نوع مقاله: مقاله پژوهشی

چکیده

امروزه آنتی بادیهای منوکلونال از پرمصرف ترین داروهای بیولوژیک هستند. اولین گام در این راستا ساخت قطعات آنتی بادی (ScFv) است که مزیت آن در داشتن اندازه کوچک، پاکسازی (کلیرانس) سریع از خون و نفوذپذیری بهتر به بافتها است. آنتی بادی منوکلونال A1D12 که سبب افزایش هضم لخته می شود، کاندید خوبی به عنوان دارو در بیماران مبتلا به اختلالات عروقی است. بنابراین هدف اصلی در این بررسی برداشتن اولین گامهای لازم در راستای انسانی کردن این آنتی بادی یعنی تهیه ScFv است. در این تحقیق، قطعه تک زنجیره ای از نواحی متغیر (ScFv) این آنتی بادی تهیه و در سیستم E.coli بیان شد. نتایج حاصل از SDS-PAGE و ELISA صحت تولید ScFv و قابلیت اتصال آن به پلاسمینوژن را اثبات می کنند.

کلیدواژه‌ها

عنوان مقاله [English]

Cloning, expression and immunological activity analysis of a ScFv from mouse monoclonal antibody against human plasminogen capable of enhancing fibrinolysis

چکیده [English]

Nowadays, monoclonal antibodies are the most applicable biological drugs. To that end, the construction of ScFv is the first step, having the advantage of small size, rapid clearance from blood, and better penetration to the tissues. A monoclonal antibody (A1D12) that enhances the activation of plasminogen 3-50-fold in the presence of plasminogen activators is a good candidate as a drug for coronary disorders. The main goal of this study is to construct the single chain fragment of variable (ScFv) for humanization. In this investigation ScFv of A1D12 has constructed and expressed in E.coli, which is capable of recognizing the corresponding antigen according to the results of SDS-PAGE and competitive ELISA respectively.

کلیدواژه‌ها [English]

  • cloning
  • ScFv
  • polymerase chain reaction (PCR)
  • fibrinolysis

کلونینگ، بیان و بررسی فعالیت ایمونولوژیکی ScFv حاصل از آنتی‏بادی منوکلونال موشی ضد پلاسمینوژن انسانی با توانایی افزایش فیبرینولیز 

محبوبه سیفی ابوالحسن1، منوچهر میرشاهی*،1، مهرداد بهمنش2، محمد رضا قرائتی1، فهیمه چربگو1، ملیحه محمدی1 و مهناز بژگی1 

1 تهران، دانشگاه تربیت مدرس، دانشکده علوم زیستی، گروه بیوشیمی 

2 تهران، دانشگاه تربیت مدرس، دانشکده علوم زیستی، گروه ژنتیک

تاریخ دریافت: 18/11/89             تاریخ پذیرش: 17/12/89 

چکیده

امروزه آنتی بادیهای منوکلونال از پرمصرف ترین داروهای بیولوژیک هستند. اولین گام در این راستا ساخت قطعات آنتی بادی (ScFv) است که مزیت آن در داشتن اندازه کوچک، پاکسازی (کلیرانس) سریع از خون و نفوذپذیری بهتر به بافتها است. آنتی بادی منوکلونال A1D12 که سبب افزایش هضم لخته می شود، کاندید خوبی به عنوان دارو در بیماران مبتلا به اختلالات عروقی است. بنابراین هدف اصلی در این بررسی برداشتن اولین گامهای لازم در راستای انسانی کردن این آنتی بادی یعنی تهیه ScFv است. در این تحقیق، قطعه تک زنجیره ای از نواحی متغیر (ScFv) این آنتی بادی تهیه و در سیستم E.coli بیان شد. نتایج حاصل از SDS-PAGE و ELISA صحت تولید ScFv و قابلیت اتصال آن به پلاسمینوژن را اثبات می کنند.

