نوع مقاله: مقاله پژوهشی

چکیده

باکتری شیگلا و سویه های اشرشیا کلی مهاجم روده ای (EIEC) جزء خانواده با کتریهای گرم منفی و عامل مسری ترین اسهال باسیلی (شیگلوز) می باشند. ژن virG یکی از  فاکتور های ضروری در آسیب زایی باکتری شیگلا است. پروتئین رمزگذاری شده توسط این ژن، بر روی غشای خارجی (OM) شیگلا قرار گرفته و به خانواده پروتئینهای خود منتقل شونده AT (Autotrnasporter) خارج سلولی در باکتریهای گرم منفی تعلق دارد. یکی از روشهای ساخت واکسنهای شیگلا ایجاد تخفیف حدت در سویه های وحشی از طریق جهش زایی در ژنهای ویژه آسیب زایی باکتری می باشد. هدف از این مطالعه شناسایی، همسانه سازی و تعیین توالی ژن virG و ایجاد سویه زنده تخفیف حدت یافته virGΔ با استفاده از سیستم λ Red recombinase در سویه شیگلا دیسانتری تیپ1 جدا شده از مبتلایان به شیگلوز بود. در ابتدا با استفاده از آزمایش سرم شناسی و واکنش زنجیره ای پلیمراز (PCR)، گونه و سرووار شیگلای جدا شده از بیمار مورد بررسی و تأیید قرار گرفت. با توجه به اطلاعات موجود در پایگاه داده های ژنومی (NCBI)، آغازگرهای شناسایی ژن virG طراحی و پس از تکثیر این ژن، در حامل pGEM-7zf همسانه سازی و توالی یابی با استفاده از آغازگر های عمومی حامل انجام گردید. سویه مذکور توسط پلاسمید کمکی pKD46 (حامل ژنهای لازم برای القای نوترکیبی تحت پروموتور آرابینوز) با روش شوک الکتریکی تراریخت گردید. بعد از طراحی آغازگر های ویژه القای نوترکیبی، واکنش PCR با استفاده از حامل pKD3 (دارای کاست کلرامفنیکل که با توالیهای FRT همجوار شده است) اجرا شد. تراریخت سازی کاست آنتی بیوتیکی پس از خالص سازی، در سویه شیگلا بومی حامل pKD46 با استفاده از روش شوک الکتریکی انجام شد. سویه جهش یافته با جایگزینی کاست کلرامفنیکل با ژن virG از طریق وقوع نوترکیبی هومولوگ به دست آمد. سپس کاست آنتی بیوتیکی با به کارگیری پلاسمید کمکی pCP20 (حامل آنزیم FLP ریکامبیناز) از طریق جایگاه های FRT حذف گردید. صحت فرآیند از طریق بررسی خصوصیات  فنوتیپی (رشد سویه مقاوم به کلرامفنیکل) و ژنوتیپی (واکنش PCR با آغازگر های خارجی و سپس توالی یابی محصول آن) مورد تأیید قرار گرفت. نتایج به دست آمده حاصل از تعیین توالی ژن virG در مقایسه با سویه استاندارد (با شماره دسترسیCP000035)، هم خوانی کامل (100 درصد) را  تأیید نمود. اطلاعات حاصل ازآنالیز بیوانفورماتیکی حذف 3220 جفت باز از ژن virG را در سویه جهش یافته نشان داد. استفاده از سیستم λ Red recombinase ایجاد جهش را تسهیل و در مقایسه با سایر روشها مانند حاملهای انتحاری، روشی مؤثر و ارزان تر می باشد.

کلیدواژه‌ها

عنوان مقاله [English]

Identification, cloning, sequencing virG gene and construction a live Attenuated ΔvirG(icsA) strain byusing λ Red recombinase

چکیده [English]

