نوع مقاله: مقاله پژوهشی

چکیده

بیان ساختارهای ساقه - حلقه در گیاهان تراریخت موجب تحریک چرخه خاموشی ژن با استفاده از مولکولهای dsRNA دارای مشابهت در توالی با mRNA موجود در گیاه می شود. در این پژوهش با استفاده از گیاهان توتون تراریخت  (N. tabacum cv. Samsun, NN)که ژن (RNA-Directed-RNA Polymerase-1) RDR1 آنها توسط ساختارهای ساقه- حلقه دارای مشابهت ژنتیکی با ژن RDR1 با اندازه های متفاوتی خاموش شده بود میزان پایداری خاموشی ژن بررسی شد. به منظور بررسی پایداری خاموشی ژن، میزان حساسیت به آلودگی سیستمیک ویروس (Potato virus Y strain o) PVY° و نیز میزان بیان ژن  RDR1 بررسی شد. توسط آزمون RT-PCR نیمه کمی (semi-quantitative RT-CR) میزان بیان ژنهای دخیل در مقاومت گیاهان به آلودگیهای ویروسی شامل ژنهای IVR ، AOX1،  ERF5 و نیز  RDR6یک هفته پس از مایه زنی نسلهای دوم (T2) و سوم (T3) توتونهای تراریخت که ژن RDR1 در آنها خاموش شده بود با ویروسPVY° بررسی شد. نتایج این تحقیق نشان داد نسل دوم توتونهای تراریخت نسبت به نسل بعدی از میزان بیان کمتر ژن RDR1 و سایر ژنهای دخیل در مقاومت برخوردار می باشد. همچنین لاین های نسل دوم (T2) توتونهای تراریخت در مقایسه با نسل سوم (T3) از حساسیت بیشتر به ویروسPVY° برخوردار بوده و میزان بیان ژن RDR1 در نسل سوم معادل با توتون غیر تراریخت بود. نتایج نشان داد کارآیی ساختار ساقه - حلقه در خاموشی ژن RDR1 در نسل بعد کاهش یافته است.  از آنجایی که ژن RDR6 تحت تأثیر ژنRDR1 بوده و برای انتقال پیام خاموشی در طول گیاه و افزایش مقاومت گیاهان به آلودگی ویروسی لازم می باشد، پیشنهاد می کنیم که سرکوب ژن RDR1 در توتونهای تراریخت موجب جلوگیری از بیان ژن RDR6 و در نهایت موجب کاهش انتقال عمودی ساختارهای ساقه - حلقه خاموش کننده به نسل بعد شده است. 

کلیدواژه‌ها

عنوان مقاله [English]

The instability of the inhibition of the expression of genes involved in resistance to virus infection in transgenic plants using hairpin constructs

چکیده [English]

Transgenic expression of hairpins can induce RNA silencing pathways by means of dsRNA with sequence homology to a plant mRNA. Using transgenic tobacco plants (N. tabacum cv. Samsun NN) in which the RDR1 gene was silenced to different extents by a hairpin structure homologous to the tobacco RDR1 gene, we evaluated the stability of gene silencing, by analyzing the RDR1 gene expression levels and the plant susceptibility to systemic infection by PVY°. The second (T2) and third (T3) generations of RDR1 silenced transgenic lines were tested by semi-quantitative RT-PCR to evaluate the expression levels of defense-related genes including IVR, ERF5, AOX1, and RDR6, one week after PVY° infection. The results showed that T2 transgenic tobacco lines transcribed the RDR1 and the other defense-related genes to a lower level than the corresponding T3 transgenic lines. The T2 lines were more susceptible to PVY° infection than the T3 lines and the RDR1 gene was expressed to the same level in the T3 lines as in non-transformed tobacco. The efficiency of hairpin structure-mediated silencing of the RDR1 gene decreased through different generations. As the RDR1-regulated RDR6 is required for the spreading of silencing throughout the plant, we propose that suppressing RDR1 leads to inhibition of RDR6, which then leads to loss of silencing by the RDR1 hairpin transgene after vertical gene transmission.  

کلیدواژه‌ها [English]

  • RNA silencing
  • stem-loop structure
  • (RDR1)
  • PVY°

ناپایداری ساختارهای ساقه - حلقه در جلوگیری از بیان ژنهای مسئول مقاومت در برابر آلودگیهای ویروسی در توتونهای تراریخت 

فرشاد رخشنده رو1،2،*، پیتر پالوکایتیس2 و مسعود شمس بخش2،3

1 تهران، دانشگاه آزاد اسلامی واحد علوم و تحقیقات، دانشکده کشاورزی و منابع طبیعی، گروه بیماری شناسی گیاهی

2 اسکاتلند، اینورگوری، بخش تحقیقات ویروس شناسی مرکز تحقیقات زراعی

3 تهران، دانشگاه تربیت مدرس، دانشکده کشاورزی، گروه بیماری شناسی گیاهی

تاریخ دریافت: 19/7/88               تاریخ پذیرش: 1/9/90 

چکیده

بیان ساختارهای ساقه - حلقه در گیاهان تراریخت موجب تحریک چرخه خاموشی ژن با استفاده از مولکولهای dsRNA دارای مشابهت در توالی با mRNA موجود در گیاه می شود. در این پژوهش با استفاده از گیاهان توتون تراریخت  (N. tabacum cv. Samsun, NN)که ژن (RNA-Directed-RNA Polymerase-1) RDR1 آنها توسط ساختارهای ساقه- حلقه دارای مشابهت ژنتیکی با ژن RDR1 با اندازه های متفاوتی خاموش شده بود میزان پایداری خاموشی ژن بررسی شد. به منظور بررسی پایداری خاموشی ژن، میزان حساسیت به آلودگی سیستمیک ویروس (Potato virus Y strain o) PVY° و نیز میزان بیان ژن  RDR1 بررسی شد. توسط آزمون RT-PCR نیمه کمی (semi-quantitative RT-CR) میزان بیان ژنهای دخیل در مقاومت گیاهان به آلودگیهای ویروسی شامل ژنهای IVR ، AOX1،  ERF5 و نیز  RDR6یک هفته پس از مایه زنی نسلهای دوم (T2) و سوم (T3) توتونهای تراریخت که ژن RDR1 در آنها خاموش شده بود با ویروسPVY° بررسی شد. نتایج این تحقیق نشان داد نسل دوم توتونهای تراریخت نسبت به نسل بعدی از میزان بیان کمتر ژن RDR1 و سایر ژنهای دخیل در مقاومت برخوردار می باشد. همچنین لاین های نسل دوم (T2) توتونهای تراریخت در مقایسه با نسل سوم (T3) از حساسیت بیشتر به ویروسPVY° برخوردار بوده و میزان بیان ژن RDR1 در نسل سوم معادل با توتون غیر تراریخت بود. نتایج نشان داد کارآیی ساختار ساقه - حلقه در خاموشی ژن RDR1 در نسل بعد کاهش یافته است.  از آنجایی که ژن RDR6 تحت تأثیر ژنRDR1 بوده و برای انتقال پیام خاموشی در طول گیاه و افزایش مقاومت گیاهان به آلودگی ویروسی لازم می باشد، پیشنهاد می کنیم که سرکوب ژن RDR1 در توتونهای تراریخت موجب جلوگیری از بیان ژن RDR6 و در نهایت موجب کاهش انتقال عمودی ساختارهای ساقه - حلقه خاموش کننده به نسل بعد شده است.