واژه های کلیدی: کلونینگ، ScFv، واکنش زنجیره‏ایی پلیمراز (PCR)، فیبرینولیز

* نویسنده مسئول، تلفن: 82884717 ، پست الکترونیکی: mirshahi_mc@yahoo.com

مقدمه 

 

فیبرینولیز شامل واکنشهای آنزیمی است که منجر به حل لخته فیبرین می شود. آنزیم کلیدی این سیستم، پلاسمین است که تحت تأثیر آنزیمهایی به نام فعال کنندگان پلاسمینوژن از پیش آنزیم پلاسمینوژن ساخته می شود و با اثر آنزیمی خود روی فیبرین، باعث حل شدن آن می گردد (5 و 20). پلاسمینوژن انسانی، گلیکوپروتئین تک زنجیره ای با 6 دمین ساختاری است که شامل پنج دمین کرینگل (Kringle) در قسمت انتهای آمین با توانایی اتصال به فیبرین و یک دمین پروتئازی شبیه سایر سرین پروتئازها است (4، 8 و 16). در هر یک از این کرینگل ها جایگاههای ویژه ای برای اتصال به اسید آمینه لیزین وجود دارد که به آنها نواحی اتصال به لیزین می گویند. این نواحی در کرینگل 5 (اسیدآمینه های 541-462) به یک اسیدآمینه لیزین در انتهای N متصل است (21) و همین امر سبب شده است که پلاسمینوژن ساختار بسته ای به خود بگیرد. این پیوند با اتصال به اسید آمینه های لیزین موجود در سطح فیبرین، باز می شود و در این حالت، پلاسمینوژن تحت اثر فعال کننده های پلاسمینوژن قرار می گیرد و به پلاسمین تبدیل می شود (3). آنتی بادی منوکلونال موشی تحت عنوان A1D12 که علیه اپی توپی (Arg68-Lys77) از انتهای آمین پلاسمینوژن انسانی است، می تواند سبب باز شدن ساختار پلاسمینوژن شود و تبدیل آن به پلاسمین را به کمک فعال کننده پلاسمینوژن 3 تا 50 برابر افزایش دهد (13). با دانستن این موضوع، به نظر می رسد که این آنتی بادی کاندید خوبی برای افزایش حل لخته در بیماران مبتلا به انسداد رگی باشد ولی با توجه به منشأ موشی و ایمونوژن بودن آن برای انسان نمی توان از آن مستقیماً استفاده نمود. بنابراین هدف اصلی در این تحقیق برداشتن اولین گامهای لازم در راستای انسانی کردن این آنتی بادی یعنی تهیه قطعه متغیر تک زنجیره‏ای (ScFv) آن است که متداول‌ترین شکل استفاده از قطعات آنتی‌بادیها است (19 و 6). در راستای رسیدن به این هدف، پس از طراحی پرایمر، این ساختار در سیستم بیانی E.coli بیان شد و با ELISA ی رقابتی قدرت شناسایی و اتصال به آنتی ژن مربوط بررسی شد.

مواد و روشها

کشت سلولهای A1D12، استخراج RNA و ساخت  cDNA: سلولهای هیبریدومای A1D12 در شرایط استریل با استفاده از محیط کشت RPMI 1640 حاوی 10 درصد سرم جنین گوساله و آنتی‌بیوتیک جنتامایسین (mg/ml 80) در انکوباتور کشت سلول کشت داده شدند. پس از رشد سلولها به مقدار 3 تا 5 میلیون، جمع آوری آنها با سانتریفیوژ به مدت 10 دقیقه در rpm 1000 انجام شد و سلول‏ها سه بار با بافر فسفات استریل شستشو داده شد و هر بار مانند مراحل پیشین سانتریفیوژ گردید. این سلولها تحت استخراج total RNA با استفاده از روش کار کیت استخراج (RNXTM Total RNA Isolation (BiONEER قرار گرفتند. غلظت RNA استخراج شده با استفاده از تکنیک طیف سنجی تعیین و کیفیت آن با ژل آگارز  (1 درصد) بررسی شد. در مرحله بعد cDNA با استفاده از پرایمر الیگو dT (Oligo(dT)18 primer) ساخته شد (18). صحت ساخت این محصول با پرایمرهای ژن موشی GAPDH به عنوان کنترل داخلی تحت واکنش زنجیره‏ای پلیمراز (PCR) با روش کار PCR Master Mix (سیناژن، ایران) بررسی شد. سپس محصولات PCR در ژل آگارز 1 درصد الکتروفورز شدند.

