نوع مقاله: مقاله پژوهشی

چکیده

لکتین متصل شونده به مانوز (MBL) جزء خانواده کالکتین ها بوده و در فعال سازی سیستم کمپلمان ایمنی ذاتی از مسیر لکتین نقش دارد. MBL  به عنوان اپسونین، فرآیند ذره خواری و حذف میکروارگانیسم بیگانه را تسهیل می کند. این پروتئین نقش مهمی در سلامت افراد دارد، به ویژه افرادی که دارای نقص سیستم ایمنی اولیه هستند، در صورتی که در پروتئین MBL هم نقص داشته باشند عوارض کلینیکی بیشتری را بروز می دهند. سلامت و صحت کارکرد این پروتئین در نوزادان هم بسیار حائز اهمیت است. همچنین گزارشاتی مبنی بر  نقش کمبود MBL در بیماریهایی مثل ایدز، روماتوئید ارتریت، لوپوس و انواع عفونتهای باکتریایی از جمله لیشمانیا، وجود دارد. بنابراین، با توجه به نقش کلینیکی این پروتئین، نیاز به انجام چنین پژوهشی در خصوص این پروتئین و وضعیت ان در کشور، احساس می شد. هدف از این انجام این مطالعه، به دست آوردن اطلاعاتی پایه راجع به شیوع کمبود این پروتئین مهم در جمعیت کشور و محاسبه سطح میانگین این پروتئین در خون بود. نتایج این مطالعه می تواند در آینده در مطالعات تکمیلی راجع به نقش کمبود MBL در انواع عفونتها، به خصوص عفونتهای مکرر، و همین طور یافتن راههای درمانی برای این مسئله، مفید واقع شود. پروتئین MBL توسط ژن  mbl2واقع بر روی کروموزوم 10، رمزگذاری می شود. ژن mbl2 چهار اگزون دارد که پلی مورفیسم در اگزون 1 آن، تأثیر بیشتری بر سطح سرمی MBL دارد. طبق گزارشاتی که قبلاً منتشرشده اند، پلی مورفیسم در کدونهای 52، 54 و 57 بیشترین تأثیر را بر سطح سرمی MBL می گذارد. در این پژوهش وضعیت پلی مورفیسم در اگزون 1 این ژن، در 143 نفر از جمعیت سالم شهر تهران، که به سازمان انتقال خون تهران مراجعه کرده اند، بررسی شد. همچنین سطح سرمی پروتئین MBL در این افراد با استفاده از تکنیک الایزا مشخص شد. مقایسه نتایج به دست آمده از تعیین توالی DNA این افراد، و بررسی ارتباط آن با سطح سرمی MBL، نشان داد که در جمعیت مورد بررسی، پلی مورفیسم در کدون 54، علاوه بر ان که نسبت به پلی مورفیسم در 2 کدون دیگر فراوانی بیشتری دارد، تأثیر بیشتری نیز در کم کردن سطح سرمی پروتئین MBL دارد. به علاوه بر خلاف انتظار، در ناحیه 5 ́ UTR هیچ پلی مورفیسمی مشاهده نشد و تمامی افراد در این جایگاه دارای آلل P بودند.

کلیدواژه‌ها

عنوان مقاله [English]

Association study of mbl2 exon 1 polymorphisms and its relation to serum MBL level in tehran population

چکیده [English]

Mannose Binding Lectin (MBL) is a major initiator of the lectin pathway (LP) of complement System. MBL produced by the liver and involved in the innate immunity response. We have analyzed three SNPs of mbl2 gene at the exon 1 individuals of a random population residing in Tehran (N=143), and have correlated genotypes with respective MBL serum concentration. Polymorphisms in exon 1 of the MBL are reported to be associated with impaired MBL function and in response of the body to infection. Three different mutations within exon 1 of the MBL gene have been described, each causing MBL deficiency. Three SNPs in exon 1 were genotyped using PCR amplification. Plasma level of MBL were quantified using ELISA. Our research showed 3 variant polymorphisms at codon 52(D Allele), 54(B Allele), 57(C Allele) of mbl2 gene affecting the protein level in plasma. B allele was significantly correlated with the lowest MBL level.

