نوع مقاله: مقاله پژوهشی

چکیده

شناسایی و مطالعه تنوع موجود در جمعیتهای زنبور عسل یکی از اهداف مهم در اصلاح نژاد زنبور عسل محسوب می‌شود. بدین منظور 32 نمونه تصادفی از کلنیهای زنبور عسل و عمدتاً در طول تابستان در استان اردبیل جمع آوری گردید. گروه­بندی جمعیتها بر اساس صفات کلیدی مورفولوژیک با روش‌ تجزیه خوشه­ای به روش حداقل واریانس وارد (WARD) کلنیهای مورد بررسی را به چهار گروه مجزا تقسیم نمود. این یافته‌ها جدایی مورفولوژیک نژاد زنبور عسل ایرانی و نژادهای خارجی آن را اثبات کرد. نژادهای وارد شده به این منطقه شامل نژاد ایتالیایی و هیبرید استارلاین در گروههای کاملاً مجزا قرار گرفتند ولی نژاد میدنایت کاملاً از نژاد استارلاین مجزا نشد. استفاده از دو جایگاه ریزماهواره(microsatellite)  نشانگر حداقل 2 و حداکثر 4 آلل در هر مکان ژنی بود. تحلیل کلیه پارامترهای حاصل از مطالعه ژنتیک جمعیت و برآورد رابطه فیلوژنتیکی بین جمعیتها با استفاده از روش تجزیه خوشه‌ای نشان داد که میانگین هتروزیگوسیتی مشاهده شده 93/0 و مورد انتظار 53/0 است. بیشترین شباهت ژنتیکی بین نژاد ایتالیایی و استارلاین به میزان 98/0 و کمترین آن بین نژاد میدنایت و ایتالیایی به میزان 57/0 برآورد شد. نتایج این تحقیق نشان داد که نمونههای ایرانی از هیبریدهای میدنایت ، استارلاین و ایتالیایی تفکیک شدند.

کلیدواژه‌ها

عنوان مقاله [English]

Morphologic and microsatellite genetic variation of honeybee populations in Ardabil

چکیده [English]

Identification and analysis of  the variation of honeybee populations is an outstanding subject in the bees breeding. The grouping of populations based on the morphological keys using cluster analysis by the minimum variance WARD method divided the colonies into four groups. The results showed morphological dissociation of Iranian race from the foreign ones. The imported race to this region including Italian and hybrid Starline were dissociated into four different groups but the Midnite race were not completely dissociated from the Starline. The study of two microsatellite loci showed a minimum of 2 and a maximum of 4 allels per locous. The analysis of population genetic parameters and phylogenetic relationships using cluster analysis method showed that the mean observed and expected heterozygosity was 0.93 and 0.53, respectively. The most similarity was observed between Italian and  Starline races as 0.98 and the less similarity was revealed between Midnite and Italian races as 0.57. The results implies that the Italian race was completely separated from the Italian ones, Starline and Midnite hybrids. 

کلیدواژه‌ها [English]

  • Honey bee
  • Genetic variation
  • microsatellite
  • Apis

تنوع جمعیتهای زنبور عسل بر اساس نشانگرهای مورفولوژیکی و ریزماهواره (microsatellite) در استان اردبیل 

صابر زهری1،*، علی اصغری2 و معصومه دادخواه1 

1 اردبیل، دانشگاه محقق اردبیلی، دانشکده علوم

2 اردبیل، دانشگاه محقق اردبیلی، دانشکده کشاورزی 

تاریخ دریافت: 26/10/89             تاریخ پذیرش: 1/9/90 

چکیده

شناسایی و مطالعه تنوع موجود در جمعیتهای زنبور عسل یکی از اهداف مهم در اصلاح نژاد زنبور عسل محسوب می‌شود. بدین منظور 32 نمونه تصادفی از کلنیهای زنبور عسل و عمدتاً در طول تابستان در استان اردبیل جمع آوری گردید. گروه­بندی جمعیتها بر اساس صفات کلیدی مورفولوژیک با روش‌ تجزیه خوشه­ای به روش حداقل واریانس وارد (WARD) کلنیهای مورد بررسی را به چهار گروه مجزا تقسیم نمود. این یافته‌ها جدایی مورفولوژیک نژاد زنبور عسل ایرانی و نژادهای خارجی آن را اثبات کرد. نژادهای وارد شده به این منطقه شامل نژاد ایتالیایی و هیبرید استارلاین در گروههای کاملاً مجزا قرار گرفتند ولی نژاد میدنایت کاملاً از نژاد استارلاین مجزا نشد. استفاده از دو جایگاه ریزماهواره(microsatellite)  نشانگر حداقل 2 و حداکثر 4 آلل در هر مکان ژنی بود. تحلیل کلیه پارامترهای حاصل از مطالعه ژنتیک جمعیت و برآورد رابطه فیلوژنتیکی بین جمعیتها با استفاده از روش تجزیه خوشه‌ای نشان داد که میانگین هتروزیگوسیتی مشاهده شده 93/0 و مورد انتظار 53/0 است. بیشترین شباهت ژنتیکی بین نژاد ایتالیایی و استارلاین به میزان 98/0 و کمترین آن بین نژاد میدنایت و ایتالیایی به میزان 57/0 برآورد شد. نتایج این تحقیق نشان داد که نمونههای ایرانی از هیبریدهای میدنایت ، استارلاین و ایتالیایی تفکیک شدند.