طراحی پرایمرها و انجام واکنش زنجیره‏ایی پلیمراز: طراحی پرایمر برای تکثیر ژن بخش متغیر زنجیره‏های سبک (VL) و سنگین (VH) با استفاده از سیستم بین‌المللی اطلاعات ایمونوژنتیکی یا IMGT (http://www.imgt.cines.fr) (9) انجام شد (جدول 1). برای تکثیر VL از پرایمرهای VLFR1 و VLC و برای تکثیر VH از پرایمرهای VHFR1 و CH1 استفاده شد. واکنش زنجیره ای پلیمرازی با PCR Master Mix (سیناژن، ایران) انجام شد. برای انجام PCR واسرشتگی اولیه در دمای 94 درجه سانتی گراد بمدت 2 دقیقه، سپس 30 سیکل متشکل از 45 ثانیه واسرشتگی در دمای 94 درجه سانتی گراد، 30 ثانیه دمای 55 درجه سانتی گراد برای اتصال پرایمرها و 1 دقیقه در دمای 72 درجه سانتی گراد طویل شدن صورت گرفت و طویل شدن نهایی 5 دقیقه در دمای 72 درجه سانتی گراد انجام شد (1). سپس محصولات PCR در ژل آگارز 1 درصد الکتروفورز شدند. قطعات PCR شده از ژل آگارز طبق روش کار ارائه شده در Gel Purification kit (BioNeer) استخراج و به کمک آنزیم لیگاز وارد TA وکتور (pTZ57R/T) شدند. سپس به سلولهای مستعد باکتری E.coli سویه  XL1-Blue منتقل شدند (18). این باکتری‏ ها در محیط کشت LB جامد حاوی آمپی‏سیلین (µg/ml 100) کشت داده شدند و کلون های رشد کرده تحت کلونی PCR با پرایمرهای روی بدنه TA وکتور با توالی های5¢GTTTCCCAGTTCACGAC3¢  و 5¢CAGGAAACAGCTATG AC 3¢  قرار گرفتند. کلون های مثبت دارای قطعه در محیط LB  مایع حاوی آمپی سیلین (µg/ml 100) کشت داده شدند و واکنش miniprep (استخراج پلاسمید) با استفاده از کیت  Plasmid mini extraction (BioNEER) انجام شد. پلاسمیدهای استخراج شده با استفاده از ژل آگارز (8/0 درصد) مورد بررسی قرار گرفتند و  4 عدد از این پلاسمیدهای دارای هر یک از قطعات VH و VL برای توالی یابی فرستاده شدند.

 

 

جدول 1- ترادف پرایمرهای دو زنجیره سبک (VL) و سنگین (VH).

VHFR1

5¢TCWGGRSSWGRVBTDSBRVNRYG3¢

CH1

5¢ AAYCTCCACACACAGGMMCCAGTGGATAGAC 3¢

VLFR1

5¢TGGTGGGAAGATGGATACAG3¢

VLC

5¢ AACTGGATGGTGGGAGATGGA 3¢

R(a, g); Y(c, t); M(a, c); K(g, t); S(g, c); W(a, t); V(a, c, g); H(a, t, c); B(g, t, c); D(g, a, t); N(a, c, g, t).