کلیدواژه‌ها [English]

  • mannose-binding lectin
  • mbl2
  • Polymorphism

بررسی چند شکلی ­ژنتیکی اگزون 1 ژن mbl2 و ارتباط آن با سطح سرمی پروتئین MBL در جمعیت منتخبی از شهر تهران

احمد سلطانی1، سارا رحمتی راد1، زهرا پورپاک2، زهرا علیزاده2، بشیر حاجی بیگی3، مجید زیدی3 و علی فرازمند4،*

1 کیش، دانشگاه تهران، پردیس بین المللی کیش، گروه سلولی و مولکولی

2 تهران، دانشگاه علوم پزشکی تهران، مرکز تحقیقات ایمونولوژی آسم و آلرژی

3 تهران، سازمان انتقال خون

4 تهران، دانشگاه تهران، پردیس علوم، دانشکده زیست شناسی، گروه سلولی و مولکولی

تاریخ دریافت: 15/12/90             تاریخ پذیرش: 16/5/92 

چکیده

لکتین متصل شونده به مانوز (MBL) جزء خانواده کالکتین ها بوده و در فعال سازی سیستم کمپلمان ایمنی ذاتی از مسیر لکتین نقش دارد. MBL  به عنوان اپسونین، فرآیند ذره خواری و حذف میکروارگانیسم بیگانه را تسهیل می کند. این پروتئین نقش مهمی در سلامت افراد دارد، به ویژه افرادی که دارای نقص سیستم ایمنی اولیه هستند، در صورتی که در پروتئین MBL هم نقص داشته باشند عوارض کلینیکی بیشتری را بروز می دهند. سلامت و صحت کارکرد این پروتئین در نوزادان هم بسیار حائز اهمیت است. همچنین گزارشاتی مبنی بر  نقش کمبود MBL در بیماریهایی مثل ایدز، روماتوئید ارتریت، لوپوس و انواع عفونتهای باکتریایی از جمله لیشمانیا، وجود دارد. بنابراین، با توجه به نقش کلینیکی این پروتئین، نیاز به انجام چنین پژوهشی در خصوص این پروتئین و وضعیت ان در کشور، احساس می شد. هدف از این انجام این مطالعه، به دست آوردن اطلاعاتی پایه راجع به شیوع کمبود این پروتئین مهم در جمعیت کشور و محاسبه سطح میانگین این پروتئین در خون بود. نتایج این مطالعه می تواند در آینده در مطالعات تکمیلی راجع به نقش کمبود MBL در انواع عفونتها، به خصوص عفونتهای مکرر، و همین طور یافتن راههای درمانی برای این مسئله، مفید واقع شود. پروتئین MBL توسط ژن  mbl2واقع بر روی کروموزوم 10، رمزگذاری می شود. ژن mbl2 چهار اگزون دارد که پلی مورفیسم در اگزون 1 آن، تأثیر بیشتری بر سطح سرمی MBL دارد. طبق گزارشاتی که قبلاً منتشرشده اند، پلی مورفیسم در کدونهای 52، 54 و 57 بیشترین تأثیر را بر سطح سرمی MBL می گذارد. در این پژوهش وضعیت پلی مورفیسم در اگزون 1 این ژن، در 143 نفر از جمعیت سالم شهر تهران، که به سازمان انتقال خون تهران مراجعه کرده اند، بررسی شد. همچنین سطح سرمی پروتئین MBL در این افراد با استفاده از تکنیک الایزا مشخص شد. مقایسه نتایج به دست آمده از تعیین توالی DNA این افراد، و بررسی ارتباط آن با سطح سرمی MBL، نشان داد که در جمعیت مورد بررسی، پلی مورفیسم در کدون 54، علاوه بر ان که نسبت به پلی مورفیسم در 2 کدون دیگر فراوانی بیشتری دارد، تأثیر بیشتری نیز در کم کردن سطح سرمی پروتئین MBL دارد. به علاوه بر خلاف انتظار، در ناحیه 5 ́ UTR هیچ پلی مورفیسمی مشاهده نشد و تمامی افراد در این جایگاه دارای آلل P بودند.