واژه های کلیدی: زنبور عسل- تنوع ژنتیکی ریزماهواره- Apis

* نویسنده مسئول، تلفن: 04515510801 ، پست الکترونیکی: zahri@uma.ac.ir 

مقدمه 


شمال غرب آسیا منطقهای است که تنوع گسترده موفولوژیکی زنبور عسل در آنجا دیده میشود (17). جدایی جغرافیایی می‌تواند منجر به تمایز ژنتیکی جمعیتها به واسطه انتخاب محلی(Local selection) و رانش ژنی (Gene flow) شود و در نهایت باعث ایجاد گروههایی شود که نژاد نامیده میشوند (6). از مدتها قبل برای زنبور عسل فقط چهار گونه شناخته شده بود. در حالی که طبق مطالعه فیلوژنتیکی، حداقل شش گونه از جنس آپیس (Apis) در دنیا انتشار دارد (5). زنبورعسل حشره‌ای بسیار سازش یافته با اکوسیستمهای متغیر در گستره آفریقا، اروپا و قسمتهای مرکزی و غرب آسیا میباشد.  در حدود 26 زیر گونه و اکوتیپهای (موجود سازش یافته با یک زیستگاه خاص) متعدد گونه Apis melifera  بر اساس رفتار، صفات ظاهری و شواهد مولکولی معرفی شده است. برخی نژادها منطقه جغرافیایی وسیع و برخی دیگر مناطق کوچکی را اشغال میکنند (18).  بعضی از محققین از تفاوتهایی همچون واکنش به سرما، ابتلا به بیماری، ریتمهای (رقصهای) حین برقراری ارتباط و ویژگیهای یادگیری به عنوان عامل تعیین کننده تمایز بین گونهها استفاده کردهاند (19).

در زنبورها، از آغازگرهای ریزماهواره برای اولین بار در Apis melifera و Bombus terrestris   استفاده شد و سپس برای سه نوع زنبور عسل بدون نیش استفاده گردید (8). ریزماهواره‌ها توالیهای ساده و تکراری کوتاهی(SSR) هستند که اگر طول آنها به حد کافی بلند و غیر منقطع باشد، به دلیل چند شکل بودن به عنوان نشانگرهای ژنتیکی مناسبی به کار میروند (4). شمار زیادی از میکروستلایتها برای ژنوم انسانی، حیوانات مدل و تعدادی از گیاهان زراعی توسعه پیدا کرده است. در زنبوران عسل نقشه پیوستگی ژنی برای گونه آپیس و چندین زنبور دیگر تهیه شده است (18).  فرانک و همکاران در سال 2001 در بررسی زنبوران عسل آفریقا با استفاده از نشانگرهای ریزماهواره و میتوکندریایی، نشان دادند که جایگاههای ریزماهواره به طور گسترده در جمعیتهای آفریقایی نسبت به اروپایی چندشکلی زیادی را نشان می‌دهد و این خود تفسیری بر اندازه بزرگ جمعیتها در آفریقا است (10). با مطالعه 7 جایگاه ریز ماهواره در ساختار ژنتیکی زنبوران عسل مشخص شد که هیچ کدام از جایگاهها از تعادل هاردی واینبرگ انحراف ندارند (9).

 استان اردبیل از لحاظ تولید عسل و پرورش زنبور عسل در ایران از اهمیت قابل توجهی برخوردار است. این مطالعه به منظور بررسی تنوع ژنتیکی بین جمعیتهای زنبورعسل موجود در برخی مناطق استان اردبیل با استفاده از نشانگرهای مورفولوژیکی و مولکولی (ریز ماهواره) انجام شد.