Shigella and enteroinvasive Escherichia coli (EIEC) strains are belong to the gram negative bacterium family which cause the most communicable of bacterial dysenteries (shigellosis). The virG gene as an essential factor is required for pathogenicity of shigella. This protein encoded via virG gene which located on the outer membrane (OM) of bacteria surface. Furthermore, the VirG protein belonging to autotransporter (AT) protein family of extracellular protein's gram-negative bacteria. This protein interacts with the host actin regulatory protein which caused intra- and intercellular spreading throughout the host epithelium. One approach for construction of Shigella vaccines is to attenuate wild-type strains by mutating genes which regulate specific virulence properties. The aim of this research was identification, cloning, sequencing virG gene and construction of a live attenuated ΔvirG by use of the λ Red recombinase in Shigella dysenteriae type 1isolated from patients with shigellosis. By use of serological and Polymerase Chain Reaction (PCR) tests, species and serotype of shigella seperated from patient was confirmed. According to the Gene Bank database (NCBI), detection primers of virG gene was designed, after amplification of virG, this construct was cloned to pGEM-7zf vector as cloning vector. Finally, sequencing was performed by use of universal primers of vector. The pKD46 as helper plasmid (composed of the essential genes for induce recombination under arabinose promoter) was transformed to the native shigella by using electroporation. After designing the primes which require for induction recombination, the PCR reaction performed through pKD3 vector (which compose of chloramphenicol cassette flanked by FRT sequence). After purification of chloramphenicol cassette, this cassette transformed to the native shigella which carrying pKD46 by using electronic shock. Mutant strain obtained by occurring homologous recombination between chloramphenicol cassette and virG gene. Then, antibiotic cassette was eliminated via FRT sites by application of pCP20 (carrying FLP recombinase) as helper plasmid. Precision of process was confirmed by phenotypic (growth resistant strain to chlramphenicol) and genotypic (PCR reaction with external primers and then sequencing of its product) characterization. The result sequencing of virG in comparison with standard strain as reference strain (Accession No. CP000035)  was identical (100%). According to bioinformatics analysis mutant strain, deletion of 3220 bp of virG gene was confirmed. Utilization of λ Red recombinase system facilitates mutant construction in more cost-effective method in comparison with the other techniques such as suicide vector.

کلیدواژه‌ها [English]

  • Shigellosis
  • Shigella dysenteriae type 1
  • virG (icsA)
  • λ Red recombinase
  • homologous recombination

شناسایی، همسانه سازی، تعیین توالی ژن virG و ایجاد سویه بومی تخفیف حدت یافته virGΔ با استفاده از سیستم λ Red recombinase 

سید مصطفی حسینی1،5، مجتبی سعادتی2، بهار نیری فسایی3، تقی زهرایی صالحی3، حورا احمدی دانش4، مهدی تات2 و احسان حسینی6،* 