واژه های کلیدی: خاموشی RNA، ساختمان ساقه - حلقه، RDR1، PVY°

* نویسنده مسئول، تلفن: 09124786687 ،  پست الکترونیکی: rakhshandehroo_fa@srbiau.ac.ir

مقدمه

 

خاموشی RNA (RNA Silencing) پدیده ایست ژنتیکی که در طی آن تنظیم بیان ژنها از طریق توالی ویژه ای از RNA ، غیر از mRNA ، tRNA و یا rRNA ، در سلول صورت می پذیرد (1). خاموشی جهت تنظیم بیان ژنهای موجودات یوکاریوتیک و همچنین، هنگام مواجه با قطعات نوکلئوتیدی خارجی ویروسها و ترانسپوزون ها، در جهت ایجاد مقاومت در سلولهای موجودات فعال می شود (2 و 3). این فرآیند بیوشیمیایی با حضور قطعات نوکلئوتیدی از نوع RNA دو رشته ای (dsRNA) با توالی مشابه با قسمتی از ژنوم گیاه یا جانور میزبان صورت می پذیرد (1). در نتیجه برش این توالیهای مهاجم با آنزیم ریبونوکلئاز نوع 3 با نام (Dicer like) قطعات کوچک RNA به طول 24-21 نوکلئوتید ایجاد می شود و از این طریق یک دفاع ژنتیکی طبیعی علیه توالیهای پارازیت مهاجم در سلول حاصل می شود (2 و 3). خاموشی RNA می تواند در هسته یا در سیتوپلاسم سلول اتفاق بیافتد. در حالت دوم آن را خاموشی ژن پس از نسخه برداری[Post transcriptional Gene Silencing (PTGS)]   می نامند (1). آنزیمهای مختلفی از جمله RNA پلیمراز وابسته به [RNA Directed RNA polymerase]  (RDRs) در این مسیر شرکت می کنند. این آنزیم با تکثیر RNA های تک رشته ای و تبدیل آن به فرم دو رشته ای (dsRNA)، در تکثیر سیگنال هدف و فعالیت بیشتر اجزای خاموشی RNA نقش بسیار مهمی را عهده دار می باشد (27). تا کنون 6 نوع آنزیم RDR در سلولهای گونه های مختلف گیاه مدل آرابیدوپسیس (Arabidopsis sp.) شناخته شده است که نوع اول آن با نام مخفف RDR1 ، آنزیمی کلیدی در فرآیند PTGS بوده و در ایجاد مقاومت پایه (Basal-defense) در یوکاریوت ها، در برابر آلودگیهای پاتوژنیک نقش دارد (9). واترهوس (Waterhouse) و همکاران در سال 1998 نشان دادند هرگاه ردیفهای نوکلئوتیدی دارای مشابهت با توالی ژنتیکی هدف در ساقه ساختار ساقه - حلقه در سلول گیاهان به فرم RNA دولا بیان شوند این توالیها می توانند موجب خاموشی ژن هدف در گیاه شوند (28). بر این مبنا محققین تا کنون دستورالعملهای متفاوتی را برای ساخت ناقلهای استاندارد خاموشی ژن ارائه کرده اند که ناقل pHANNIBAL از جمله آنهاست (10 و 20). ویژگی این ناقلها آن است که توالی ژن مورد بررسی که باید خاموش شود را بصورت توالی تکراری معکوس به فرم RNA دولا در سیستم تراریخته بیان می نمایند. توالی سنتز شده RNA دو لا (dsRNA) در ساقه موجب خاموش شدن کامل ژن هدف می شود (8). از این طریق می توان قطعه ای به طول50 جفت باز یا بیشتر که از لحاظ ژنتیکی با ژن هدف مشابه باشد را جهت خاموش نمودن ژن مذکور در گیاهان مورد بررسی بیان نمود. هم اکنون محصولات تراریخته شده با استفاده از مکانیسم خاموشی RNA تولید شده و بصورت تجارتی تنها در استرالیا مورد استفاده قرار می گیرند و در آنها برای خاموش نمودن ژن هدف از ناقلهای بیان کننده ساختارهای ژنتیکی ساقه- حلقه استفاده  می شود (1 و 16). در این پژوهش برای بررسی عملکرد ژن RDR1 در ایجاد مقاومت توتون به آلودگی ویروس Y سیب زمینی(PVY) Potato virus Y از لاین های توتون سامسون  تراریخته ای استفاده شد که با نسبتهای متفاوتی در مقایسه با گیاه توتون غیر تراریخت mRNA ژن RDR1 در آنها کاهش پیدا کرده بود. برای کاهش میزان mRNA ژن RDR1 قسمتی از ژن مذکور با استفاده از ناقل RNAi بصورت ساختار ساقه و حلقه و بصورت dsRNA در سلول توتونهای تراریخت بیان می شد که موجب فعال شدن فرآیند خاموشی ژن بر علیه ژن RDR1 و هضم آنزیمی ژن مذکور در توتونهای تراریخت می شد. لاین های مورد بررسی از این ویژگی برخوردار بودند که مربوط به نسلهای مختلف دوم و سوم بودند. همچنین با مقایسه میزان مقاومت به آلودگی ویروسی در نسلهای مختلف توتونهای تراریخته، پایداری انتقال و حفظ ویژگی ساختارهای ساقه - حلقه خاموش کننده ژن RDR1 در نسلهای مختلف مورد ارزیابی قرار گرفت. نتایج تحقیقی که به تازگی انجام پذیرفت نشان داد که ژن RDR1 در افزایش دفاع فوق حساسیت در برابر آلودگیهای ویروسی علاوه بر دفاع از طریق فرآیند خاموشی ژن نقش دارد (13 و 21). از این رو در این پژوهش از ویروس TMV که در توتون سامسون غیر تراریخت پاسخ فوق حساسیت را ایجاد می نمود استفاده شد تا علاوه بر بررسی تأثیر بیان ژن RDR1 در تولید نسخه های mRNA مربوط به مهم ترین ژنهای مقاومت درگیر در پاسخ فوق حساسیت در کنار ژنهای مسئول فرآیند خاموشی ژن امکان پایداری تأثیر احتمالی آن در نسلهای مختلف در توتونهای تراریخت نیز بررسی شود.

مواد و روشها  

منابع گیاهی و ویروسی و روش آلوده سازی: در این پژوهش از کلنهای بیماریزا (Infectious clone) نژاد O ویروس Y سیب زمینی (Potato virus Y strain O (PVYO برای مایه زنی مورد استفاده قرار گرفت. همچنین از کلنهای بیماریزا استرین U1 ویروس موزاییک توتون Tobacco mosaic virus (TMV) که در توتون  Samsun, NN) (N. tabacum cv. ایجاد لکه موضعی و پاسخ فوق حساسیت می نمود نیز برای ارزیابی و مقایسه میزان بیان ژنها استفاده شد. عوامل ویروسی مذکور توسط بخش ویروس شناسی گیاهی مرکز تحقیقات زراعی اسکاتلند (SCRI) در اختیار این تحقیق قرار گرفت. مایه زنی مکانیکی با استفاده از بافر فسفات پتاسیم 1/0 مولار با pH= 7.5 انجام شد. برای این منظور به میزان 5/0 گرم بافت پهنک برگ در 4 میلی لیتر از بافر مخصوص مایه زنی در هاون چینی سرد، خرد و یکنواخت شد. مایه زنی در مرحله 4 برگی توتونهای تراریخت و غیر تراریخت سامسون انجام شد. نمونه برداریها از برگهای فوقانی و یک هفته پس از مایه زنی، صورت پذیرفت. در این تحقیق از لاین های متفاوت توتون N. tabacum cv Samsun, دارای ژن مقاومت N استفاده شد. برای بررسی نقش ژنRDR1  در مقاومت در برابر ویروس Y سیب زمینی از 4 رقم مختلف توتون سامسون NN N. tabacum cv Samsun, استفاده شد (جدول 2).