مواد و روشها

1- مطالعات مورفولوژیک:  برای انجام مطالعات مورفولوژیک، از کندوهای مربوط به زنبورداریهای برخی شهرستانهای استان اردبیل (اردبیل، نمین، نیر، هیر، مشکین­شهر، سرعین و گرمی) که دارای بیش از صد کلنی بودند و حدود 6 سال سابقه زنبورداری داشتند، نمونه‌ برداری به عمل آمد. در هر منطقه، نمونه برداری به طور تصادفی از 1-3 کلنی و در طی ماههای تیر، مرداد و شهریور سال 1385 انجام شد. از هر کلنی در حدود 15 زنبور عسل کارگر انتخاب گردید. برای نمونه برداری از ظروف پلاستیکی دهان گشاد استفاده شد و زنبورها با احتیاط از داخل هر کندو و از روی شانهای زنبور عسل در داخل بطریهای پلاستیکی قرار داده شدند. صفات ظاهری روی 6 زنبور کارگر از هر کلنی اندازه‌گیری شد و در مورد اعضایی که به طور قرینه در بدن زنبور عسل وجود دارند، همیشه عضو سمت راست برای اندازهگیری انتخاب شد. از بین حدود 40 صفت ظاهری که برای متمایز ساختن نژادهای زنبور عسل دنیا استفاده میشود، 11 صفت ظاهری کمی (جدول 3) و سه صفت کیفی ( شکل تومنتوم، وضعیت زاویه دیسکوئیدال و رنگ نیم حلقه‌های پشتی و شکمی  ناحیه شکم) انتخاب شد.  برای بررسی ویژگیهای مربوط به بال جلو، پس از جدا کردن بال سمت راست مدتی آن را در محلول الکل 70 درصد قرار داده و سپس بالها به ترتیب روی اسلایدهای دو جداره چیده شدند تا پس از تبخیر الکل به اسلایدها بچسبند و اندازه‌گیری روی آنها انجام شود. دادههای حاصل از اندازه گیری طول و زاویه رگبالها و شاخص کوبیتال در شناسنامه هر کلنی ثبت گردید. برای اندازه‌گیری طول خرطوم‏، طول و عرض بال جلویی، طول پای عقبی و سلول رادیال از استریو میکروسکوپ مجهز به عدسی مدرج استفاده شد. کلیه اندازه‌گیریها با استفاده از روش بین المللی روتنر انجام گرفت (16).

2- استخراج DNA : برای انجام مطالعات مولکولی، استخراج DNA با استفاده از روش نمکی بهینه ( Salting out method) با اندکی تغییرات انجام شد (7). پس از جدا کردن قسمت سینه حشره و شستشوی آن با آب مقطر، نمونهها به لولههای میکروتیوب منتقل و با استفاده از لوله پلاستیکی خرد شدند. بافرهای استخراج CTAB و TNE به ترتیب به مقدارµl120 وµl500 به میکروتیوبها اضافه و مخلوط ورتکس گردید. آنزیم پروتئیناز K  به مقدار 8 واحد در داخل یخ به نمونهها اضافه و در حمام آب 60 درجه سانتی گراد به مدت 12 ساعت اینکوبه شدند. مخلوط حاصل در دو نوبت با محلول فنل کلروفرم سانتریفیوژ (×g/min10000 ) و محلول رویی دور ریخته شد. برای رسوب DNA‏، 5/2 برابر اتانل سرد 100 درصد اضافه و پس از سانتریفیوژ و دور ریختن محلول رویی، رسوب حاصل با اتانل 70 درصد شستشو و در هوای آزاد خشک گردید. رسوب خشک شده در آب دیونیزه حل و پس از ارزیابی کمی و کیفی با روش اسپکتروفتومتری و الکتروفورز بر روی ژل آگارز 8/0 درصد، در فریزر  نگهداری گردید.

3- بررسی نشانگرهای ریزماهواره: در این تحقیق از 2 جایگاه ریز ماهوارهای AM2 و A88استفاده شد (جدول 1). آغازگرهای AM2f وAM2B با استفاده از نرم افزار  Oligo 0.6 و الگو قرار دادن توالی ثبت شده به شماره AJ509247 طراحی گردید و آغازگرهای A88f و A88b بر اساس گزارشات قبلی ساخته شد(5). واکنش PCR در حجم 25 میکرولیتر شامل: 2 واحد آنزیم Taq پلیمراز، 2/1 میلی‌مول dNTP، 5/1 میلی‌مول  MgCl2، 4 میلی‌مول از هر آغازگر و 30 نانوگرم DNA صورت گرفت. مراحـل واکنش PCR شامل 94 درجه سانتی گراد به مدت 3 دقیقه در یک چرخه،  94 درجه سانتی گراد به مدت 1 دقیقه، 54 درجه سانتی گراد به مدت 30 ثانیه و 72 درجه سانتی گراد به مدت 1 دقیقه در 34 چرخه و 72 درجه سانتی گراد به مدت 5 دقیقه جهت تکمیل نهایی تکثیر بود. محصول PCR در سطح ژل آگارز 2 درصد و با رنگ آمیزی اتیدیوم بروماید مورد بررسی اولیه قرار گرفت و جهت ارزیابی و سنجش دقیق آلل‌های ریز ماهواره از الکتروفورز محصول PCR بر روی ژل پلی آکریلامید 12 درصد استفاده شد.