1 تهران، دانشگاه علوم پزشکی بقیه الله (عج)، مرکز تحقیقات ژنتیک انسانی  

2 تهران، دانشگاه جامع امام حسین (ع)، گروه زیست شناسی 

3 تهران، دانشگاه تهران، دانشکده دامپزشکی، گروه میکروبیولوژی 

4 تهران، پژوهشگاه ملی مهندسی ژنتیک و زیست فناوری، گروه صنعت و محیط زیست 

5 تهران، دانشگاه آزاد اسلامی، واحد علوم و تحقیقات، باشگاه پژوهشگران جوان 

6 تهران، دانشگاه آزاد اسلامی، واحد تهران مرکز، باشگاه پژوهشگران جوان 

تاریخ دریافت: 10/12/89             تاریخ پذیرش: 21/9/90 

چکیده

باکتری شیگلا و سویه های اشرشیا کلی مهاجم روده ای (EIEC) جزء خانواده با کتریهای گرم منفی و عامل مسری ترین اسهال باسیلی (شیگلوز) می باشند. ژن virG یکی از  فاکتور های ضروری در آسیب زایی باکتری شیگلا است. پروتئین رمزگذاری شده توسط این ژن، بر روی غشای خارجی (OM) شیگلا قرار گرفته و به خانواده پروتئینهای خود منتقل شونده AT (Autotrnasporter) خارج سلولی در باکتریهای گرم منفی تعلق دارد. یکی از روشهای ساخت واکسنهای شیگلا ایجاد تخفیف حدت در سویه های وحشی از طریق جهش زایی در ژنهای ویژه آسیب زایی باکتری می باشد. هدف از این مطالعه شناسایی، همسانه سازی و تعیین توالی ژن virG و ایجاد سویه زنده تخفیف حدت یافته virGΔ با استفاده از سیستم λ Red recombinase در سویه شیگلا دیسانتری تیپ1 جدا شده از مبتلایان به شیگلوز بود. در ابتدا با استفاده از آزمایش سرم شناسی و واکنش زنجیره ای پلیمراز (PCR)، گونه و سرووار شیگلای جدا شده از بیمار مورد بررسی و تأیید قرار گرفت. با توجه به اطلاعات موجود در پایگاه داده های ژنومی (NCBI)، آغازگرهای شناسایی ژن virG طراحی و پس از تکثیر این ژن، در حامل pGEM-7zf همسانه سازی و توالی یابی با استفاده از آغازگر های عمومی حامل انجام گردید. سویه مذکور توسط پلاسمید کمکی pKD46 (حامل ژنهای لازم برای القای نوترکیبی تحت پروموتور آرابینوز) با روش شوک الکتریکی تراریخت گردید. بعد از طراحی آغازگر های ویژه القای نوترکیبی، واکنش PCR با استفاده از حامل pKD3 (دارای کاست کلرامفنیکل که با توالیهای FRT همجوار شده است) اجرا شد. تراریخت سازی کاست آنتی بیوتیکی پس از خالص سازی، در سویه شیگلا بومی حامل pKD46 با استفاده از روش شوک الکتریکی انجام شد. سویه جهش یافته با جایگزینی کاست کلرامفنیکل با ژن virG از طریق وقوع نوترکیبی هومولوگ به دست آمد. سپس کاست آنتی بیوتیکی با به کارگیری پلاسمید کمکی pCP20 (حامل آنزیم FLP ریکامبیناز) از طریق جایگاه های FRT حذف گردید. صحت فرآیند از طریق بررسی خصوصیات  فنوتیپی (رشد سویه مقاوم به کلرامفنیکل) و ژنوتیپی (واکنش PCR با آغازگر های خارجی و سپس توالی یابی محصول آن) مورد تأیید قرار گرفت. نتایج به دست آمده حاصل از تعیین توالی ژن virG در مقایسه با سویه استاندارد (با شماره دسترسیCP000035)، هم خوانی کامل (100 درصد) را  تأیید نمود. اطلاعات حاصل ازآنالیز بیوانفورماتیکی حذف 3220 جفت باز از ژن virG را در سویه جهش یافته نشان داد. استفاده از سیستم λ Red recombinase ایجاد جهش را تسهیل و در مقایسه با سایر روشها مانند حاملهای انتحاری، روشی مؤثر و ارزان تر می باشد.

واژه های کلیدی: شیگلوز، شیگلا دیسانتری تیپ 1، (icsA)virG،  λ Red recombinase

* نویسنده مسئول، تلفن:09372697774، پست الکترونیکی:Geneticman2005@gmail.com  

مقدمه


شیگلا دیسانتری تیپ1باکتری گرم منفی، بی هوازی اختیاری و بدون اسپور می باشد که به خانواده انتروباکتریاسه تعلق دارد (16). بیماری که توسط شیگلا ایجا‌د می‌شود شیگلوز نام دارد. شیگلوز یک بیماری عفونی است که قسمتی از روده کوچک را تحت تأثیر قرار می‌دهد. شیگلوز با علائمی مانند اسهال آبکی به همراه مقادیر مختلفی از خون و مخاط، تب، حالت تهوع، استفراغ، گرفتگی و درد شکمی تشخیص داده می شود (3 و 17). در بین گونه های شیگلا، شیگلا دیسانتری تیپ 1 علاوه بر علائم فوق، از طریق ناهنجاری سیستم اعصاب مرکزی، تشنج و بیماری (HUS)Hemolytic Uremic Syndrom نیز قابل تشخیص می باشد (16). 

شیگلا از نظر ژنتیکی بسیار شبیه اشریشیا کلی می باشد که گاهی حتی از آن به عنوان اشریشیا کلی بیماریزا یاد می شود (3)، تقریباً 99 درصد عفونتهای شیگلا در مناطق در حال توسعه رخ می دهد و سالانه حدود 1/1 میلیون نفر از مبتلایان به شیگلوز متاسفانه می میرند که 60 درصد آنها را، کودکان زیر 5 سال تشکیل می دهند (4، 10).