چگونگی تهیه کاستهای ژنی: در این بررسی از همسانه های ژن RDR1 توتون nn N. tabacum cv Xanthi به اندازه های 1630 و 542 جفت باز استفاده شد (جدول 1). همسانه های مذکور در ناقل دوتایی (Binary vector) ، pFGC5941(Chrom DB. U.S.A) مطابق روش Kerschen و همکاران وارد شدند (8). ناقل دوتایی pFGC5941 (GenBank Accession No. AY310901) از 11406 جفت باز تشکیل شده و دارای اینترون ژن سنتز کالکون A  (ChsA) و دو جایگاه ورود برای وارد کردن توالیهای مکمل معکوس از ژن مورد بررسی بود (شکل 1). از ناقل ذکر شده برای تولید قطعه های dsRNA به فرم ساقه و حلقه از ژنRDR1 به منظور کاهش میزان بیان آن در توتونهای تراریخت استفاده شد (جدول 2). برای تراریختی گیاهان توتون Samsun, NN cv tabacum Nicotiana از باکتری آگروباکتریوم LBA4404) (Agrobacterium tumefaciens, دارای ناقل دوتایی حاوی توالی مکمل معکوس از ژن RDR1 توتون استفاده شد. باکتری آگروباکتریوم با استفاده از روش تزریق زیر پوستی Clough  و Bent به گیاهان توتون تزریق شد (6). انتظار می رفت که به دلیل حضور تعداد نسخه های زیاد از ساختارهای ساقه- حلقه خاموش کننده ژن RDR1 در لاین های R-5-1 و R-5-1-1 بیان ژن RDR1 در آنها نسبت به گیاه غیر تراریخت بسیار کمتر باشد. لاین های R-14-1 و R-14-1-1 تعداد نسخه های خاموش کننده ژن  RDR1 کمتری را  نسبت به لاین های R-5-1 و R-5-1-1 دریافت کرده بودند. به منظور تهیه cDNA از توالی RDR1 توتون Xanthai از جفت آغازگرهای اختصاصی برای تکثیر دو ناحیه از ژن RDR1 استفاده شد (جدول 1).

آزمونهای ارزیابی حساسیت توتونهای تراریخت به آلودگی ویروسی: جهت بررسی میزان حساسیت در لاین های تراریخت توتون، بیانهای ژنهای دخیل در مقاومت شامل IVR ،AOX1،ERF5،RDR6 و RDR1  و نیز ژن مربوط به پروتئین پوششی ویروس PVY از آغازگرهای اختصاصی استفاده شد (جدول 3). آغازگرها با استفاده از نرم افزار Oligo6 (Molecular biology, Insights,Inc, U.S.A) طراحی شدند. بررسی میزان بیان ژنها حضور نسخه های mRNA برای هر ژن با استفاده از آزمون RT-PCR نیمه کمی مطابق روش مارون و همکاران در 3 تکرار و در هر تکرار با 3 تکرار برای هر نمونه گیاهی انجام شد (12).

 

 
   

 

 

 

 

 

 

 


شکل 1- ساختار ناقل RNAi (pFGC5941  ) و روش تغییر ساختار ناقل برای بیان قسمتی از ژن RDR1 توتون Xanthi nn cv tabaccum Nicotiana بصورت ساختمان ساقه - حلقه. مشخصات ژنRDR1 توتون Xanthi nn cv tabaccum Nicotiana و کاست ژنی مورد استفاده برای ایجاد خاموشی ژن RDR1 در سلول لاین های تراریخت cv Samsun, NN tabaccum Nicotiana.در شکل مشخص شده است. در جایگاههای تکثیر (1) توالی به طول 1630 جفت باز در حدفاصل بین توالی 3030- 1400 و (2) توالی به طول 540 جفت باز در حد فاصل بین توالیهای 2155-1614 از ژن RDR1 در ناقل وارد شدند.

 

جدول 1- مشخصات آغازگرها و جایگاههای برشی برای همسانه سازی قطعات مربوط به ژن RDR1 a) باندازه 1631 جفت باز در حد فاصل بین نوکلئوتیدهای های 303 و 1400 و b) باندازه 542 جفت باز جفت باز در حد فاصل بین نوکلئوتیدهای های 2154 و 1614 از طول ژن که برای تکثیر در درون ناقل pFGC5941 مورد استفاده قرار گرفت. مکان برش توسط آنزیم در پایین هر توالی آغازگر مشخص شده است.

نام لاین های مورد  ارزیابی 

R-5-1-1

R-14-1-1

R-5-1

R-14-1

ویژگی لاین های مورد ارزیابی

نسل سوم

نسل سوم

نسل دوم

نسل دوم

تعداد نسخه های ساختار ساقه و حلقه وارد شده در لاین توتون مورد ارزیابی

30 تا 50 نسخه خاموش کننده ژن RDR1

2 تا 5 نسخه خاموش کننده ژن RDR1

30 تا 50 نسخه خاموش کننده ژن RDR1

2 تا 5 نسخه خاموش کننده ژن RDR1

جدول 2-  خصوصیات لاین های توتون مورد ارزیابی. در این تحقیق از لاین های متفاوت توتون  Samsun, NN cv tabacum Nicotiana استفاده شد که بیان ژنRDR1 در آنها توسط سازه های ژنی دارای توالی ژنی مشابه با فرم ساقه - حلقه، با درجات مختلف کاهش یافته بود. برخی از لاین ها مربوط به نسل دوم و برخی دیگر متعلق به نسل سوم بودند.

نام ژن

جهت توسعه آغازگر

توالی آغازگر

اندازه تولیدات (bp)

RDR1-1a

Sense

5'-AAAGAATTCGCATCAAGACCTGGCCTTAC-3'                                                                Eco RI

1631

RDR1-2a

Antisense

5'-AAAAGCGGCCGCCACTAAGTATTTCAGCCTCAG-3'                                               Not I

RDR1-3b

Sense

5'-AAATCTAGAGGCGCGCCAAATATCTGCTGACTTTG-3'                                             Xba I

542

RDR1-4b

Antisense

5'-AAAAGGATCCATTTAAATCTGGATTCATCCAAGCAT-3'                                              Bam HI

 

 

RNA کل بافت توتونهای تراریخت و غیر تراریخت در حالت سالم و یا یک هفته پس از مایه زنی با ویروس°PVY  و همزمان با بروز علایم موزاییک سیستمیک از برگها استخراج شد. برای این منظور از ستونهای کوچک استخراج RNA  RNeasy Plant Mini kit (Qiagen, USA) استفاده شد. غلظتRNA  استخراج شده با دستگاه اسپکتروفوتومتر سنجش شد. با استفاده از آنزیم نسخه بردار معکوس (RT) و آغازگرOligo dT  مطابق دستورالعمل شرکت (Promega,Wisconsin, USA) برای ساخت cDNA تک رشته ای اقدام شد. به این ترتیب که به ازای 10 نانوگرم از RNA استخراج شده از 50 پیکومول Oligo dT استفاده شد و با آب DEPC حجم محلول واکنش به 7 میکرولیتر رسید. محلول 10 دقیقه در دمای 65 درجه سانتی گراد قرار گرفت. پس از زمان مذکور محلول به سرعت بر روی یخ سرد شد. سپس محلول زیر  (1mM dNTP)،4 μl   بافر (5X) ، (10 µM) dTT ، (1U) آنزیم (RT) نوع M-MuLV ، تهیه شد و حجم نهایی با آب DEPC به 10 میکرولیتر رسید. محلول فوق به مدت 60 دقیقه در دمای 42 درجه سانتی گراد و 10 دقیقه در 80 درجه سانتی گراد قرار گرفت. پس از ساخت cDNA تک رشته ای، از آن به عنوان الگو برای ساخت cDNA دو رشته ای و تکثیر آنها توسط PCR استفاده شد. آزمون RT-PCR نیمه کمی با حضور 1 میکرولیتر از cDNA سنتز شده در حجم 24 میکرولیتر از واکنشگرها شامل (2 میلی مولار  MgCl2، 4/0 میلی مولار 4dNTP-Mix، 6/0 واحد آنزیم Taq DNA polymerase (200 واحد در میکرولیتر)، 4/0 میکرومولار از آغازگرها، 5 میکرولیتر (10X) PCR Buffer و تا حجم 24 میکرولیتر آب مقطر استریل)  در دستگاه ترموسایکلر  انجام شد. نمونه ها با واکنش حرارتی (2 دقیقه واسرشت سازی اولیه در 1 دقیقه در 94 درجه سانتی گراد، 30 ثانیه در 54 درجه سانتی گراد ، 40 ثانیه در 72 درجه سانتی گراد و بسط نهایی 10 دقیقه در 72 درجه سانتی گراد) برای 25، 30 ، 35 و 40 چرخه تکثیر شدند. همچنین از ژنهای Tubulin- ß و Myb به عنوان کنترل داخلی و برای نرمال سازی بیان ژنها برای این آزمون استفاده شد. 

