGIP in tomato limits fungal colonization. Molecular Plant-Microbe Interactions 13, 942-950.

35. Salvi, G., F. Giarrizzo, G. De Lorenzo  and F. Cervone. (1990). A polygalacturonase-inhibiting protein in the flowers of Phaseolus vulgaris L. Plant Physiology. 136: 513-518.

36. Sambrook, J., and Russell, D.W. (2001). Molecular Cloning A Laboratory manual. 3rd Edition Cold Spring Harhor Press.New York.

37. Scholten, O.E., Klein-Lankhorst, R.M., Esselink, D.G., De Bock, T.S., Lange. W. (1997). Identification and mapping of random amplified polymorphic DNA (RAPD) markers linked to resistance against beet necrotic yellow vein virus (BNYVV) in Beta accessions.Theor Appl Genet. 94(1), 123-30.

38. Seidl V., Schmoll M., Scherm B., Balmas V., Seiboth B., Migheli Q., Kubicek C P. (2006). Antagonism of Pythium blight of Zucchini by Hypocrea jecorina does not require cellulase gene expression but is improved by carbon catabolism derepression. FEMS Microbiology Letters, Volume 257 Page 145  - April 2006.

39. Shanmugam, V. (2004). Role of extracytoplasmic leucine rich repeat proteins in plant defence mechanisms. J. Microbiological Research, 09-014.

40. Shieh, M.T., R.L. Brown, M.P. Whitehead, J.W. Cary, P.J. Cotty, T.E. Cleveland and R.A. Dean. (1997). Molecular genetics evidence for the involvement of a specific polygalacturonase, P2c, in the invasion and spread of Aspergillus flavus in cotton balls. Appl. Environ. Microbiol. 63, 3548–3552.

41. Tamura, M., Gaob, M., Tao, R., Labavitch, J.M., Dandekar, A.M. (2004). Transformation of persimmon with a pear fruit polygalacturonase inhibiting protein (PGIP) gene. Sci Hort 103, 19–30.

42. ten Have, A., W. Mulder, J. Visser and J.A. van Kan. (1998). The endopolygalacturonase gene Bcpg 1 is required for full virulence of Botrytis cinerea. Mol. Plant Microbe Interact. 11, 1009–1016.

43. Williamson, B., Tudzynski, B., Tudzynski, P., van Kan, J.A.L. (2007). Botrytis cinerea: The cause of grey mould disease. Mol Plant Pathol 8, 561–580.

44. Zamani, M.R., M. Motallebi  and M.A. Arefpour. (2000). Comparative study of polygalacturonase activity from different Iranian isolates of Fusarium oxysporum. Iranian Journal of Agricultural Science. 31, 293-302.

45. Zhe, L., Kyung-Jin, L., Yingxue, S., Jeong-Hwan, L., Yangkang, S., Young-Kug, C., Doo-Byoung, O., Kyung-A, H., Seung, H.h., Yeon, S.n., and Kisung, K. (2012). Expression of GA733-Fc Fusion Protein as a Vaccine Candidate for Colorectal Cancer in Transgenic Plants. Journal of Biomedicine and Biotechnology. Volume 2012, Article ID 364240, 11 pages