شیگلا پس از ورود به بدن میزبان، ناحیه راست روده و کلون را در دستگاه گوارش هدف قرار می دهد، سپس قادر است این تهاجم را به سلولهای پوششی غیر فاگوسیتی نیز گسترش دهد، این فرآیند از طریق پروتئینهایی صورت می گیرد که در تمام سویه های بیماریزا به شدت حفاظت شده هستند. این پروتئینها توسط یک پلاسمید بزرگ 213 کیلوبازی رمز می گردند که از آن به عنوان پلاسمید تهاجمی و یا پلاسمید بیماریزا یاد می شود (31 و 32). هر باکتری نهایتاً درون یک واکوئل اندوسیتوزی بلعیده شده و سپس با پاره کردن واکوئل به درون سیتوپلاسم سلول پوششی میزبان رها می گردد و پس از تکثیر در آنجا، به کمک پروتئین IcsA (IntraCellular Spreading A)، که به نام VirG نیز شناخته می شود، به سمت سلولهای پوششی مجاور حرکت می کند (5، 19 و 28). پروتئین VirG از سه بخش تشکیل شده است که بخش انتهایی آن با پروتئین N-WASP میزبان وارد واکنش شده و با فعال کردن کمپلکس 3/2Arp در سیتوپلاسم، موجب پلیمریزه شدن اکتین های گلوبولی به شکل اکتین رشته ای (F-actin) می شود که نتیجه آن، گسترش آلودگی در بدن میزبان است (30). یاخته های شیگلا که دارای نقص در ژن virG(icsA) هستند در تمام مدلهای حیوانی قدرت بیماریزایی کمتری دارند به طوری که در نهایت از طریق جریان گلبولهای سفید چند هسته ای (PMN)، از بدن میزبان حذف می گردند و بدین نحو عفونت از بین می رود. بنابراین جهش در ژن virG (icsA) محور اصلی کاهش بیماریزایی در چندین سویه واکسن تقلیل حدت یافته می باشد (5).

روشهای مختلفی جهت حذف و غیر فعال نمودن ژنها در باکتریها گزارش شده است که برای درک بیولوژی مولکولی ، فیزیولوژی، تنظیم ژنتیکی و بیماریزایی ارگانیسم ها بسیار حائز اهمیت است. روشهای اولیه ای که برای ایجاد سویه های تخفیف حدت یافته به منظور تولید واکسن در باکتری و ویروسهای بیماریزا مورد استفاده قرار می گرفت شامل پاساژ های متوالی و جهش زایی با مواد شیمیایی بود. این روشها فاقد اختصاصیت بودند، به همین دلیل توسط تکنیکهای پیشرفته تر مهندسی ژنتیک و نوترکیبی هومولوگ که بر مبنای حذف هدفمند ژنهای بیماریزا استوارند جایگزین گردیدند که اغلب، از این فرآیندها به عنوان مهندسی ژنتیک معکوس تعبیر می شود. یکی از روشهای نسبتاً جدید در مهندسی ژنتیک که اخیراً ظهور پیدا کرده است، استفاده از سیستم نوترکیبی Red (ویژه فاژ لامبدا) در باکتریها می باشد (7، 8، 23 و 37).

برای مدت زمان زیادی دانشمندان از این نکته آگاهی داشتند که بسیاری از باکتریوفاژ ها سیستم نوترکیبی هومولوگ مختص به خود را دارا هستند. در سال 1998 مورفی و همکاران نشان دادند که عملکرد ژنهای Red باکتریوفاژ لامبدا، باعث افزایش چشمگیر بازدهی نوترکیبی، در سویه های جهش یافته در ژنهای recBC sbcB یا recD  می گردد (23). در سال 2000 داتسنکو و وانر روشی را برای غیر فعال کردن یک مرحله ای ژنهای کروموزومی درسویه E.coli K12 از طریق وقوع نوترکیبی بین محصول PCR و میزبان بیان کننده ژنهای سیستم Red پیشنهاد نمودند  (8- 23). در واقع این تکنیک، مشابه روشی بود که برای سالهای زیادی در مخمر به کار گرفته می شد.  این روش ابزار مفیدی را به منظور ایجاد جهشهای هدفمند در باکتریها فراهم می آورد و باعث جلوگیری از به کار بردن پلاسمید های انتحاری یا دیگر پلاسمید های مشابه (حامل سازه های ژنی ویژه) می گردد. با استفاده از این روش می توان سازه های ژنی مورد نظر را بر روی پلاسمید یا به طور مستقیم در ژنوم باکتری به صورت in vivo از طریق وارد نمودن محصول PCR یا اولیگونوکلئوتید های سنتزی با تکیه بر پدیده نوترکیبی هومولوگ وارد نمود. این امر امکان پذیر است، زیرا پروتئینهای مسئول نوترکیبی فاژی به طور مؤثری قادرند تنها توالیهای بین 30 تا 50 جفت باز که دارای همخوانی با ژن هدف باشند را، در ژنوم میزبان وارد نمایند (شکل1).