واژه های کلیدی: لکتین متصل شونده به مانوز ، mbl2 ، مسیر لکتین ، پلی مورفیسم تک نوکلئوتیدی

* نویسنده مسئول، تلفن: 61112476-021 ، پست الکترونیکی: afarazmand@khayam.ut.ac.ir

 

مقدمه

 

لکتین متصل شونده به مانوز (MBL) یکی از اجزای مهم در ایمنی ذاتی است که توسط هپاتوسیت ها در کبد تولید می شود. MBL جزء خانواده کالکتین ها بوده و برای عملکرد خود نیاز به حضور کلسیم در محیط دارد (5و6) . MBL در فعال سازی سیستم کمپلمان از مسیر لکتین نقش دارد و برای این کار، از یک طرف به قند موجود در دیواره خارجی میکروارگانیسم ها، و از طرف دیگر به سرین پروتئازهایی به نام MASP متصل می شود. پس از این اتصال، MBL که نقشی همانند مولکول C1q در مسیر کلاسیک کمپلمان دارد (2)، موجب راه اندازی آبشار فعال سازی کمپلمان می شود و از این طریق باعث حذف میکروارگانیسم مهاجم می شود(6 و 9). به طور کلی مولکول MBL که هوموتریمری از زیر واحد های مشابه است، از بخشهای زیر تشکیل می شود: دمین متصل شونده به کربوهیدارت (CRD) در پایانه C ، ناحیه خمیده، ناحیه کلاژنی و یک ناحیه غنی از سیستئین در پایانه N (8 و 10) (شکل 1). وقوع برهمکنشهای هیدروفوبیک و پیوندهای دی سولفیدی، به خصوص در پایانه N، کمک زیاد به پایداری مولکول MBL می کند.

 

شکل 1- نمایی کلی از MBL و دمین CRD

پروتئین MBL توسط ژن  mbl2واقع بر روی بازوی بلند کروموزوم10 (در موقعیت10q11.2-q21)، رمزگذاری می شود و 4 اگزون دارد. MBL وزن مولکولی بین kDa700-400 داشته و فرم فعال ان به صورت تترامر است(10 و 11). از بین پلی مورفیسم های گوناگون موجود در اگزون 1 ژن mbl2، پلی مورفیسم در کدونهای 52، 54 و 57 ، بیشترین تأثیر را بر سطح سرمی این پروتئین دارد که به ترتیب با آلل های D  ، B وC  نشان داده می شوند. به علاوه، در موقعیت 4+ در 5 ́ UTR هم یک پلی مورفیسم گزارش شده است که در آن نوکلئوتید C (آلل P) بهT  (آلل Q) تبدیل می شود. در کدون 52 ، نوکلئوتید C با T و درکدونهای 54 و 57 ، نوکلئوتید G با A جانشین می شود (3، 5 و 9) (شکل 2).

در نتیجه این جابه جاییها، در کدون 52 امینو اسید ارژینین به سیستئین، در کدون 54 گلایسین به اسید اسپارتیک و در کدون 57 گلایسین به اسید گلوتامیک تبدیل می شود. به طور کلی، ژنوتیپ دارای جهش با O و حالت نرمال ژنوم، با A نشان داده می شود (6، 7 و 9).

مواد و روشها

نمونه های خون: تعداد 143 فرد سالم داوطلب اهدای خون، وارد مطالعه شدند. سلامتی این افراد توسط پزشک و به وسیله انجام تستهای غربالگری انتقال خون ایران تأیید شد. نمونه های خون در دو لوله گردآوری شد: یک لوله حاوی cc5 خون کامل به همراه EDTA برای استخراج DNA ، و لوله دیگر حاوی cc5 خون کامل به همراه ژل سیلیکونی جدا کننده، به منظور جداسازی سرم از خون و تعیین سطح سرمی MBL توسط انجام  تکنیک الایزا.