4- تجزیه و تحلیل آماری: پس از اندازه‌گیری صفات ظاهری، تجزیه واریانس و محاسبه میانگین، معیار اشتباه صفات اندازه گیری شده با استفاده از نرم افزار SPSS14  انجام شد (12). برای بررسی میزان دوری و نزدیکی جمعیتها و نژادهای مورد مطالعه از روش تجزیه خوشه­ای با روش حداقل واریانس وارد (Ward) استفاده شد (12). تجزیه تنوع ژنتیکی جمعیتها در جایگاههای مورد نظر شامل تعداد آللها در هر لوکوس، تعداد ژنوتیپها و میزان تنوع در هر جمعیت و لوکوس، فراوانی آللی، هتروزیگوسیتی مورد انتظار و مشاهده شده و تعادل هاردی واینبرگ با استفاده از نرم افزار  Popgen3.2 انجام گرفت (13). گروه­بندی نژادها براساس داده­های مولکولی با استفاده از تجزیه خوشهای به روشUPGMA  انجام شد.

نتایج 

برای شناسایی نژادهای مختلف زنبورعسل با استفاده از کلیدهای شناسایی روتنر(16)، از یازده صفت مختلف استفاده شد. پس از اندازه گیری صفات مذکور در نمونه‌های زنبورعسل و مقایسه آنها با کلید شناسایی در مجموع چهار نژاد در مناطق مختلف استان اردبیل شناسایی شد. نژادهای شناسایی شده عبارت بودند از: نژاد ایرانی، نژاد ایتالیایی، هیبرید میدنایت، هیبرید استارلاین. میانگین این صفات در چهار نژاد در جدول 3 مشاهده می­شود.

تجزیه واریانس صفات کمی در نژادهای زنبور عسل نشان داد که بین نژادها در صفات کمی کوبیتال A، کوبیتالB، طول خرطوم، طول پای عقبی و زاویه  A4اختلاف معنی­داری وجود دارد ( جدول 2). به غیر از صفات مورد استفاده در شناسایی، صفات مورفولوژیکی مختلفی (جدول 4) در این نژادها اندازه­گیری شد. میانگین و معیار اشتباه صفات اندازهگیری شده در جدول 4 نشان داده شده است. برای مقایسه نژاد ایرانی با سایر نژادهای وارد شده به استان اردبیل، این نژادها بر اساس صفات مورفولوژیکی و با استفاده از روش تجزیه خوشهای گروه­بندی شدند.

گروه بندی جمعیتها با استفاده از صفات کیفی از قبیل رنگ نیم حلقه‌های پشتی، شکل تومنتوم و وضعیت زاویه دیسکوئیدال، صفات کمی از قبیل شاخص کوبیتال و طول خرطوم، طول و زاویه رگبالها و ترکیب صفات مذکور انجام گرفت. نتیجه گروه­بندی حاصل از صفات کیفی در شکل 1 دیده می­شود. در این گروه­بندی جمعیتهای نژاد ایرانی، ایتالیایی، استارلاین و میدنایت به خوبی از هم تفکیک شدند و این مسئله نشان می­دهد که صفات کیفی در تمایز جمعیتهای مورد مطالعه بهتر عمل کرده است.


 

جدول 1- مشخصات آغازگرهای مورد استفاده  برای تکثیر جایگاه‌های ریزماهواره در زنبور عسل

  نام آغازگر 

توالی ریزماهواره 

لوکوس 

مرجع 

AM2f 

GGAGCGGAGAAGACTTCACC

AJ509247

این تحقیق

AM2b

GATCGGGAACCGTAGAAACC

AJ509247

این تحقیق

A88f

CGAATTAACCGATTTGTCG

AJ509283

استوپ و همکاران (1995)

A88b

GATCGCAATTATTGAAGGAG

AJ509283

استوپ و همکاران (1995)

 

جدول2- نتایج حاصل ازتجزیه واریانس یکطرفه برای صفات کمی مورد مطالعه

منابع تغییر

درجه آزادی

(df)

 

 

 

 

 

 

 

میانگین مربعات

(MS)

 

 

 

 

شاخص کوبیتال

کوبیتالa

کوبیتال b

طول خرطوم

طول بال جلویی

عرض بال جلویی

طول پای عقبی

زاویه

G18

زاویه

D7

زاویه

A4

طول سلول رادیال

بین گروه

 

داخل گروه

 

3

 

 

176

 

ns22/0

 

 

110/0

 

*19/0

 

 

005/0

 

 

*026/0

 

 

005/0

 

 

**39/4

 

 

058/0

 

 

ns  045/0

 

 

074/0

 

 

ns  045/0

 

 

008/0

 

 

**704/0

 

 

103/0

 