آزمون Si –Blotting: آزمون Si-Blotting  (Small interfering RNA –Blotting)  روش تغییر یافته Northern  Blot  است و از آن برای ردیابی قطعات RNA با اندازه های کوچک کمتر از 30 نوکلئوتید مطابق روش کانتو و همکاران استفاده شد (5). تکنیک مذکور مطابق روش ونی تارانی  و همکاران انجام پذیرفت (26). برای انجام این آزمون ابتدا RNA تام از برگ توتونهای مورد ارزیابی استخراج شد. ابتدا میزان 3 گرم از بافت برگ در 4 میلی لیتر بافر کلرید لیتیم (1/0 مولارLiCl، 1/0 مولار Tris-HCl با اسیدیته 8، 01/0 مولار EDTA با اسیدیته 8، 1 درصد SDS، 5 درصد ماده PVP-24000 و 2 درصد (Na2So3) و 4 میلی لیتر مخلوط فنل-کلروفرم- ایزو آمیل الکل به نسبت (25-24-1) به طور کامل ادغام شد. مخلوط واکنش در دمای اتاق برای مدت 1 ساعت با چرخش 10000 دور در دقیقه سانتریفیوژ شد. رونشین به دست آمده با 5/4 میلی لیتر لیتیم کلراید 4 مولار و 500 ماکرولیتر استات پتاسیم 3 مولار با اسیدیته 8 ترکیب شد و برای مدت 3 ساعت در دمای 20- درجه سانتی گراد قرار داده شد. سپس مخلوط واکنش در دمای 4 درجه سانتی گراد برای مدت 30 دقیقه با چرخش 10000 دور در دقیقه سانتریفیوژ شد. رسوب حاصل با اتانل 70 درصد شستسو داده شد و در 500 ماکرولیتر آب مقطر استریل دوبار تقطیر شده حل شد. RNA کل استخراج شده روی ژل پلی آکریل آماید20 درصد  در بافر TBE با ولتاژ 280 میلی آمپر الکتروفورز شد. ژلها در محلول اتیدیم بروماید جهت بررسی کیفیتRNA  استخراج شده رنگ آمیزی شدند.RNA  موجود در  ژل پلی آکریل آماید توسط دستگاه Mini Trans-Blot® Electrophoretic Transfer Cell  (Bio-Rad, U.S.A)  پس از یک ساعت با شدت جریان 100 ولت به غشاهای نیتروسلولزی انتقال پیدا کرد. غشاء پس از بلوکه شدن در محلول بلوکه کننده شامل(1X Roche Blocking Reagent، 0.1 M Maleic acid (0.15M NaCl, با کاوشگر اختصاصی برای قطعات RNA  ژن RDR1  ردیابی شد. برای این منظور از کاوشگر غیر رادیواکتیو Dioxygenin-Labbeled (Roche,Germany) استفاده شد. اتصال کاوشگر به RNA برای مدت یک شب در دمای 41 درجه سانتی گراد و ردیابی تولیدات توسط Anti-dioxygenin  در سوبسترای (CSPD) ({1,2-dioxetane-3,2′-(5′-chloro) tricyclo [3.3.1.13,7] decan}-4-yl] phenylphosphate) انجام پذیرفت. برای تهیه کاوشگر از ناقل بیان کننده ژن (pLF103) استفاده شد. ناقل مذکور حاوی توالی ژن RDR1 توتون Xanthi بود و پس از رونویسی توسط دو پروموتر T3 و T7 تولید پروب Sense RNA برای انجام نوردن بلات می نمود.  برای تهیه کاوشگر از توالی cDNA به طول 540 جفت باز از ژن RDR1 توتون Xanthi در حد فاصل بین توالیهای 2154-1614 استفاده شد (شکل 1). در نهایت لاین هایی که برای ژن RDR1  خاموش شده بودند باند پر رنگی را باندازه 24-21 نوکلئوتید نشان دادند. شدت باندها بیانگر میزان خاموش شدن و هضم آنزیمی ژن RDR1 و تبدیل آن به قطعه های کوچک RNA در لاین ها بود.

نتایج

ارزیابی عملکرد کاست های ژنی در توتونهای تراریخت: ارزیابی میزان بیان ژن RDR1 در حالت سالم و یک هفته بعد از مایه زنی با ویروسPVY در توتونهای غیر تراریخت و نسلهای دوم و سوم توتونهای تراریخت (اشکال 2 و3) با استفاده از  RT-PCR نیمه کمی با 25 تا 40 چرخه PCR  انجام پذیرفت. میزان بیان ژن RDR1  در مقایسه با میزان بیان ژن کنترل داخلی ß-Tubulin ، ارزیابی شد. اندازه تولیدات حاصل از تکثیر ژنهای RDR1  و ß-Tubulin بر روی ژل آگارز 5/2 درصد مطابق با اندازه های اشاره شده در (جدول 3) برای هر ژن بود. نتایج آزمون Semi-quantitative-RT-PCR نشان داد میزان mRNA ژن RDR1 در لاین های تراریخت متعلق به نسل دوم در مقایسه با شاهد تیپ وحشی غیر تراریخت کاهش پیدا کرده است (شکلهای 2 و 3).