جدول 2- پرایمرهای Forward و Reverse برای PCR و اتصال دو قطعه VH و VL. جایگاه های برش Nco1 در پرایمر Forward و Sac1 در پرایمر Reverse به صورت ایتالیک و ضخیم نشان داده شده اند و زیر نواحی مکمل در هر دو پرایمر خط کشیده شده است.

ggCCATGGACGTTCAGGTGACTCAG3¢

Forward/VL

AGAACCACCTCCGCCTGAACCGCCTCCACCTGCAGCATCAGCCCG3¢

Reverse/VL/Linker

GGCGGAGGTGGTTCTGGCGGTGGCGGATCGGTGCAACTGCAGGAG3¢

Forward/Linker/VH

aaGAGCTCTCATGCGGAGACTGTGAGTAG3¢

Reverse/VH

 


طراحی پرایمر های مکمل برای اتصال VH و VL : نتایج توالیها و کروماتوگرامهای تمامی نمونه ها با هم مقایسه و در بانکهای اطلاعاتی ایمونوژنتیکی IMGT (http://www.imgt.cines.fr) (9) و NCBI (www.ncbi.nlm.nih.gov) بررسی شدند. طراحی دوباره پرایمرها برای اتصال این دو قطعه به هم انجام شد، به گونه ای که پرایمر های دو سر دارای جایگاه برش Nco1 و Sac1 بودند. پرایمر های میانی نیز حدود 15 نوکلئوتید مکمل هم بودند تا Linker 3 تکراری از Gly4Ser را بین دو قطعه VH و VL به وجود آورند. توالی این پرایمر ها در جدول 2 آورده شده است. جهت قرارگیری این قطعات نیز به گونه ای طراحی شد که در انتهای N پروتئین، دمین VL و انتهای C آن VH باشد یعنی به شکل VL-VH.

واکنش زنجیره ای پلیمرازی برای اتصال VH و VL  : در این مرحله این دو قطعه VH و VL به هم متصل شدند که برای این امر Splicing by Overlapping Extension PCR (SOE-PCR) انجام شد (7).

مواد مورد استفاده برای انجام این PCR همانند PCR در مراحل قبل است با این تفاوت که پرایمر های دو سر پس از گذراندن 5 سیکل به مخلوط واکنش افزوده شدند. نتایج

این PCR با الکتروفورز در ژل آگارز  1 درصد بررسی شد.

آماده سازی پلاسمیدهای بیانی و بیان پروتئین :

قطعات ScFv دارای جایگاه برش آنزیم Nco1 در انتهای ′5 زنجیره سبک و جایگاه برش آنزیم Sac1 در انتهای ′3 زنجیره سنگین می‌باشد. پلاسمید pET26b (+) که به عنوان وکتور بیانی انتخاب شده است نیز حاوی این جایگاههای برش آنزیمی بر روی خود می‌باشد. ابتدا با استفاده از جدول مربوط به خصوصیات آنزیمهای محدود کننده در کاتالوگ Takara شرایط بافری برای هضم دوتایی (Double Digest) به دست آورده شد و واکنش هضم آنزیمی انجام شد (18). سپس تمامی محصولات هضم شده ژل الکتروفورز شدند و قطعه ScFv و وکتور با کیت BiONEER از ژل تخلیص شدند و تحت واکنش با آنزیم لیگاز به هم متصل شدند. شناسایی باکتریهای دارای پلاسمید با آزمون Colony PCR با استفاده از پرایمرهای T7 Forward و T7 Backward انجام شد. کلونهای دارای قطعه طی روش کار ارائه شده در کیت Plasmid mini extraction (BioNEER) تحت استخراج پلاسمید قرار گرفته و برای توالی یابی فرستاده شد. بررسی نتایج توالیها و کروماتوگرامهای تمامی نمونه ها و مقایسه آنها طبق روشهای مذکور انجام شد. وکتورهای حاوی VL-VH به باکتریهای مستعد اشریشیاکلی سویه BL21 انتقال داده شدند و در پلیتهای LB-Agar با کانامایسین (µg/ml 50) به مدت 16 ساعت در انکوباتور 37 درجه سانتی گراد کشت داده شدند تا کلونیها رشد کنند. سپس برای تهیه پری کالچر یکی از کلونهای به دست آمده برداشته شد و در محیط کشت LB با کانامایسین (µg/ml 50) با دور همزن (rpm 250) و در مجاورت  37 درجه سانتی گراد کشت داده شد تا OD آن در nm 600 به 1-6/0 برسد. از این پری کالچر برای تلقیح چندین محیط کشت LB  با کانامایسین (µg/ml 50) جدید استفاده شد. پس از تلقیح، محیطهای کشت در 37 درجه سانتی گراد مجاور شدند تا OD در در nm 600 به 8/0 -4/0 رسید پس از برداشت 1 میلی لیتر نمونه به عنوان کنترل منفی، به مابقی محیط کشت جهت القاء،  IPTG با غلظت نهایی 1 میلی مولار اضافه شد و هر یک از محیطهای کشت در 28 درجه سانتی گراد به مدت 5 ساعت  مجاور شدند.