 

شکل 1- روش ساده ایجاد گسستگی در ژن هدف. نواحی H1 و H2: بازو های هومولوگ (یکسان) با ژن هدف؛ جایگاههای P1 و :P2 به نقاط شروع کننده (Priming sites) بر روی پلاسمید pKD3  به کار گرفته شده در روش recombineering اشاره می کند (8).


در این تکنیک بر خلاف دیگر تکنیکهای رایج مهندسی ژنتیک نیازمند ساخت سازه های ژنی با بازوهای هومولوگ طویل (بین 500 تا 1000 جفت باز) نمی باشند. در این سیستم، ژنهای سیستم Red دارای نقش ویژه ای در افزایش فرکانس نوترکیبی می باشند که در ادامه به نقش هر یک از آنها  مختصراً اشاره می گردد. یکی از پروتئینهای سیستم Red، پروتئین Exo است. این پروتئین با نقش اگزونوکلئازی 3¢     5¢ خود قادر است تا در انتهای کاست خطی وارد شده به درون باکتری، انتهای چسبنده (sticky) ایجاد کند (7). به دنبال ایجاد ناحیه چسبنده به طول تقریبی بیشتر از 35 نوکلئوتید، پروتئین Beta به عنوان یک SSB (پروتئینهای متصل شونده به DNA تک رشته ای) عمل کرده و نقش میانجی را در جفت شدن  یک رشته با رشته مکمل خود در ژنوم میزبان بازی می کند. پروتئین Gam به آنزیم RecBCD باکتری متصل شده و مانع از بین رفتن DNA خطی دو رشته ای وارد شده به باکتری میزبان می گردد. این آنزیم در مواقعی که باکتری دچار جهشهای طویل می گردد به کمک زیر واحد های خود به انتهای DNA خطی دو رشته ای متصل شده و به کمک سیستم نوترکیبی باکتری این جهش را ترمیم می کند (7-23).

 این سیستم اولین بار برای ایجاد تغییراتی در ژنوم باکتری اشرشیا کلی به کار برده شد اما با توجه به مزایای این سیستم در میزبانهای دیگری نیز مورد استفاده قرار گرفته است، به طور مثال مورنو و همکاران در سال 2006 با استفاده از این روش توانستند در ژن stxAB از باکتری اشرشیا کلی K12 جهش ایجاد نمایند. نتایج این تحقیق نشان داد علی رغم کارآیی و سرعت این روش اما وجود نواحی مرتبط با ژنوم فاژی در کروموزوم اشرشیا کلی باعث ایجاد اختلال در مسیر نوترکیبی می گردد (22). کاوروش و همکاران در سال 2000 توانستند با استفاده از تکنیک نوترکیبی در شرایط in vivo در قارچ رشته ای Aspergillus nidulans با واسطه کاسمید (Cosmid) حامل جهش در ژنtreA قارچی و با استفاده از پلاسمید pKOBEG جهش ایجاد کنند. این تحقیق نشان داد که این تکنیک  روش مناسبی برای ایجاد هم جوشی (fusion) و جایگزینی پروموتور در سویه های قارچی با فرکانس بیشتر از  50 درصد می باشد (6).

با توجه به بیماریزایی و شیوع نسبتاً بالای شیگلوز در کشورهای در حال توسعه و ناموفق بودن روشهای درمان آنتی بیوتیکی، اهمیت پیشرفت روشهای پیشگیرانه مانند واکسیناسیون افراد و به خصوص کودکان در اولویت سازمان بهداشت جهانی (WHO) قرار دارد (1). امروزه یکی از مؤثرترین نوع واکسنهای خوراکی، تهیه سویه های مهاجم تخفیف حدت یافته است، که اثرات بالینی قابل قبولی را دارا می باشند (25). با توجه به اهمیت و نقش ژن virG در  سویه شیگلا دیسانتری تیپ 1، لذا به عنوان ژن هدف در ایجاد گسستگی (حذف) جهت تولید سویه کاندید واکسنی بومی انتخاب گردید. هدف از انجام این تحقیق، توالی یابی ژن virG و همچنین تهیه سویه زنده تخیف حدت یافته  بر پایه حذف ژن virG با استفاده از روش λ Red recombinase در سویه شیگلا دیسانتری تیپ 1 جدا شده از نمونه های بیمارستانهای میلاد و مفید تهران بود.