بیشترین میزان کاهش mRNA ژنRDR1 در لاین R-5-1 با تعداد زیاد ساختارهای ساقه- حلقه خاموش کننده مشاهده شد (شکل 2). کاهش میزان mRNA ژنRDR1 در لاین های توتون تراریخت R-5-1 وR-14-1 سالم و آلوده به ویروس PVYº مشاهده شد. با این وجود میزان بیان ژن مذکور تا یک هفته پس از مایه زنی توتونهای تراریخت و غیر تراریخت در مقایسه با توتونهای مایه زنی نشده افزایش نشان داد (شکل 2). بیشترین میزان افزایش mRNA ژن RDR1 در توتون غیر تراریخت تیپ وحشی تا 3 روز پس از مایه زنی با ویروس TMV و همزمان با بروز پاسخ فوق حساسیت مشاهده شد (شکلهای 2 و 3). همچنین ارزیابی میزان بیان ژن RDR1 در توتون غیر تراریخت در حالت سالم و یک هفته بعد از مایه زنی با ویروس°PVY و یا 3 روز بعد از مایه زنی با ویروسTMV نشان داد ویروس TMV در مقایسه با °PVY از توان بیشتری در افزایش بیان ژن RDR1  برخوردار بوده است (شکل 3). اگرچه در توتون غیر تراریخت در مقایسه با لاین های تراریخت تا یک هفته پس از مایه زنی با ویروس PVYº میزان نسخه های mRNA بیشتری از ژن RDR1  در سلول تجمع پیدا نمود (شکل 2) با این وجود نتایج فوق برای لاین های توتون تراریخت  R-14-1-1 و R-5-1-1 که متعلق به نسل سوم بودند مانند نتایج مشاهده شده برای نسل دوم نبود و بر خلاف نسل دوم، میزان mRNA ژنRDR1 در نسل سوم افزایش نشان داد (شکل 3). همچنین نتایج آزمون  Sq-RT-PCR نشان داد بیشترین میزان تجمع پروتئین پوششی ویروس  PVYº در لاین تراریخت (R-5-1)  با میزان کم mRNA ژن RDR1 صورت پذیرفته است (شکل 4). در این آزمون میزان بیان ژن پروتئین پوششی ویروس (PVYº) در چرخه های 25 ، 30 ، 35 و 40 آزمون RT-PCR مورد بررسی قرار گرفت. در لاین های توتون تراریخت با بیان کمتر ژن RDR1 پروتئین پوششی ویروس PVYº به میزان بیشتری در مقایسه با توتون غیر تراریخت بیان شد (شکل 4). پروتئین پوششی محصول تکثیر شده مربوط به پروتئین پوششی ویروس PVYº باند 200 جفت بازی را در ژل تشکیل داد. لاین های تراریخت R-5-1 و R-14-1 ، تجمع پروتئین پوششی ویروسPVYº را در مقایسه با توتون تیپ وحشی غیر تراریخت بیشتر حمایت نمودند که این امر بیانگر افزایش حساسیت به آلودگی ویروسی در اثر کاهش حضور ژن RDR1  در لاین های تراریخت می باشد (شکل 4). نتایج همچنین حاکی از آن بود که میزان توان تهاجمی ویروس PVYº در لاین های تراریخت R-14-1-1 و R-5-1-1 متعلق به نسل سوم همزمان با افزایش میزان mRNA ژن RDR1 افزایش پیدا کرده است (شکل 4).

 

جدول 3- مشخصات آغازگرها جهت تکثیر ژنهای مقاومت در توتونهای تراریخت و غیر تراریخت. قطعه های حاصل از تکثیر ژنها مربوط به چرخه های مختلف آزمون PCR روی ژل آگارز 5/2 درصد تفکیک شدند. برای هر ژن از نمونه های کنترل منفی و مثبت استفاده شده و تمام آزمونها با 4 تکرار انجام شدند. برای کنترل منفی از مخلوط واکنش بدون الگو (cDNA) استفاده شد. برای کنترل مثبت از ناقل pTZ57 R/T (Fermentaz, Germany) دارای هر یک از ژن اشاره شده در جدول زیر استفاده شد.

نام ژن

جهت توسعه آغازگر

توالی

اندازه تولیدات

RDR1

Foreward Primer

CAGGCTAGCTCCATCGCGAC

430bp

Reverse Primer

CATACTAGTGGTCATAAACACA

IVR

Foreward Primer

ATCGTTAACAATCGACCTGAAGCTGCT

581bp

Reverse Primer

ATGGGATCCTCATAAAAGCTCAGCCTCT

ERF5

Foreward Primer

ATGTCAAGTAACTCAAGCCCA

780bp

Reverse Primer

TCAGTCCCTTCGACACGAATG

 

AOX1

Foreward Primer

GATGACACGTGGAGCGACAAGG

620bp

Reverse Primer

CCACTCTGTTCGAATCGCCTAAG

ß-tubulin

Foreward Primer

CTTGCATTGGTACACAGG

300bp

Reverse Primer

CACTCTCCAGCATTCATCC

RDR6

Foreward Primer

TCCATGCCGAAGTACAGTGCT

350bp

Revearse Primer

TCCATGCCGAAGTACAGTGCT

Myb

Foreward Primer

CATTCCCAAAGTACCAAGAAG

330bp

Revearse Primer

GGACTGGTGGTACCTGTGC

Potato virus Y Coat Protein

Foreward Primer

ATGCCAACTGTGATGAAT

200bP

Revearse Primer

ACTCGGCCCGAAGGTGACGCATTTCT

 

 

شکل 2- الکتروفورز محصولات حاصل از تکثیر ژن RDR1 لاین های توتون تراریخت R-14-1 و R-5-1  و توتون غیر تراریخت در ژل آگاروز 5/2 درصد . (L) مارکر وزن مولکولی 100 جفت باز (Promega, USA). اعداد به ترتیب بیانگر چرخه ای از واکنش PCR می باشد که محصول تکثیر جمع آوری شده است. NT-H: توتون غیر تراریخت مایه زنی نشده. NT-PVY: توتون غیر تراریخت مایه زنی شده با ویروس PVY. NT-TMV: توتون غیر تراریخت مایه زنی شده با ویروس TMV. N: کنترل منفی (به جای DNA از آب در مخلوط واکنش PCR استفاده شد).

 

 

 

شکل 3- الکتروفورز محصولات حاصل از تکثیر ژن RDR1 در لاین های توتون تراریخت R-14-1 ، R-5-1 ،R-14-1-1 و R-5-1-1 و توتون غیر تراریخت. (L) مارکر وزن مولکولی 100 جفت باز (Promega, USA) . Ui : نمونه سالم . PVY: نمونه های توتون غیر تراریخت و تراریخت مایه زنی شده با ویروس PVY. TMV: نمونه های توتون غیر تراریخت و تراریخت مایه زنی شده با ویروس .TMV +  ß-Tubulinشاهد مثبت برای ژن مورد بررسی. –  ß-Tubulin شاهد منفی برای ژن مورد نظر. +RDR1  شاهد مثبت برای ژن مورد بررسی. –RDR1 شاهد منفی برای ژن مورد نظر.

 

 

 

شکل 4- الکتروفورز محصولات حاصل از تکثیر بخشی از ژن پروتئین پوششی ویروس Potato virus Y (PVY°) در لاین های توتون تراریخت R-14-1 ، R-5-1 ،R-14-1-1، R-5-1-1 و توتون غیر تراریخت. L: مارکر وزن مولکولی 100 جفت باز (Promega,USA). N : کنترل منفی (از آب به جای DNA الگو در نمونه کنترل منفی استفاده شد).  NTRH : نمونه مربوط به گیاه توتون غیر تراریخت سالم. NTRI : نمونه مربوط به گیاه غیر تراریخت آلوده به ویروس  PVYº.

R-5-1

 (Ui)

R-5-1

(I)

R-14-1 (Ui)

R-14-1

(I)

R-5-1-1 (Ui)

R-5-1-1

 (I)

R-14-1-1 (Ui)

R-14-1-1 (I)

 

شکل 5- الگوی باندی قطعات 24-21 نوکلئوتیدی  RNA نمونه های مختلف توتون پس از لکه گذاری و آشکارسازی توسط کاوشگر بر روی غشاء نیتروسلولزی. باند های تیره تر بیانگر خاموشی بیشتر ژن RDR1 می باشد.Ui : نمونه سالم. I : نمونه آلوده به ویروسPVY.

 

شکل 6- الکتروفورز محصولات حاصل از تکثیر ژنهای RDR6 و IVR در لاین های توتون تراریخت              R-14-1 ، R-5-1 ،R-14-1-1 ، R-5-1-1 و توتون غیر تراریخت. (L) مارکر وزن مولکولی 100 جفت باز (Promega, USA). N : کنترل منفی (از آب به جای DNA الگو در نمونه کنترل منفی استفاده شد). NT-H : نمونه مربوط به گیاه توتون غیر تراریخت سالم. NT-PVY : نمونه مربوط به گیاه غیر تراریخت آلوده به ویروس  PVYº. اعداد به ترتیب بیانگر چرخه ای از واکنش PCR می باشد که محصول تکثیر جمع آوری شده است.