 

ns  99/7

 

 

82/3

 

 

ns  01/7

 

 

82/3

**76/30

 

 

56/4

ns  003/0

 

 

007/0

ns‏، * و ** به ترتیب غیر معنی‌دار، معنی‌دار در سطح 5 و 1 درصد

 

شکل 1- نمودار درختی حاصل از تجزیه خوشه­ای با روش حداقل واریانس وارد (Ward) برای جمعیتهای زنبور عسل با به کار بردن صفات کیفی: جمعیتهای گروه A مربوط به نژاد ایتالیایی، گروه B مربوط به نژاد هیبرید میدنایت، گروه C مربوط به نژاد ایرانی و گروه D مربوط به هیبریدهای میدنایت و استارلاین است.

 

شکل 2- نمودار درختی حاصل از تجزیه خوشه­ای با روش حداقل واریانس وارد (Ward) برای جمعیتهای زنبور عسل با بکار بردن صفات کمی: گروه­های A و GوD مربوط به اقلیم نیمه خشک و گروه­های B و F مربوط به اقلیم نیمه مرطوب و گروه های G و  C مربوط به اقلیم نیمه خشک و نیمه مرطوب است.


گروه بندی جمعیتها با استفاده از صفات کمی نیز به طور جداگانه انجام شد (شکل 2). در این گروه­بندی نژاد­ها به خوبی از هم تفکیک نشده­اند. بنابراین، نمی­توان تنها با استفاده از صفات کمی، جمعیتهای مزبور را از هم مجزا کرد. در حالی که تفکیک جمعیتها بیشتر با شرایط اقلیمی آنها مطابقت داشت. در این نمودار جمعیتهای مربوط به اقلیمهای نیمه خشک و نیمه مرطوب در گروههای جداگانه­ای قرار گرفتند.

در گروه­بندی جمعیتها و نژادها  با ترکیب داده­های کمی (تومنتوم، رنگ نیم حلقه ها و وضعیت زاویه دیسکوئیدال)و داده‌های کیفی ( طول بال جلویی، شاخص کوبیتال، طول خرطوم، طول و زاویه رگبالها)، جمعیتها تا حدود زیادی از هم تفکیک گردیدند (شکل 3). بطوری­که مشاهده می‌گردد، نژادهای ایرانی و ایتالیایی در این نمودار کاملاً از هم مجزا شده‌اند. اما نژادهای میدنایت و استارلاین همانند نمودار رده­بندی جمعیتها با استفاده از صفات کیفی به طور کامل از هم مجزا نشدند. همچنین گروه­بندی جمعیتها بر اساس شرایط اقلیمی تا حدودی منطبق با گروه بندی جمعیتها بر اساس داده‌های کیفی و کمی بود.

جهت بررسی تنوع ژنتیکی از دو جایگاه ریزماهواره نیز استفاده گردید. آغازگر   AM2پلی مورفیسم و تنوع نواری قابل توجهی نشان داد. این آغازگر چهار آلل در چهار جایگاه ژنی تولید کرد که هر چهار آلل چند شکل بودند. آغازگر A88 دو نوار در دو لوکوس نشان داد که هر دو نوار مونومورف بودند. برای تعیین تعادل هاردی- واینبرگ از آزمون کای اسکوئر برای یک جایگاه ژنی استفاده شد. براساس این روش جمعیت ایتالیایی برای جایگاه ژنی AM2 در سطح 05/0 از تعادل انحراف نشان دادند (05/0 P) . نتایج حاصل از این تحقیق نشان داد که با استفاده از این آغازگر‏، میزان هتروزیگوسیتی آللها تا حدودی متفاوت است که امری کاملاً طبیعی است. مقادیر هتروزیگوسیتی مشاهده شده (Ho) و هتروزیگوسیتی مورد انتظار(He)  در هر جایگاه ژنی و برای هر جمعیت با استفاده از شاخص نی (Nei) محاسبه شد (12).

میزان هتروزیگوسیتی مشاهده شده بین 60/0 در نژاد ایرانی و00/1 در نژاد ایتالیایی بود و هیبریدهای میدنایت و استارلاین متغیر بودند. بیشترین مقدار شاخص شانون  مربوط به جمعیت میدنایت (029/1) و کمترین مقدار آن مربوط به جمعیت ایتالیایی (6931/0) بود. محاسبه ماتریس شباهت و فاصله ژنتیکی بین چهار نژاد بر اساس تشابه نی (13) نشان داد که کمترین تشابه ژنتیکی مربوط به نژاد استارلاین و میدنایت (برابر 5735/0) میباشد. بیشترین تشابه ژنتیکی نیز بین نژاد ایتالیایی و استارلاین (برابر9820/0) بود ( جدول 5).