مواد و روشها

باکتری شیگلا دیسانتری تیپ 1 از بیماران مبتلا به اسهال خونی در بیمارستانهای میلاد و مفید تهران جدا شدند. نمونه های تهیه شده، با استفاده از سوآپ های استریل در محیط سالمونلا – شیگلا آگار، در دمای 37 درجه سانتی گراد کشت و به مدت 16 ساعت انکوبه شدند. سپس نمونه ها توسط آزمونهای بیوشیمیایی اورنیتین دکربوکسیلاز، هکتوئن، زایلوز لایزین دکربوکسیلاز (XLD)، مک کانکی، TSI، ONPG، آزمون تخمیر قند آرابینوز و تولید اندول شناسایی و پس از کشت در محیط LB مایع و افزودن گلیسرول (غلظت نهایی20 درصد) در دمای 80- درجه سانتی گراد ذخیره شدند.

واکنش آنتی سرمی: سویه های شیگلا جدا شده از بیماران پس از انجام آزمایشات بیوشیمیایی، همچنین با استفاده از کیت تشخیصی پلی کلونال گونه های شیگلا (شرکت Mast، انگلستان)، تأیید شد. برای این منظور ابتدا سویه های شیگلا بر روی محیط مک کانکی آگار کشت داده شدند و سپس آزمایشات شناسایی گونه با استفاده از روش آگلوتیناسیون بر روی شیشه اجرا گردید (29). 

طراحی آغازگر: به منظور شناسایی سرووار شیگلا جدا شده یک جفت آغازگر اختصاصی برای تشخیص حضور ژن زیر واحد  Aشیگا توکسین (stxA) با توجه به اطلاعات موجود در بانک ژنی (شماره دسترسی NC_007606) طراحی و سنتز گردید (سینا کلون، ایران). توالی آغازگر های بالادست و پایین دست تشخیص ژن زیر واحد A شیگا توکسین عبارت بودند از:

STXF: 5¢ GGGATAGATCCAGAGGAAGG 3¢

STXR: 5¢CCGGACACATAGAAGGAAACTC 3¢

 آغازگر های بالادست و پایین دست ژن virG بدون جایگاه برش آنزیمی به منظور همسانه سازی ژن virG در حامل pGEM-7zf با توجه به اطلاعات موجود در بانک ژنی (شماره دسترسی CP000035) طراحی و سنتز گردید (سیناکلون، ایران). توالی آغازگر های بالادست و پایین دست عبارت بودند از :

VRGF: 5¢GGGTTTATCAACCACTTACTG 3¢

VRGR: 5¢ GAAATGCAGGACATCAACAC 3¢

پس از طراحی و انتخاب آغازگر های فوق، خصوصیات ترمودینامیکی و مولکولی آغازگر ها به وسیله نرم افزار مربوطه (CLC sequence viewer version 6) مورد ارزیابی قرار گرفت (13). برای این منظور ابتدا توالی کامل ژنهای stxA و virG در نرم افزار وارد گردید و سپس نسبت به انتخاب و طراحی آغازگرهای مناسب اقدام شد.

آماده سازیDNA باکتری: پس از شناسایی اولیه سویه شیگلا دیسانتری نسبت به کشت آن در محیط LB مایع اقدام گردید و نمونه به مدت 18 ساعت در گرم خانه شیکر دار با سرعت 200 دور در دقیقه در دمای 37 درجه سانتی گراد انکوبه شد. ژنوم باکتری با استفاده از کیت تخلیص ژنومی AccuPrep (کره جنوبی، BioNEER) با توجه به دستورالعمل شرکت سازنده استخراج گردید و با انجام واکنش PCR وجود ژن زیر واحد A شیگا توکسین و نیز ژنvirG مورد تأیید قرار گرفت.