 

 

شکل 7- الکتروفورز محصولات حاصل از تکثیر ژنهای AOX1 و ERF5 در لاین های توتون تراریخت  R-14-1 ، R-5-1 ،R-14-1-1 ، R-5-1-1 و توتون غیر تراریخت. (L) مارکر وزن مولکولی 100 جفت باز (Promega, USA) . Ui : نمونه سالم تلقیح نشده.PVY : نمونه آلوده و مایه زنی شده با ویروس PVY ، یک هفته پس از مایه زنی.  +  ß-Tubulin: شاهد مثبت برای ژن مورد بررسی.–  ß-Tubulin: شاهد منفی برای ژن مورد نظر. ERF5-: شاهد منفی برای ژن مورد نظر. ERF5+: شاهد مثبت برای ژن مورد نظر. AOX1-: شاهد منفی برای ژن مورد نظر. AOX1+: شاهد مثبت برای ژن مورد نظر. NT : توتون تیپ وحشی غیر تراریخت.

 

نتایج آزمون Blotting-si نشان داد توتونهای تراریخت دارای قطعه های کوچک siRNA به اندازه 24 تا 22 نوکلئوتید می باشند (شکل 5). به این معنی که در آنها خاموشی ژن اتفاق افتاده است. همچنین مشخص شد که نسل دوم  لاین های تراریخت R-5-1 و R-14-1  به میزان بیشتری نسبت به نسلهای بعدی آنها یعنی R-5-1-1  و R-14-1-1 خاموش شده اند (شکل 5). همچنین نتایج این آزمون نشان داد لاین هایی که تعداد ساختارهای ساقه و حلقه خاموش کننده ژن RDR1 بیشتری را دریافت داشته اند مانند R-5-1 وR-5-1-1،  باند مربوط به قطعات بسیار کوچک RNA (siRNA) برای آنها پر رنگ تر از لاین هایی می باشد که تعداد نسخه های ژنی  خاموش کننده کمتری را دریافت داشته اند (R-14-1  وR-14-1-1) (شکل 5). مقایسه الگوی باندی نمونه آلوده به ویروس هر لاین با نمونه عاری از ویروس همان نمونه نشان داد که میزان siRNA بیشتری در تمام لاین ها پس از آلودگی به ویروس PVY در مقایسه با شاهد تولید می شود. همچنین در این آزمون از توتونهای غیر تراریخت نیز به عنوان شاهد استفاده شد. نمونه توتون غیر تراریخت هیچگونه باندی را نشان ندادند (شکل 5).

ارزیابی حساسیت توتونهای تراریخت به آلودگی ویروسی: بررسی نتایج کمی سنجی نسبی میزان رونوشتهای mRNA مربوط به ژنهای دخیل در مقاومت پایه گیاهان به آلودگیهای ویروسی شامل IVR ، AOX1 ، RDR6 و ERF5 در این پژوهش نشان داد که ژنهای مذکور به میزان زیادی در پاسخ فوق حساسیت تا 3 روز پس از مایه زنی ویروس TMV در توتون سامسون غیر تراریخت دارای ژن مقاومت N بیان می شوند (شکلهای 6 و 7). همچنین افزایش بیان ژنهای مذکور تا یک هفته بعد از مایه کوبی با ویروسPVYº در لاین های توتون غیر تراریخت مورد آزمون نیز مشاهده شد. با این وجود بیان ژنهای دخیل در مقاومت بعد از مایه کوبی با ویروس TMV در توتونهای غیر تراریخت بیشتر از ویروسPVYº افزایش پیدا کرد. نتایج حاکی از آن بود که با افزایش حساسیت به آلودگی ویروسیPVYº در لاین های توتون تراریخت دارای تعداد نسخه های کم ژن RDR1 ، میزان بیان ژنهای مقاومت در آنها نیز کاهش می یابد (شکلهای 6 و 7).  میزان نسخه های mRNA مربوط به ژنهای RDR6 و IVR در حالت سالم و یک هفته بعد از مایه زنی با ویروسPVYº در توتونهای تراریخت و غیر تراریخت و یا 3 روز بعد از مایه زنی با ویروس TMV در توتون غیر تراریخت با استفاده از RT-PCR نیمه کمی با 25 تا 40 چرخه PCR  ارزیابی شد. اندازه تولیدات حاصل از تکثیر ژنهای RDR6  ،IVR و Myb بر روی ژل آگارز 5/2 درصد مطابق با اندازه های اشاره شده در (جدول 3) برای هر ژن بود. نتایج نشان داد میزان نسخه های mRNA ژنهای دخیل در مقاومت میزبان شامل  IVR (Inhibitor of virus replication) و نیز(RNA-Directed RNA Polymerase-6) RDR6 با کاهش میزان نسخه های mRNA ژن RDR1 در توتونهای تراریخت کاهش یافته است (شکل 6). میزان بیان  ژنهای AOX1  و ERF5  (Ethylene response factor 5) در توتونهای سالم و آلوده یک هفته بعد از مایه زنی با هر یک از ویروسهای TMV و PVYº ارزیابی شد. میزان نسخه های mRNA ژنهای دخیل در مقاومت میزبان (AOX1 و ERF5) با کاهش نسخه های mRNA  ژن RDR1 در توتونهای تراریخت کاهش یافت (شکل 7).