تخلیص پروتئین و ارزیابی اتصال به پلاسمینوژن انسانی با استفاده از ELISA رقابتی : پس از تایید تولید پروتئین ScFv با ژل الکتروفورز این باکتریها در حجم بیشتر کشت داده شدند و پس از گذشت 5 ساعت از القاء با سانتریفیوژ از محیط کشت جدا شدند. با روش شوک اسمزی در pET System Manual از شرکت Novagen، پروتئینهای پری ‏پلاسمی جدا شدند و برای تخلیص این پروتئین از بین پروتئینهای دیگر پری پلاسمیک و محیط کشت سلولی از روش جداسازی پروتئینها از ژل Native PAGE استفاده شد (17). برای ارزیابی اتصال ScFv به آنتی ژن پلاسمینوژن انسانی از ELISA رقابتی استفاده شد. هر یک از چاهکهای پلیت‏ ELISA با غلظت‌ ng/well 100 از آنتی ژن پلاسمینوژن انسانی پوشش‏ دهی شده و در دمای 4 درجه سانتی گراد به مدت یک شبانه روز انکوبه شدند. سپس چاهکها سه بار با بافر شستشوی الایزا (PBS/Tween 0.05%) شسته و با 100 میکرولیتر بافر بلاک کننده الایزا (PBS/BSA 1%) به مدت یک ساعت در دمای اتاق مجاور شدند. پس از شستشو با بافر شستشو، مقدار 100 میکرولیتر از ScFv تخلیص شده با غلظتهای افزایشی از  ng/ml 15 تا ng/ml 120 به چاهکها اضافه شد و به مدت یک ساعت در دمای اتاق مجاور گردید. در نمونه کنترل منفی از یک آنتی بادی منوکلونال دیگر که علیه اپی توپ انتهای کربوکسیل پلاسمینوژن است، استفاده شد. پس از 5 بار شستشو، به هر چاهک آنتی بادی منوکلونال A1D12 با غلظت ng/ml 100 افزوده شد و به مدت یک ساعت در دمای اتاق مجاور گردید. پس از انجام شستشو مانند مرحله قبل، به هر چاهک 100 میکرولیتر از HRP labeled goat anti-mouse Fc specific IgG با رقت 1:1000 افزوده شد و به مدت یک ساعت در دمای اتاق مجاور شد. پس از شستشو و اضافه کردن سوبسترا (TMB) واکنش پس از 3 دقیقه توسط اسید سولفوریک 2 نرمال متوقف گردید و OD پلیتها در 450 نانومتر با دستگاه الایزا خوان (Anthos 2020) قرائت شد. 