تکثیر ژن زیر واحد A شیگا توکسین باکتری شیگلا: DNA به دست آمده از مرحله قبل، به کمک واکنش PCR و آغازگر های اختصاصی سرووار شیگلا دیسانتری تیپ 1 تکثیر شد. واکنش PCR به منظور تکثیر DNA در حجم 50 میکرولیتر انجام گرفت. هر واکنش شامل 4/0 میکرومول از هر آغازگر، 2/0 میلی مولار از مخلوط نوکلئوتید های dATP، dCTP، dGTP، dTTP و 5/2 واحد از آنزیم DNAپلی مراز Pfu، 5 میکرولیتر از بافر x10،MgCl2 با غلظت نهایی 5/2 میلی مولار و 50 نانوگرم از DNA تهیه شده، بود. چرخه های PCR شامل مرحله واسرشت شدن ابتدایی در دمای 94 درجه سانتی گراد به مدت 1 دقیقه و دوره سه مرحله ای شامل واسرشت شدن ابتدایی در دمای 94 درجه سانتی گراد به مدت 45 ثانیه، اتصال آغازگرها به رشته الگو در دمای 58 درجه سانتی گراد به مدت 30 ثانیه، طویل سازی قطعه مورد نظر در 72 درجه سانتی گراد به مدت 2 دقیقه و در پایان، مرحله تکثیر نهایی در دمای 72 درجه سانتی گراد به مدت 7 دقیقه بود. محصول PCR پس از الکتروفورز بر روی ژل آگاروز 1 درصد و رنگ آمیزی در اتیدیوم بروماید (با غلظت نهایی 25 میکروگرم در هر میلی لیتر) مورد تأیید قرار گرفت.

تکثیر ژن virG و آماده سازی محصول PCR: به منظور همسانه سازی ژن virG در حامل pGEM-7zf  (Ins T⁄A clone PCR Product Cloning Kit; Promega) دستور العمل  PCRمطابق مرحله قبل، اجرا گردید با این تفاوت که مدت زمان طویل سازی 6 دقیقه و 45 ثانیه و دمای اتصال آغازگر ها 55 درجه سانتی گراد انتخاب شد. به منظور آماده سازی محصول PCR، DNA تکثیر شده با استفاده از کیت High Pure PCR ProductPurification Kit ,Roche)، آلمان) خالص سازی و جهت همسانه سازی برای الحاق آماده گردید.

آماده سازی حامل pGEM-7zf: هضم آنزیمی حامل pGEM-7zf با استفاده از آنزیم SmaI (فرمنتاز) در واکنش هضم یک گانه با 5/2 میکرولیتر از بافرx10، 10 میکرولیتر از حامل pGEM-7zf، 2 میکرولیتر از آنزیم محدود کننده به طوری که حجم واکنش به 25 میکرولیتر برسد، تهیه و سپس به مدت 2 ساعت در دمای 37 درجه سانتی گراد قرار داده شد، تا پس از انجام برش، پلاسمید خطی برش خورده با انتهای صاف ایجاد شود.

الحاق: مخلوط محصول PCR و پلاسمید برش خورده به ترتیب با نسبت 3 به 1، تهیه و به مدت 10 دقیقه در 37 درجه سانتی گراد گرمادهی گردید و بلافاصله به ظرف یخ منتقل شد و سپس 2 میکرولیتر از آنزیم لیگاز 4T و 5 میکرولیتر از بافرx10 به آن اضافه و به مدت 16 ساعت در دمای 10 درجه سانتی گراد قرار گرفت. محصول واکنش الحاق توسط کیت (PCR cleanup kit, QIAGEN،آمریکا) به منظور انجام تراریختی استخراج گردید.

تراریختی: پلاسمید های نوترکیب با روش شوک الکتریکی به سلول مستعد E. coli سویه DH5α  منتقل شد. برای این کار ابتدا سلولهای مستعد پذیرنده الکتریکی مطابق روش (سمبروک و همکاران، 1989) تهیه و سپس30 میکرولیتر از سلول مستعد با 5 میکرولیتر از پلاسمید نوترکیب pGEMvirG مخلوط و به مدت 1 دقیقه بر روی یخ قرار داده شدند. مخلوط تهیه شده سپس به درون کووت 2/0 سانتیمتر(BioRad، آمریکا) منتقل و از طریق شوک الکتریکی (0/2 کیلو ولت در میلی ثانیه) به سلولهای مستعد انتقال یافتند و در ادامه بلافاصله به آن محیط  SOCمایع بدون آنتی بیوتیک اضافه و به مدت 60 دقیقه در دمای 37 درجه سانتی گراد کشت داده شدند. باکتریهای رشد کرده با دور 4000 دور در دقیقه سانتریفیوژ و در محیط LB جامد حاوی آنتی بیوتیک آمپی سیلین (100 میکروگرم بر میلی لیتر) به مدت 18 ساعت در دمای 37 درجه سانتی گراد به صورت چمنی کشت داده شدند.