 

جدول3- نتایج حاصل از بیومتری مربوط به  چهار نژاد مورد بررسی

نژاد

 شاخص کوبیتال

طول خرطوم (میلیمتر)

تومنتوم(Tomentum)

رنگ نیم حلقه­ های پشتی

وضعیت زاویه دیسکوئیدال

ایرانی

39/2

20/6

پهن

تیره

مثبت

ایتالیایی

31/2

42/6

پهن

روشن

مثبت

میدنایت

47/2

23/6

پهن

تیره

صفر

استارلاین

55/2

30/5

پهن

روشن

صفر

 

 

جدول 4- میانگین صفات کمی اندازه­گیری شده و معیار اشتباه آنها در نژادهای­ میدنایت، استارلاین، ایتالیایی و ایرانی

صفات مورفولوژیکی نژادها

هیبرید میدنایت

هیبرید استارلاین

نژاد ایتالیایی

نژاد ایرانی

واحد

ایندکس کوبیتال

07/0 ± 47/2

04/0 ± 54/2

05/0 ± 31/2

06/0 ± 39/2

-

طول رگبال A

01/0 ± 58/0

07/0 ± 51/0

01/0 ± 56/0

04/0 ± 55/0

میلی­متر

طول رگبال B

01/0 ± 23/0

07/0 ± 30/0

01/0 ± 24/0

03/0 ±28/0

میلی­متر

طول خرطوم

03/0 ± 23/6

23/0 ± 56/5

03/0 ± 23/6

03/0 ± 20/9

میلی­متر

طول بال جلویی

07/0 ± 53/9

09/0 ± 53/9

07/0 ± 62/9

04/0 ± 58/9

میلی­متر

عرض بال جلویی

03/0 ± 28/3

02/0 ± 66/11

03/0 ± 27/3

02/0 ± 29/3

میلی­متر

طول پای عقبی

13/0 ± 49/11

16/0 ± 76/90

04/0 ± 50/11

09/0 ± 75/11

میلی­متر

زاویه    G18

26/1 ± 92/80

13/0 ± 50/72

05/1 ± 38/91

45/0 ± 98/90

درجه

زاویه D7

01/1 ± 13/72

10/1 ± 86/32

52/0 ± 45/72

65/0 ± 36/72

درجه

زاویه A4

11/1 ± 63/31

6/0 ± 53/3

55/0 ± 76/31

7/0 ± 48/31

درجه

طول سلول رادیال

02/0 ± 49/3

04/0 ± 00/0

07/0 ± 12/5

02/0 ± 48/3

میلی­متر

 

 

 

شکل 3- نمودار درختی حاصل از تجزیه خوشه­ای با روش حداقل واریانس وارد (Ward) برای جمعیتهای زنبور عسل با بکار بردن صفات کیفی و کمی: گروه‌های  A، B،  D و F  مربوط به اقلیم نیمه خشک ، گروه‌های E و C  مربوط به اقلیم نیمه مرطوب  است.

جدول 5-  فاصله ها و تشابهات ژنتیکی بین نژادهای مورد بررسی. اعداد بالای قطر جدول، تشابه ژنتیکی و اعداد پایین قطر جدول فاصله ژنتیکی بین نژادها را نشان میدهد.

ایتالیایی

استارلاین

میدنایت

ایرانی

 

8973/0

8530/0

8269/0

***

ایرانی

6258/0

5735/0

***

1900/0

میدنایت

9820/0

***

5559/0

1473/0

استارلاین

***

0182/0

4688/0

1083/0

ایتالیایی

 

 

شکل4- نمودار درختی حاصل از تجزیه خوشه­ای به روش  UPGMA  بر اساس داده های ملکولی برای چهار نژاد زنبورعسل.

 


در نمودار درختی حاصل از تجزیه خوشه­ای بر اساس داده‌های ملکولی، دو نژاد ایتالیایی و استارلاین در یک گروه قرار گرفتند و نژادهای ایرانی و میدنایت در گروههای مجزا واقع شدند. طبق این نمودار، بیشترین فاصله ژنتیکی بین جمعیت نژاد میدنایت با استارلاین و سپس با نژاد ایتالیایی و ایرانی میباشد. زنبوران عسل نژاد ایتالیایی و استارلاین کمترین فاصله را داشتند (شکل 4).