نتایج

پس از استخراج RNA کل، کیفیت آن با ژل الکتروفورز آگارز 1 درصد بررسی شد (شکل A1) سپس ساخت cDNA انجام شد و این محصول با پرایمر های کنترل داخلی تحت PCR قرار گرفت و باندی حدود 1200 جفت باز روی ژل الکتروفورز مشاهده شد که صحت ساخت cDNA را تأیید می کرد (شکل B1). واکنش PCR برای هر دو زنجیره سبک (VL) و سنگین (VH) انجام شد و باندهایی حدود 380 جفت باز روی ژل الکتروفورز آگارز 1 درصد به دست آمد (شکل C1). نتایج توالیها و کروماتوگرامهای تمامی نمونه ها با هم مقایسه شدند و میزان شباهت این توالیها با توالیهای ثبت شده در بانکهای اطلاعاتی IMGT (9) و NCBI بررسی شد(شکل 2). دو قطعه متغیر با استفاده از SOE-PCR به هم متصل شدند که نتایج ژل الکتروفورز باندی حدود 780 جفت باز را نشان می دهد (شکل D1). پس از وارد کردن قطعه VL-VH به پلاسمید حامل pET26b (+) مسیر بیان در باکتری اشریشیاکلی سویه BL21 القاء شد. پروتئین بیان شده پس از القاء، تحت ژل الکتروفورز SDS-PAGE  5/12 درصد قرار گرفت که باندی حدود 33 کیلودالتون را نشان می دهد. پس از جداسازی پروتئین محلول پری پلاسمیک، تخلیص آن از ژل انجام شد که نتیجه آن در شکل 4 مشهود است. بررسی اتصال پروتئین ScFv به آنتی ژن پلاسمینوژن با تست ELISA رقابتی نسبت به آنتی بادی منوکلونال مادر A1D12 سنجیده شد که نتایج در شکل 5 نشان داده شده است. همان طور که در این شکل مشاهده می شود در غیاب ScFv، OD حاصل از اتصال آنتی بادی مادر حدود 1 است. در حضور غلظتهای افزایشی از ng/ml 15 تا ng/ml 120 از ScFv، OD کاهش می یابد (ستونهای تیره) با این تفاوت که در OD آنتی بادی کنترل هیچگونه تغییری مشاهده نمی شود (ستونهای روشن).

 

 

شکل 1- A: الکتروفورز RNA کل و 3 باند آن. B: ژل آگارز 1 درصد از محصول PCR با پرایمرهای کنترل داخلی که در آن 1 مارکر DNA و 2 باند 1200 جفت بازی را نشان می دهد. C: نتایج حاصل از PCR دو زنجیره سبک (VL) و سنگین (VH) که 1 همان کنترل مثبت، 2 محصول PCR از VH و 3 محصول PCR از VL است و 4 مارکر DNA است. D: نتیجه حاصل از SOE-PCR را نشان می دهد که در آن 1 مارکر DNA و 2 قطعه VL-VH است.

 

شکل 2- بررسی ژنهای VH و VL در بانکهای اطلاعاتی در IMGT و میزان شباهت آن به سایر ژنهای ثبت شده در این سایت.


 

شکل 3- بیان پروتئین نوترکیب. پروتئین بیان شده در حدود 33 کیلودالتون است که در شکل مشخص شده است.M: مارکر پروتئین، C-: کنترل منفی، 5h: بررسی بیان پس از 5 ساعت

 

 

شکل 4- پروتئین ScFv پس از تخلیص روی ژل SDS-PAGE   5/12 درصد. باند پروتئینی 33 کیلودالتونی در آن مشخص است.

بحث

توانایی ویژه آنتی بادی در تشخیص و اتصال به آنتی ژن زمینه ساز کاربرد وسیع آن در پزشکی و تحقیقات علمی گشته است (11، 14 و 19) اما در رسیدن به این اهداف مشکلات فراوانی وجود دارد که از مهم ترین آنها، فعال شدن پاسخهای ایمنی علیه آنتی بادی ارائه شده به انسان است. از این رو موضوع انسانی کردن آنتی بادیها مطرح شد که اولین گام در این راستا ساخت قطعات آنتی بادی (ScFv) است که در آن نواحی متغیر زنجیره سبک و سنگین به وسیله یک اتصال دهنده پپتیدی به طور مصنوعی به هم متصل می شوند. مزیت ScFv ها در داشتن اندازه کوچک، پاکسازی (کلیرانس) سریع از خون، نفوذپذیری بهتر به بافتها و پایداری در دمای 37 درجه سانتی گراد هستند (19).