استخراج DNA : استخراج DNA از نمونه های خون ، به روش Salting-Out و به صورت دستی انجام شد. در این روش، ابتدا طی چند مرحله، با استفاده از محلولهای لیز کننده و انجام سانتریفیوژ، سلولها لیز می شوند و عصاره سلولی به دست می آید. سپس با استفاده از آنزیم پروتئیناز K هضم پروتئینهای سلولی انجام می گیرد و به وسیله NaCl این پروتئینها رسوب داده  می شوند،  در  نهایت  از

اتانول مطلق برای پاکسازی نمونه DNA استفاده می شود.

 

 

5 ́ UTR

Exon 1

 

 

nt pos:

+4

+223

+230

+239

allele:

P to Q

A to D

A to B

A to C

nt sub:

C to T

C to T

G to A

G to A

aa Sub:

 

Arg52Cys

(R52C)

Gly54Asp

(G54D)

Gly57Glu

(G57E)

شکل 2- نمایی از نفاط دارای پلی مورفیسم در اگزون 1 و  ناحیه ی ترجمه نشونده ی ́ 5 و معرفی آلل ها و نوکلئوتیدها در هر جایگاه (9)  


PCR : نمونه های DNA استخراج شده، با استفاده از یک جفت پرایمر اختصاصی اگزون 1، برای تکثیر کل اگزون -256 نوکلئوتید- توسط تکنیک PCR تکثیر شدند. اطلاعات مربوط به پرایمر مورد استفاده، در جدول 1 آمده است. پرایمر با استفاده از نرم افزار Primer 3 طراحی، و توسط شرکت سیناژن تولید شد. حجم کل محلول مورد استفاده برای تکثیر هر نمونه، lµ20 در نظر گرفته شد که شامل این مواد بود: µl5/0 از هریک از پرایمرهای بالا دست و پایین دست، lµ8/0 MgCl2 ، µl5/0 dNTP، lµ5/2 بافر، lµ2/0 انزیم، lµ14 اب و lµ1 از نمونه ی DNA با غلظت µg/µl1/2  . تمام نمونه های DNA ابتدا برای جدا شدن دو رشته DNA به مدت دو دقیقه در 95 درجه سانتی گراد قرار گرفتند و پس از اتصال پرایمرها و شروع تکثیر DNA در دمای 58 درجه سانتی گراد، مرحله گسترش محصولات PCR به مدت 5 دقیقه در دمای 72 درجه سانتی گراد صورت پذیرفت. سپس برای اطمینان از انجام درست PCR و حصول نتیجه، محصولات حاصل از PCR بر روی ژل آگارز 5 درصد با تکنیک الکتروفورز مورد ارزیابی قرار گرفتند (شکل3).

تعیین توالی DNA های تکثیر شده: 143 نمونه DNA حاصل از تکثیر توسط PCR، برای تعیین توالی و مشخص شدن نواحی چند شکل، به شرکت ماکروژن(macrogen) در کره جنوبی ارسال شدند. نتایج حاصل، توسط نرم افزار BioEdit آنالیز شده، و نقاط دارای چند شکلی مشخص شدند. تصاویری از گرافهای حاصل از تعیین توالی و آنالیز نتایج توسط نرم افزار BioEdit در شکلهای 4 و 5 مشخص است.

 

شکل 3- تصویر نمونهPCR  شده بر روی ژل آگارز. دو باندی که در تصویر بالا در ناحیه حدود 300 کیلو بازی مشخص اند، حاصل تکرار یک نمونه اند. پایین ترین باند مربوط به DNA الگو در سمت چپ تصویر، 100 جفت باز طول دارد.