بحث  

در این تحقیق از نسلهای 2 و 3 توتونهای تراریخت استفاده شد به این دلیل که کاهش عملکرد خاموشی ساختارهای ساقه و حلقه از نسل دوم به سوم بیشتر از آن چیزی بود که از نسل اول به دوم مشاهده می شد. پژوهشهای گذشته بر روی لاین های متعلق به نسل اول توتونهای تراریختی که در این تحقیق از آنها استفاده شد، نشان داده بود که ساختارهای ساقه - حلقه مورد استفاده با توان بسیار بالایی موجب خاموشی ژن RDR1 توتونهای تراریخت در نسل اول می شوند (22). از این رو از نسلهای دوم و سوم توتونهای مذکور برای این بررسی استفاده شد تا کارآیی ساختارهای ساقه و حلقه در خاموشی ژن در نسلهای بعدی مورد بررسی قرار گیرد.  نتایج آزمونهای Sq-RT-PCR پروتئین پوششی ویروس °PVY و نیز ژن RDR1 در توتونهای مورد بررسی حکایت از آن داشت که لاین های تراریخت دارای تعداد کم نسخه های mRNA از ژن RDR1 در مقایسه با توتون غیر تراریخت از حساسیت بیشتری نسبت به آلودگی ویروس PVYO برخوردار بودند و توان تهاجمی ویروس مذکور در نسل سوم نسبت به دوم کاهش پیدا کرده بود (شکلهای 2 و 4). به طوری که توتون لاین R-5-1  که دارای نسخه های بسیار کم mRNA  از ژن RDR1 در سلولها بود میزان بیشتری از پروتئین پوششی ویروسPVYO را در مقایسه با توتونهای غیر تراریخت در خود تکثیر نمود (شکل 4). این نتایج نشان می دهد که حضور بیشتر نسخه های mRNA از ژن RDR1 در سیتوپلاسم سلول احتمالاً می تواند موجب کنترل بیشتر آلودگی سیستمیک ویروسPVYO در توتون (N. tabaccum cv Samsun,NN) شود. در گذشته نیز نقش ژنهای RDR1 و RDR6 در دفاع پایه و ذاتی گیاهان بر علیه عوامل ویروسی ثابت شده بود (21 و 22 و 23). با وجود بررسی نقش ژن RDR1 در افزایش توان مقاومت گیاهان توتون و آرابیدوپسیس نسبت به آلودگیهای ویروسی در گذشته  (24، 29، 30، 31 و 32) تا کنون گزارشی از نقش ژن RDR1 در مقاومت بر علیه آلودگی سیستمیک ویروس PVYO وجود ندارد. همچنین نتایج این بررسی نشان داد که بیان ژنهای مسئول ایجاد مقاومت در برابر آلودگیهای ویروسی مانند  ERF5, AOX1و IVR به موازات کاهش بیان ژن RDR1 و افزایش حساسیت در توتونهای تراریخته کاهش پیدا می کنند (شکل 6). کاهش فاکتورهای مقاومت در لاین های تراریخته می تواند به دلیل نقش تنظیمی مثبت آنزیم RDR-1 در بیان آنها باشد (21). بنابراین این احتمال وجود دارد که نقش ژنRDR1 در دفاع پایه میزبان در برابر آلودگیهای پاتوژنیک تنها از طریق کمک به فرآیند خاموشی ژن نبوده و این آنزیم موجب تشدید سیگنال و انتقال مولکولهای پیامبر درون سلولی و عوامل دفاعی در میزبان گردد (21 و 22). به تازگی چنین نقشی برای دفاع توتون در برابر حمله حشرات به اثبات رسیده است )7 و 10). آنزیم RDR1 توتون ((N.attenuate در بیان متابولیت های ثانویه و ترکیبات آروماتیک دافع حشرات نقش دارد )17، 18 و 19(. نتایج این بررسی نشان داد که میزان خاموشی ژن RDR1 در نسل سوم در مقایسه با نسل قبل از آن کاهش پیدا کرده است (شکل 3). همچنین نشان داده شد که میزان قطعات کوچک siRNA به طول 24-21 نوکلئوتید در لاین های تراریخت R-14-1-1  و R-5-1-1  در مقایسه با لاین های R-5-1  و R-14-1 کاهش پیدا کرده است (شکل 5). داده های حاصل از بررسی فاکتورهای مقاومت نیز نشان داده است که بیان این فاکتورها در نسل سوم در مقایسه با نسل دوم افزایش پیدا کرده است (شکل 6). در گذشته اثبات شده بود کارآیی ساختار ساقه- حلقه در تنظیم منفی بیان ژن هدف به زیگوسیتی (Zygosity) لوکوس القاء کننده خاموشی و همچنین لوکوس ژن هدف بستگی دارد (4، 14 و 15). نتایج این تحقیق نیز نشان داد که نسلهای مختلف از لحاظ بیان ساختارهای خاموش کننده و میزان خاموشی متفاوت می باشند (شکل 5). که این امر می تواند به دلیل تفاوت زیگوسیتی در نسلهای مختلف لاین های توتون تراریخت باشد. از طرفی نتایج بررسیهای قبل مشخص ساخت که کارآیی ساختارهای ساقه و حلقه در خاموشی ژن با توجه به تفاوت در میزان بیان ژن هدف می تواند تغییر کند (11). این احتمال نیز وجود دارد که در نسل دوم توتونهای تراریخت، عملکرد بالای ساختارهای ساقه- حلقه در تحریک فرآیند خاموشی ژن پس از رونوشت برداری در سیتوپلاسم (PTGS) موجب القاء فرآیند خاموشی ژن در سطح رونوشت برداری (TGS) و متیله شدن DNA در هسته شده باشد و در نتیجه موجب کاهش میزان بیان عمومی ژنهای گیاه از جمله ژنهای ارزیابی شده در این تحقیق باشد و از این طریق دفاع پایه گیاه به آلودگی ویروسی کاهش پیدا کرده است (شکل 4). از طرفی این امکان نیز وجود دارد که کاهش کارآیی ساختارهای ساقه- حلقه در القاء فرآیند خاموشی ژن احتمالاً به دلیل انتقال کم نسخه های خاموش کننده ژن هدف به نسل سوم باشد که موجب کاهش خاموشی ژن و کاهش تولید siRNA و در نتیجه کاهش متیلاسیون DNA در هسته و افزایش عمومی بیان ژنها و کاهش میزان تکثیر ویروس در لاین های توتون نسل سوم  شده باشد ( شکلهای 6 و 7). از طرفی دیگر تحریک فرآیند خاموشی RNA در میزبان می تواند موجب متیله شدن پروموتر 35S یا ناحیه ای از توالی RNA در ساختمان ناقل بیان شونده شده باشد که در این صورت از طریق بیان نسخه های کم ساختارهای ساقه- حلقه راندمان ایجاد خاموشی RNA نیز می توانسته کاهش یابد. از طرفی نتایج پژوهشهای گذشته توسط وایستیژ و جونز نشان داد که ژن RDR6 می تواند در انتقال قطعات کوچک siRNA در طول گیاه نقش داشته باشد و از این طریق موجب افزایش کارآیی دفاع خاموشی ژن بر علیه عوامل ویروسی می شود (25). همچنین توسط گوو و همکاران نیز اثبات شده است که بیان ژن RDR6 متأثر از بیان ژن RDR1 در سلول می باشد (21). در این پژوهش نیز مشاهده شد که با کاهش بیان ژن RDR1 بیان ژن RDR6 نیز در نسل دوم توتونهای مورد بررسی کاهش می یابد (شکلهای 2 و 6). این احتمال وجود دارد که کاهش میزان خاموشی ژن RDR1 توسط ساختارهای ساقه- حلقه موجب افزایش بیان ژن RDR6 و افزایش مقاومت به آلودگی ویروسی در نسل سوم توتونهای مورد بررسی شده باشد. لازم به ذکر می باشد که نتایج این پژوهش بصورت پایه کارآیی ساختارهای ساقه- حلقه را در نسلهای مختلف توتونهای تراریخت مورد بررسی قرار داد و فاکتورهای ژنی مورد ارزیابی از نظر میزان حضور mRNA آنها در سیتوپلاسم بررسی شدند. توصیه می شود تا برای به دست آوردن نتایج دقیق تر در تحقیقات تکمیلی میزان بیان ژنهای مورد بررسی در این پژوهش بصورت کمی از سطح هسته تا سیتوپلاسم مورد بررسی قرار گیرد و حضور نسخه های خاموش کننده در لاین ها و نسلهای مختلف از لحاظ فرکانس انتقال با روشهای جدید مولکولی مورد بررسی قرار گیرد. همچنین از آنجا که امروزه از این ساختارها برای تولید گیاهان تراریخت گوناگون در بیوتکنولوژی استفاده می شود بنابراین توصیه می شود که میزان پایداری انتقال و نیز کارآیی خاموشی ژنها از طریق چنین ساختارهایی در سیستمهای مختلف گیاهی مورد ارزیابی دقیق تر قرار گیرد.

تشکر و قدردانی

از کمکها و راهنماییهای خانم دکتر Julie Squirs محقق بخش تحقیقات ویروس شناسی مرکز تحقیقات زراعی اسکاتلند (SCRI) صمیمانه تشکر و قدر دانی می شود. از زحمات دکترTomas Canto  و خانم دکتر Bung Num  ، محققین مرکز تحقیقات زراعی اسکاتلند قدردانی و تشکر می شود. همچنین از آقای دکتر Takeshi Minuru مدیر گروه تحقیقات مولکولی دانشگاه توکیو ژاپن و نیز پروفسورJun Peter Carr مدیر گروه بیوتکنولوژی دانشگاه کمبریج ، به خاطر همکاری ایشان با این تحقیق قدر دانی و تشکر می شود. 