همان طور که در مقدمه ذکر شد آنتی بادی منوکلونال موشی (A1D12) می تواند در حضور فعال کنندگان پلاسمینوژن سبب افزایش فیبرینولیز شود (2 و 13). بنابراین این آنتی بادی پتانسیل استفاده در درمان با فیبرینولیز را دارد، لیکن لازم است که به کمک ساخت قطعات آنتی بادی (ScFv) از خواص ایمونوژنیک آن کاسته شود (15). در این راستا، پس از کشت سلولهای هیبریدوما، استخراج RNA کل به خوبی انجام شد بطوری که در شکل A1 سه باند مربوط به rRNA یا RNA ریبوزومی یوکاریوتی S 28، S 18 و S 8/ 5 در ژل مشخص است. با استفاده از این RNA، cDNA ساخته شد (شکل B1). مساله اساسی در این تحقیق، طراحی و انتخاب پرایمرهای مناسب است که طراحی پرایمر برای ناحیه داربستی 1 (FR1) در سر ′5 و ناحیه ثابت (Constant) در سر ′3 انجام شد. همان طور که در شکل 2 مشاهده می شود این پرایمر ها در جداسازی دو ژن VH و VL با تشابهات به ترتیب 82/95 و 68/94 موفق بودند (این توالیها تحت پتنت در سازمان ثبت اختراعات ایران هستند). با توجه به اهمیت جهت گیری دمینهای VH و VL، برای اتصال این دو قطعه به هم پرایمر هایی طراحی شد که دمین VL در انتهای آمینی پروتئین ScFv قرار گیرد. جهت گیری VL–VH قدرت اتصال بالایی به آنتی ژن دارد که در این پژوهش ساخته شد (12). مرحله مهم دیگر در ساخت ScFv فعال، انتخاب یک سیستم بیانی مناسب و کارآ است. پروتئین ScFv دارای دو پیوند دی سولفیدی درون زنجیره ای است که تشکیل درست این دو پیوند نقش بسیار مهمی در فعالیت بیولوژیکی این پروتئین دارد. تشکیل این پیوندهای دی سولفیدی در محیط احیایی سیتوپلاسم صورت نمی گیرد بلکه نیازمند محیط اکسیداتیو فضای پری پلاسمی است (10). با توجه به این دانسته ها وکتور بیانی pET26b (+) انتخاب شد که دارای توالی رهبر pelB است و پروتئین را به سمت فضای پری پلاسمی هدایت می کند. پس از بیان در سیستم پروکاریوتی E.coli همان طور که در شکل 3 مشاهده می شود، پروتئین محلول پری پلاسمی تخلیص شد (شکل 4) و تحت ELISA رقابتی با آنتی بادی والدی A1D12 قرار گرفت (شکل 5). با استناد به نتایج به دست آمده، می توان این نکته را بیان کرد که ScFv تولید شده، فعال است و می تواند آنتی ژن خود را بشناسد و به عنوان اولین ScFv تولید شده بر علیه پلاسمینوژن انسانی است که ویژگیهای اتصالی آنتی بادی منوکلونال اولیه خود را حفظ کرده است.

لازم به ذکر است که علی رغم وجود سایر آنتی بادیهای منوکلونال تجاری علیه پلاسمینوژن انسانی، فعالیت افزایش لیز لخته در آنها گزارش نشده است که این موضوع اهمیت تحقیق حاضر و ادامه کار را برای مقاصد درمانی بالقوه زیاد می کند.


 