 

تعیین سطح سرمی MBL : برای تعیین سطح سرمی MBL، ابتدا پلاسمای نمونه خون این افراد توسط سانتریفیوژ جدا شد و سپس به کمک کیت تشخیص MBL توسط الایزا – Functional MBL ELISA kit(ligand elisa), Sanquin Reagents - سطح سرمیMBL در هریک از این افراد مشخص شد. در این کیت الایزا، ابتدا مانان به عنوان سوبسترای MBL بر روی سطح میکروچاهکهایی قرار می گیرد و در مرحله بعد پلاسما به این چاهکها افزوده می شود. فرم فعال و تترامر MBL ، به وسیله HRP متصل به آنتی بادی ضد MBL، شناسایی می شود و غلظت ان، با توجه به مقدار جذب نوری آن در nm450، محاسبه می گردد.

آنالیزهای اماری و محاسباتی: نتایچ پلی مورفیسم های به دست آمده و داده های مربوط به سطوح سرمی MBL ، به همراه اطلاعات مربوط به سن و جنس این 143 نفر، برای انجام آنالیزهای آماری و ایجاد ارتباط منطقی بین داده ها، در نرم افزار SPSS مورد تجزیه و تحلیل قرار گرفت.

نتایج

در جمعیت مورد مطالعه، هیچ پلی مورفیسمی در موقعیت 4+ در 5 ́ UTR دیده نشد. به عبارت دیگر، تمامی افراد در این جایگاه دارای آلل P بودند. از این 143 نفر، 95 نفر (2/64 درصد) در هیچ یک از کدونهای 52 ، 54  و 57 ، چند شکلی نشان ندادند. 20 نفر (5/13 درصد) دارای پلی مورفیسم در کدون 52 (آلل D) بودند و 27 نفر (18.2%) در کدون 54 (آلل B) پلی مورفیسم داشتند. در کدون 57 (آلل C) تنها یک مورد پلی مورفیسم به صورت هتروزیگوت مشاهده شد که این نتیجه از لحاظ آماری قابل استناد نیست. اطلاعات موبوط به نوع و فراوانی هریک از پلی مورفیسم های دیده شده، در جدول 2 قابل مشاهده است.

 

 

 

شکل 4- تصویری از نوکلئوتیدهای مرتب شده برای Align در نرم افزار BioEdit

جدول 1- توالی جفت پرایمر مورد استفاده برای تکثیر اگزون 1

دمای اتصال

اندازه محصول تکثیر شده

توالی پرایمر ́ 5

توالی پرایمر ́ 3

C°58

bp336

ACAGAACAGCCCAACACGTA

CCAGGGATGGGTCATCTATTT

 

شکل 5- قسمتی از گراف یک نمونه DNA تعیین توالی شده توسط شرکت ماکروژن. نوکلئوتیدهای متفاوت، با رنگها و حروف متمایز مشخص شده اند

 

شکل 6- نمودار مربوط به انواع پلی مورفیسم ها در کدونهای مختلف و ارتباط هریک با سطح سرمی MBL. خطوط عمودی، نشان دهنده ی دامنه ی مربوط به سطح MBL ناشی از هر پلی مورفیسم اند

 

جدول 2- اطلاعات مربوط به نوع و تعداد هریک از پلی مورفیسم های دیده شده در جمعیت

درصد شیوع

فراوانی

نوع آلل

2/64%

95

A

5/13%

20

D

2/18%

27

B

7/0%

1

C

 

 

شکل 7- نمودار مربوط به نوع و تعداد هریک از پلی مورفیسم ها در کدونهای متفاوت، و ارتباط انها با سطح سرمی MBL. (0) نشان دهنده آلل A  ، (1)، (2) و (3) به ترتیب نشان دهنده آلل های D  ، B و C ، (4) نشان دهنده  پلی مورفیسم غیر قابل انتظار، (5) نمونه های دارای پلی مورفیسم در هر دوآلل D و B. میزان MBL بر حسب µg/ml  محاسبه شده است. همان طور که در شکل مشخص است، تراکم آلل A در جمعیت بیشتر است 

 

جدول 3-  تعداد و موقعیت نقاط چندشکل در جمعیت مورد مطالعه با توجه به هتروزیگوت و هوموزیگوت بودن جهش، و ارتباط ان با سطح سرمی پروتئین MBL در خون. b مربوط به ازمونP-values Kruskal-Wallis Test

Pb

95%(µg/L) 