1. Agrawal, N., Dasaradhi, P. V. N., Mohmmed, A., Malhotra, P., Bhatnagar, R. K., and Mukherjee, S. K. 2003. RNA interference: biology, mechanism, and applications. Microbiol. Mol. Biol. Rev. 67:  657-685.

2. Baulcombe, D. 2004. RNA silencing in plants. Nature 431: 356–363.

3. Baulcombe, D. 2005. RNA silencing. Trends. Biochem. Sci. 30: 290–293.

4. Bleys, A., Vermeersch, L., Van Houdt, H., and Depicker, A. 2006. The frequency and efficiency of endogene suppression by transitive silencing signals is influenced by the length of sequence homology. Plant Physiology 142: 788–796.

5. Canto, T., Cillo, F., and Palukaitis, P. 2002. Generation of siRNAs by T-DNA sequences does not require active transcription or homology to sequences in the plant. Mol. Plant-Microbe Interact. 15:1137-1146.

6. Clough, S. J. and Bent, A. F. 1998. Floral dip: a simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana. Plant J. 16: 735–743.

7. Horsch, R. B., Fry, J. E., Hoffman, N. L., Eichholz, D., Rogers, S. G., and Fraley, R. T. 1985. A simple and general method of transferring genes into plants. Science 279: 1486-1487.

8. Kerschen, A., Napoli, C. A., Jorgensen, R. A., and Muller, A. E. 2004. Effectiveness of RNA interference in transgenic plants. FEBS Letters. 566: 223–228.

9. Loebenstein, G., and Akad, F. 2006. The local lesion response. Pages 99-124 In: Natural Resistance Mechanisms of Plants to Viruses. Loebenstein, G., and Carr J.P., (eds). Springer, The Netherlands. PP. 99-124.

10. Lu, R., Martin-Hernandez, A. M., Peart, J. R.,  Malcuit, I., and Baulcombe, D. C. 2003. Virus-induced gene silencing in plants . Methods 30 :  296–303 .

11. Marjanac, G., Karimi,M., Naudts,M., Beeckman, T., Depicker, A., and De Buck, S. 2009. Gene silencing induced by hairpin or inverted repeated sense transgenes varies among promoters and cell types. New Phytologist. 184: 851–864.

12. Marone, M., Mozzetti, S., Ritis, D., Pierelli, L., and Scambia, G. 2001. Semiquantitative RT-PCR analysis to assess the expression levels of multiple transcripts from the same sample. Biol. Proced. Online. 3: 19-25.

13. Mayers, C. N., Lee, K. C., Moore, C. A., Wong, S. K., and Carr, J. P. 2005. Salicylic acid-induced resistance to Cucumber mosaic virus in squash and Arabidopsis thaliana: Contrasting mechanisms of induction and antiviral action. Mol. Plant- Microbe Interact. 18: 428-434.

14. Mittelsten Scheid, O., Afsar, K., and Paszkowski, J. 2003. Formation of stable epialleles and their paramutation-like interaction in tetraploid Arabidopsis thaliana. Nat Genet. 34: 450–454.

15. Mittelsten Scheid, O., Jakovleva, L., Afsar, K., Maluszynska, J., and Paszkowski, J. A.1996. Change of ploidy can modify epigenetic silencing. Proc. Natl. Acad. Sci. 93: 7114–7119.

16. Palukaitis, P., and Carr, J. P. 2008. Plant resistance to viruses. J. Plant Pathol. 90: 153-171.

17. Pandey, S. P., Priyanka, P., Gase, K., and Baldwin, I.T. 2008. Herbivory-induced changes in the small-RNA transcriptome and phytohormone signaling in Nicotiana attenuata. Proc. Natl. Acad. Sci. 105: 4559-4564.

18. Pandey, S. P., and Baldwin, I. T. 2007. RNA-directed RNA polymerase 1 (RDR1) mediates the resistance of Nicotiana attenuata to herbivore attack in nature. Plant J. 50:40–53.

19. Pandey, S. P., Gaquerel, E., Gase, K., and Baldwin, I. T. 2008. RNA-directed RNA Polymerase3 from Nicotiana attenuata is required for competitive growth in natural environments. Plant Physiol. 147: 1212–1224.

20. Peart, J. R., Cook, G., Feys, B. J., Parker, J. E., and  Baulcombe, D. C. 2002. Implication of SDE-1 gene in plant resistance to viruses. Plant J. 29: 569–579.

21. Qu, F., Ye, X., Hou, G., Sato, S., Clemente, T. E, and Morris, T. J. 2005. RDR6 has a broad-spectrum but temperature-dependent antiviral defense role in Nicotiana benthamiana. J. Virol. 79: 15209–15217.

22. Rakhshandehroo, F., Takeshita, M., Squires, J., and Palukaitis, P. 2009. The influence of RNA-dependent RNA polymerase 1 on potato virus Y infection and on other antiviral response genes. Mol. Plant- Microbe Interact. 22: 1312–1318.

23. Ribeiro, SG., Lohuis, H., Goldbach, R., and Prins, M. 2007. Tomato chlorotic mottle virus is a target of RNA silencing but the presence of specific short interfering RNAs does not guarantee resistance in transgenic plants. J. Virol. 81: 1563–1573.

24. Schwach, F., Vaistij, F. E., Jones, L., and Baulcombe, D. C. 2005. An RNA-dependent RNA polymerase prevents meristem invasion by potato virus X and is required for the activity but not the production of a systemic silencing signal. Plant Physiol. 138: 1842–1852.

25. Vaistij, F. E., and Jones, L. 2009.  Compromised Virus-Induced Gene Silencing in RDR6-Deficient Plants. Plant Physiology. 149: 1399-1407.

26. Vanitharani, R., Chellappan, P.,  and Fauquet, C. M. 2003. Short interfering RNA-mediated interference of gene expression and viral DNA accumulation in cultured plant cells. Proc. Natl. Acad. Sci. U.S.A. 100: 9632-9636 .

27. Wassenegger, M., and Krczal, G. 2006. Nomenclature and functions of RNA-directed RNA polymerases.  Trends Plant Sci. 11: 142-151.

28. Waterhouse, P. M., Graham, M. W., and Wang, M. B. 1998. Virus resistance and gene silencing in plants can be induced by simultaneous expression of sense and antisense RNA. Proc. Natl. Acad. Sci. 95: 13959-13964.

29. Xie, Z., Fan, B., Chen, C., and Chen, Z. 2001. An important role of an inducible RNA-dependent RNA polymerase in plant antiviral defense. Proc. Natl. Acad. Sci. 98: 6516-6521.

30. Yang, S. J., Carter, S. A., Cole, A. B., Cheng, N. H., and Nelson, R. S. 2004. A natural variant of a host RNA-dependent RNA polymerase is associated with increased susceptibility to viruses by Nicotiana benthamiana. Proc. Natl. Acad. Sci. U.S.A. 101: 6297-6302.

31. Ying, X. B., Dong, L., Zhu, h., Duan, C. G., Du, Q. S.,  Lv, D. Q., Fang, Y. Y., Garcia, J.A., Xiang Fang, R., and Guo, H. S. 2010. RNA-Dependent RNA Polymerase 1 from Nicotiana tabacum Suppresses RNA Silencing and Enhances Viral Infection in Nicotiana benthamiana. The plant cell. 17: 2-15.

32. Yu, D., Fan, B., MacFarlane, .S. A., and Chen, Z. 2003. Analysis of the involvement of an inducible Arabidopsis RNA-dependent RNA polymerase in antiviral defense. Mol. Plant-Microbe Interact. 16: 206–216.