بحث

زنبور عسل از نظر اقتصادی در تولید عسل وگرده افشانی گیاهان نقش داشته و از نظر پتانسیل کاربرد سم آنها  (Bee venom) در درمان بیماری مالتیپل اسکلروزیس (MS) مورد توجه محققان قرار گرفته است (1و٢). جدایی جغرافیایی میتواند منجر به تنوع ژنتیکی جمعیتها به واسطه انتخاب جغرافیایی جمعیتها و رانش ژنی در جمعیتها شده و باعث ایجاد گروههایی شود که به اصطلاح زیر گونه یا نژاد نامیده میشوند (6). استان اردبیل به دلیل وجود دامنه وسیع تغییرات ارتفاع (4811-40 متر) و نیز دارا بودن میزان بارندگیهای سالانه متفاوت (مقدار بارندگی در مناطق شمالی استان نسبت به مناطق دیگر کمتر است) و تنوع مناطق (نیمه خشک، استپی، معتدل) دارای شرایط اقلیمی متنوعی است که این عوامل در مجموع باعث ایجاد تفاوتهایی در صفات ظاهری نمونه‌های مورد مطالعه شده است. با توجه به اطلاعاتی که از زنبورداران محلی به دست آمده است، زنبورعسل نژاد ایرانی بسیار نیش زن بوده و از بره موم زیادی استفاده میکند. این نژاد زنبوری صرفه جو است و زمستانها را به راحتی به پایان میرساند. همچنین چون در فصل زمستان تعداد جمعیت کلنی کاهش مییابد، در فصل بهار سریعاً رشد کرده و کمبود جمعیت را جبران مینمایدعملکرد این نژاد در مقایسه با نژادهای خارجی در حد پایینی است، ولی به دلیل صرفه جویی و زمستان گذرانی خوب، عملکرد اقتصادی مناسبی دارد. ورود ملکههای خارجی به ایران در سالهای گذشته به طور وسیعی گسترش یافته است که به علت عدم مشخص بودن هویت اصلی ملکههای وارداتی اثرات نامطلوبی روی نژاد ایرانی گذاشته است. احتمالاً همین عامل باعث گردیده است که زنبورعسل خالص نژاد ایرانی در اثر اختلاط نژادی، صفات مطلوب خود را از دست بدهد (3). برای مقایسه یک صفت باید تعداد زیادی از نمونههای یک منطقه را اندازه گیری کرد و بر روی نتایج به دست آمده از این اندازه گیریها تجزیه و تحلیل آماری صورت گیرد. این کار به خصوص در سطح شناسایی نژادها بسیار رایج است. با وجودی که صفات فنوتیپی، تنوع ژنتیکی مستقیمی را نشان میدهند، به نظر میرسد که برای تمایز تاکسونها در سطح موفولوژیکی و ظاهری مفید باشند (11). هر چقدر فاصله موقعیتهای نمونه برداری بیشتر باشد، احتمال وجود مورفوکلاسترهای بزرگتر در آنالیز چند متغیره بیشتر خواهد بود (14 و 15). در این تحقیق سعی شد، حتی الامکان فاصله نقاط نمونه برداری بیشتر باشد تا نتایج صحیح تری به دست آید. به نظر میرسد که بررسیهای مورفولوژیکی نسبت به مطالعات مولکولی جهت شناسایی جمعیتهای محلی A. mellifera مفیدتر باشند. دادههای مولکولی اطلاعات کمی را در شناسایی کلنیهای بومی و غیر بومی فراهم میسازد (19). با توجه به نتایج به دست آمده در این تحقیق برای تعیین آمارههایی مانند میزان هتروزیگوسیتی، فراوانی آللها و فاصله ژنتیکی، میکروستلایتها به عنوان ابزار مناسبی تشخیص داده شدند. در این بررسی مشخص شد با وجودی که کلنیهای زنبورعسل در این مناطق توسط رانش ژنی و همچنین جایگزینی ملکههای سایر نژادهای زنبورعسل مورد تهدید قرار گرفته اند، هنوز نژاد بومی این منطقه  (Apis mellifera mellifera )  حفظ شده است. این جمعیتها از نظر ژنتیکی تقریباً همگن هستند. با این وجود این نژاد در این منطقه حفظ شده و اکوتیپهای مختلفی را به وجود آورده است که نشان میدهد توانایی تکاملی نسبتاً بالایی برای سازگاری محلی داردبا توجه به نتیجه به دست آمده بیشترین شباهت ژنتیکی مربوط به جمعیت استارلاین و ایتالیایی بوده و برابر 9820/0 میباشد. چون هیبرید استارلاین هیبریدی از لاینهایی ایتالیایی است، بنابراین می توان گفت، منشاء نژادی یکسان دلیل اصلی تشابه زیاد این دو جمعیت است. همچنین ممکن است وجود هر دو نژاد در یک زنبورستان که از آن نمونه برداری به عمل آمده است، باعث ایجاد یک جریان ژنی  با شدت کم بین این دو نژاد و ایجاد تشابه ژنتیکی بین دو جمعیت شده باشد. نمودار درختی حاصل از تجزیه خوشه­ای با روش حداقل واریانس وارد (Ward) برای جمعیتهای زنبور عسل با به کار بردن صفات کیفی نشان میدهد که نژادهای ایرانی و ایتالیایی از بقیه گروهها کاملاً مجزا شده‌اند ولی دو نژاد میدنایت و استارلاین با همدیگر تداخل دارند. البته احتمال دارد که این نژادها کاملا خالص نباشند.