Mean (µg/L) 

Number 

Genotype 

Loci 

0.021

2.15-2.9

2.53

123

CC

52

 

0.9-2.1

1.5

18

TC

 

 

-0.12-0.15

0.01

2

TT

 

<0.001

2.45-3.19

2.82

116

GG

54

 

0.25-0.59

0.42

25

GA

 

 

-0.08-0.1

0.01

2

AA

 

-

2.02-2.69

2.35

142

GG

57

 

-

0.01

1

GA

 

 

-

-

-

AA

 

 

متوسط غلطت سرمی MBL افراد در این جمعیت، g/mlµ20/2 محاسبه شد. غلظت کمتر از g/mlµ2 برابر با سطح پایین MBL، و غلظت بیشتر از g/mlµ6/2 برابر با سطح بالای MBL در نظر گرفته شد. این تقسیم بندی بر پایه محاسبات آماری در جمعیت مورد مطالعه با در نظر گرفتن CI(Confidence interval) منظور شده است. بر این اساس، در بیش از 50 درصد از افراد جمعیت مورد مطالعه، سطح سرمی MBL پایین بود. میانگین غلظت سرمی افرادی که از نظر چند شکلی، طبیعی بوده و جهش نشان ندادند  ( A/A ) ، برابر با µg/ml 24/3، و این غلظت برای افرادی که دارای هریک از انواع جهشها و پلی مورفیسم ها بودند، برابر با µg/ml 78/0  به دست آمد (شکل 6و7). لازم به ذکر است که نمونه های اولیه، 148 نفر بودند که 5 نمونه به دلیل داشتن پلی مورفیسم نابه جا و داشتن دو کدون دارای چند شکلی، حذف شده و در محاسبات لحاظ نشده اند.

اکثر پلی مورفیسم های مشاهده شده، وضعیت هتروزیگوت داشتند و تنها در 4 نفر پلی مورفیسم به صورت هوموزیگوت وجود داشت. افرادی که در جایگاه آلل 52 پلی مورفیسم را به صورت هتروزیگوت یا هوموزیگوت داشتند، به ترتیب دارای سطح سرمی برابر با µg/ml 5/1 و µg/ml 01/0 بودند. همچنین افراد هتروزیگوت و هوموزیگوت در آلل 54 نیز، به ترتیب دارای سطوح سرمی g/mlµ44/0 و g/mlµ01/0 بودند(جدول 3). همان طور که مشاهده می شود، جهش در آلل 54، تأثیر بیشتری در کم کردن سطح سرمی پروتئین MBL در خون دارد و از طرف دیگر، فراوانی آلل B هم بیش از دو آلل دیگر است.

بحث و نتیجه گیری

مطالعات قبلی، وجود سه پلی مورفیسم در کدونهای 52 ، 54 و 57 اگزون 1 ژن mbl2 را گزارش کرده بود. در جمعیت شمال امریکا، آلل B (کدون54) بیشترین فراوانی را دارا بوده است (1)، در مطالعه مشابهی در  دانمارک هم نتایج مشابهی به دست آمد و فراوانی آلل B بیش از دو آلل دیگر گزارش شده است (9). این نتیجه، در بررسی حاضر در جمعیت تهران به عنوان الگویی از جمعیت ایران هم حفظ شد. بر خلاف انتظار، در جمعیت مورد بررسی در تهران، در بین 143 نفر، حتی یک مورد آلل Q  در  ناحیه ی 5 ́ UTR  مشاهده نشد و همه ی افراد دارای آلل P بودند، در حالی که فراوانی آلل Q در جمعیت دانمارک 5/25 درصد گزارش شده است(4). به علاوه، میانگین کلی سطح سرمی MBL در خون این 143 نفر که به روش الایزا و با کمک نرم افزار SPSS محاسبه شد، µg/ml20/2 به دست آمد. میانگین سطح سرمی MBL در جمعیت های کره و استرالیا به ترتیب 70/1 و g/mlµ94/1 گزارش شده است (5 و 6). با توجه به نقشی که MBL در سیستم ایمنی دارد و عوارض کلینیکی ناشی از نقص آن، اهمیت پژوهش بیشتر در این زمینه به خوبی دیده می شود. مواردی که جای کار بیشتری در این زمینه دارند، عبارتند از: بررسی پلی مورفیسم MBL در جمعیتهای بزرگتر به منظور حصول نتیجه دقیق تر و برداشت صحیح تری از وضعیت کل جامعه، بررسی پلی مورفیسم MBL در افراد بیمار به خصوص افراد دارای نقص ایمنی اولیه، بررسی نقش احتمالی عواملی مثل سن، جنس و رژیم غذایی در نقص MBL. در این پژوهش، اکثر جامعه آماری تحقیق حاضر را مردان تشکیل داده بودند، بنابراین، نیاز به پژوهشهای بیشتر در جمعیت زنان نیز احساس می شود.