شکل 5- بررسی اتصال پروتئین  ScFvبه آنتی ژن پلاسمینوژن با تست ELISA رقابتی

  1. قرائتی محمد رضا، میرشاهی منوچهر، ربانی حجت اله، سیفی ابوالحسن محبوبه،  بهمنش مهرداد، شمسی پور فرشته، 1391. مجله علمی-پژوهشی زیست شناسی ایران، شماره 25 (تصویب شده و زیر چاپ).
  2. ملکی علی، منصوری کامران، میرشاهی منوچهر، پورفتح اله علی اکبر، اکرمی محمد، 1388. پتانسیل آنتی پلاسمینوژن منوکلونال آنتی بادی در دستکاری دو سیستم فیبرینولیز و آنژیوژنز. مجله دانشکده پزشکی تهران، شماره 1: صفحات 33-41.
    1. Browne, M. J., Chapman, C. G., Dodd, I., Reavy, B., Esmail, A. F., Robinson, J.   H., 1989. The role of tissue-type plasminogen activator A-chain domains in plasma clearance. Fibrinolysis, 3: 207-214.
    2. Cesarman-Maus, G, Hajjar, K. A., 2005. Molecular mechanisms of fibrinolysis. Br. J. Haematol., 129:307.
    3. Dobrovolsky, A. B. , Titaeva, E. V., 2002. The Fibrinolysis System: Regulation of Activity and Physiologic Functions of Its Main Components. Biochemistry (Moscow), 67(1): 99-108.
    4. Holliger, P. and Winter, G., 1997. Diabodies: small bispecific antibody fragments. Cancer Immunology Immunother. 45: 128-130.
    5. Horton, R. M., Cai, Z., Ho, S. N., Pease, L. R., 1990. Gene splicing by overlap extension: tailor-made genes using the polymerase chain reaction. BioTechniques, 8: 528-535.
    6. Kunamneni, A., Abdelghani, T. T., Ellaiah, P., 2007. Streptokinase-the drug of choice for thrombolytic therapy. J. Thromb. Thrombolysis, 23(1):9-23.
    7. Lefranc, M. P., Giudicelli, V., Kaas, Q., Duprat, E., Jabado-Michaloud, J., Scaviner, D., Ginestoux, O., Clement, D., Lefranc, G., 2005. IMGT, the international ImMunoGeneTics information system. Nucleic Acids Res., 33: D593-
    8. Lilie, H., Schwarz, E., Rudolph, R., 1998. Advances in refolding of proteins produced in E. coli. Curr Opin Biotechnol., 9(5):497-501.
    9. Lipman, N. S., Jackson, L. R., Trudel, L. J., Weis-Garcia, F. J., 2005. Monoclonal Versus Polyclonal Antibodies: Distinguishing Characteristics, Applications, and Information Resources, ILAR Journal, 46 (3): 258-68.
    10. Lu, D., Jimenez, X., Witte, L., Zhu, Z., 2004. The effect of variable domain orientation and arrangement on the antigen-binding activity of a recombinant bispecific diabody. Biochem Biophys Res Commun., 318: 507-13.
    11. Mirshahi, M., Soria, J., Lijnen, H., Fleury, V., Bertrand, O., Drouet, L., Caen, JP., Soria, C., 1997. A monoclonal antibody directed against an epitope in the NH2-terminal region of native human plasminogen induces a modification of its functional properties. Fibrinolysis and Proteolysis, 11: 155-163.
    12. Mosesson, M. W, Siebenlist, K. R, Hainfeld. J. F, Wall JS., 1995. The covalent structure of factor XIIIa crosslinked fibrinogen fibrils. J Struct Biol., 115: 88-101.
    13. Presta L., 2003. Antibody engineering for therapeutics. Curr Opin Struct Biol., 13(4):519-25.
    14. Raum, D., D. Marcus, and C. A. Alper. 1980. Genetic polymorphism of human plasminogen. Am. J. Hum. Genet., 32:681-689.
    15. Retamal, C. A., Thiebaut, P., Alves, E. W., 1999. Protein purification from polyacrylamide gels by sonication extraction. Anal Biochem., 268(1):15-20.
    16. Sambrook J. and Russell, D. W., 2001. Molecular Cloning, 3rd edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, USA.
    17. Sharkey, R. M., Goldenberg, D. M., 2005. Perspectives on cancer therapy with radiolabeled monoclonal antibodies. J Nucl Med., 46(Suppl 1): 115S-127S.
    18. Stoica, E., Costa-Foru, D., Cherciulescu, F., 1967. The reactivity of the clotting mechanism and fibrinolysis in cerebral thrombotic disease. J. Neur. Sci., 8: 491-500.
    19. Wang, X., Lin, X., Loy, J. A., Tang, J., and Zhang, X. C., 1998. Crystal Structure of the Catalytic Domain of Human Plasmin Complexed with Streptokinase. Science, 281 (5383):1662-1665.