  1. 1.     آذر نیا، م.، نبیونی، م.، رجبی زلتی، س.، میرابوالقاسمی، غ.، حویزی، ا. (1388) تأثیر سم زنبور عسل بر رمیلینه شدن در رتهای ویستار دمیلینه شده با اتیدیوم بروماید. مجله زیست شناسیایران، جلد 22 شماره 4، ص 566-573.
  2. 2.      تقوی زاد، ر.، مجد، ا.، نظریان، ح. (1387) مقایسه گرده شناختی گیاهان در ماه‌های مختلف فعالیت زنبور عسل در منطقه "سیراچال" استان تهران. مجله زیست شناسی. جلد22 شماره 2 ص 204-217.
  3. 3.      طهماسبی، غ.، عبادی، ر.، اسماعیلی، ر.، کامبوزیا، ج. (1375) مطالعه مورفولوژیک زنبور عسل معمولی در ایران. مجله علوم و فنون کشاورزی و منابع طبیعی، جلد2 شماره 1 ص 89-101.
    1. 4.     Archak, S., Meduri, E., Kumar, P.S ., Nagaraju J. (2007) InSatDb:a microsatellite database of fully sequenced insect genomes. Nucleic Acids Research 35: 36-39.
    2. 5.     Alexander, A. B. (1991) Phylogenetic analysis of the genus Apis (Hymenoptera; Apidae). Annals of the Entomological Society of America. 84(2): 137-149.
    3. 6.     Clarke, K. E., Rinderer, T. E., Frank, P., Quezada-Euan, J. G., Oldroyd, P. (2002) The africanization of  the honeybees (Apis mellifera L.) of the Yukatan: A study of a massive hybridization event across time. Evolution. 56: 1462-1474.
    4. 7.     Doyle, J. J., Doyle,  J.L. (1990) Isoltion of plant DNA from fresh tissue. Focus. 12: 13-15.
    5. 8.     Estoup, A., Solognac, M., Harry, M., Cornuet, J.M. (1993) Characterization of (GT)n and (CT)n microsatelltes in two insect species : Apis mellifera and Bombus terrestris. Nucleic Acids Research. 21:1427-1431.  
    6. 9.     Estoup, A., Garnery, L., Solignac, M., Cornuet, J.M. (1995) Microsatellite variation in Honeybee (Apis mellifera L.) Populations:Hierarchical Genetic Structure .

10.  Frank, P., Garnery, L., Oiseau, A., Oidroyd, B.P., Hepburn, H.R., Solignak, M., Cornuet, J.M. (2001) Genetic diversity of the honeybee in Africa: microstellite and mitochondrial data. Heredity. 86: 420-430.

11.  Kandemir, I., Pinto, M., Meixner, A., Marina, D., Sheppard, W.S. (2006) Hinf-I digestion of cytochrome oxidase I region is not a diagnostic test for A.m.lamarckii. Genetics and Molecular biology. 29: 747-749. 

12.  Nei, M.A.C., Aravind, A. (1977) Drift Variances of FST and GST Statistics Obtained from a Finite Number of Isolated Populations. Theorical population biology. 11: 307. 

13.  Nie, M. (1972) Genetic distance between populations. American naturalist, 106: 383-299.

14.  Radloff, S.E., Hepburn, H. (2000) Population structure and morphometric variance in the Apis mellifera scutellata group of honeybees in Africa. Genetics and Molecular Biology. 23: 305-316.

15.  Radloof, S.E., Hepburn, H.R., Fuchs, S. (2005) The morphometric affinities of Apis cerana of the hindu kush and Himalayan regions of western Asia. Apidologie. 36: 25-30. 

16.  Ruttner, F., Tassencourt, L., Louvaux, J. (1948) Biometrical-Statistical Analysis of the geographic variability of Apis mellifera L. Aapidologie. 9: 363-381.

17.   Ruttnert, F. (1988) Biogeography and taxonomy of honeybees. Springer-Verlag, Berlin, Germany. 285pp.11:55-88.

18.  Strange, J.P., Garnery, L., Sheppard, W.S. (2007) Morphological and molecular characterization of the Landes honeybee (Apis mellifera L.) ecotype for genetic conservation. J. Insect Conservation. 12: 527-537

Trouve, S., Degen, L., Meuntier, C., Tirads, C., Hurtrez-Bousses S., Durand P.,Guegan, J.F., Goudet, J., Renaud, F. (2000) Microsatelltes in the hermaphroditic snail, Lymnaea truncatula, intermediate host of the liver fluke, Fasiola hepatica. Molecular ecology. 9:1661-1686