تشکر و قدردانی

این پژوهش با کمک و یاری ارگانها و افراد زیر انجام شده است:

دانشگاه تهران ، مرکز تحقیقات ایمونولوژی آسم و آلرژی، سازمان انتقال خون تهران، و همکاران محترم خانم ثقفی، خانم طالب زاده و خانم نجفی در مرکز تحقیقات ایمونولوژی آسم و آلرژی.

  1. Babovic-Vuksanovic D. , Snow K. , Ten R. M. , 1999, Mannose-Binding Lectin (MBL) Deficiency Variant Allels in a Midwestern Population of  The United States, Annals of Allergy, Asthma & Immunology, 82: 134-143 
  2. Carroll M. C. , 2004, The Complement System in Regulation of Adaptive Immunity, Nature Immunology, 5:981-986
  3. Garred P. , Larsen F. , Madsen H. O. , Koch C. , 2003, Mannose-Binding Lectin Deficiency –revisited, Molecular Immunology, 40: 73-84 
  4. Gusfield D. , Orzack S. H. ,  2001, Haplotype Inference; by CRC Press 
  5. Lee S. G. ,  Yum J. S. , Moon H. M. , Kim H. J. , Yang Y. J. , Kim H. L. , Yoon Y. ,  Lee S. ,Song K. , 2005,  Analysis of Mannose-Binding Lectin 2 (MBL2) Genotype and The Serum Protein Levels in The Korean Population, Molecular Immunology, 42: 969-977
  6. Minchinton R. M. , Dean M. M. , Clark T. R.  , Heatley S. , Mullighan C. G. , 2002, Analysis of The relationship Between Mannose-Binding Lectin (MBL) Genotype, MBL Levels and Function in an Australian Blood Donor Population, Scand. J. Immunology, 56: 630-641
  7. Phatsara C. , Jennen D. G. , Ponsuksilit S. , Murani E. , Tesfaye D. , Schellander K. , Wimmers K. , 2007, Molecular genetic Analysis of  Porcine Mannose-Binding Lectin Genes, MBL1 and MBL2, and Their Association With Complement Activity, International Journal of Immunogenetics, 34: 55-63
  8. Selander B. , Martensson U. , Weintraub A. , Holmstorm A. , Matsushita M. , Thiel S. , Jensenius J. C. , Truedsson L. , Sjoholm A.G. , 2006, Mannan-Binding Lectin Activates C3 and the Alternative Complement Pathway Without Involvement of C2, The Journal of Clinical Investigation, 116: 1215  
  9. Steffensen R. , Thiel S. , Varming K. , Jersild C. , Christian Jensenius J. , 2000, Detection of Structural Gene Mutations and Promoter  Polymorphisms in The Mannan-Binding Lectin (MBL) by Polymerase Chain Reaction with Sequence-Specific Primers, Journal of Immunological Methods, 241: 33-42
  10. Turner M.W. , 2002, The Role of Mannose-Binding Lectin in Health and Disease, HK J Peadiatr, 7: 134-142

11.  Worthley D. L. , Bardy P.G. , Mullighan C. G. , 2005, Mannose Binding Lectin: Biology and Clinical Implications, Internal Medicine Journal, 35: 548-555