غربالگری: صحت همسانه سازی پرگنه های حاوی قطعه مورد نظر، به کمک PCR و در نهایت با توالی یابی تأیید گردیدند. برای انجام این کار، پلاسمید باکتری با استفاده از کیت AccuPrep (Plasmid Extraction Kit BioNEER، کره جنوبی) استخراج و مطابق روش قبل، واکنش PCR اجرا گردید. پلاسمید های مثبت پس از خالص سازی با استفاده از آغازگر های عمومی M13 حامل و آغازگرهای اختصاصی ژن virG تعیین توالی شدند (شرکت تکاپو زیست، ایران).

بررسی حساسیت و مقاومت سویه شیگلا دیسانتری تیپ 1 بومی ایران: سویه جدا شده از مبتلایان به شیگلوز پس از تعیین سرووار به منظور ارزیابی حساسیت به آنتی بیوتیکهای آمپی سیلین (100 میکروگرم در میلی لیتر) و کلرامفنیکل (5/12میکروگرم در میلی لیتر) بر روی محیطLB جامد حاوی این دو آنتی بیویک به طور جداگانه کشت و در دمای 37 درجه سانتی گراد به مدت 16 ساعت انکوبه گردید.

 

شکل 2- پلاسمید pKD46 داری سه پروتئین Exo ،  Betaو Gam می باشد که تحت پروموتور PBAD قرار گرفته اند و داری origin (مبدا) حساس به دما و نیز ژن مقاومت به آمپی سیلین (bla) نیز به عنوان ژن گزارشگر می باشد (8).

انتقال پلاسمید pKD46 به شیگلا: در این مطالعه از حامل pKD46  (داتسنکو و وانر، 2000) به عنوان سیستم بیان کننده ژنهای Red (Exo،Beta  و Gam) استفاده گردید (شکل 2). این ژنها تحت پروموتور القاپذیر با پروتئین Ara-C همسانه سازی گردیده اند. این حامل از پلاسمید pINT-t حاوی ژن ara-C و پروموتور آن به نام ParaB مشتق شده است، همچنین،. در ساختن حامل فوق (Genbank AY048746) از پلاسمید pBAD18 و نیز DNA لامبدا استفاده گردیده است. این پلاسمید در مرکز (The Coli Genetic Stock Center) دانشگاه Yale آمریکا سنتز و برای اولین بار به کار گرفته شده است.

این پلاسمید از سویه BW25113 (lacIq rrnBT14 ΔlacZWJ16 hsdR514 ΔaraBAΔAH33 ΔrhaBAΔLD78) به عنوان سویه والدی با استفاده از کیت AccuPrep (Plasmid Extraction Kit BioNEER، کره جنوبی) استخراج گردید. سپس سلول مستعد الکتریکی از شیگلا بومی بر اساس دستور العمل (مالوی، 1981) تهیه شد (20). به این منظور 40 میکرولیتر از یاخته مستعد الکتریکی با 1 میکرولیتر از پلاسمید pKD46 در درون کووت مخلوط و سپس دستگاه الکتروپوریتور (BioRad ,USA) مطابق مرحله قبل تنظیم و عمل تراریختی انجام گردید، سپس بلافاصله 1 میلی لیتر از محیط LB مایع به مخلوط اضافه و به مدت 2 ساعت در دمای 30 درجه سانتی گراد در گرمخانه همراه با همزن با سرعت 200 دور در دقیقه قرار داده شد. باکتریهای رشد کرده با سرعت 14000 دور در دقییقه به مدت 1 دقیقه سانتریفیوژ شده و سپس در محیطLB جامد حاوی آنتی بیوتیک آمپی سیلین (100 میکروگرم در میلی لیتر) به مدت 24 ساعت در دمای 30 درجه سانتی گراد کشت داده شد سپس از سویه های رشد کرده حاوی پلاسمید pKD46 به منظور انجام مراحل بعدی استفاده شد. لازم به ذکر است در مورد نمونه شاهد به جای DNA پلاسمیدی، از آب استریل فاقد آنزیم نوکلئاز استفاده گردید. به منظور ارزیابی کارآیی تراریختی انجام شده، از دو مقدار پلاسمید تخلیص شده pKD46 به میزان 1 و 10 نانوگرم در میکرولیتر با شرایط غلظت یکسان (39 نانوگرم در میکرولیتر)، به یاخته مستعد الکتریکی اضافه و عمل تراریختی انجام و سپس به منظور کمی کردن نتایج، محاسبه کارآیی بازده انتقال پلاسمید با استفاده از فرمول (1-1) انجام شد.


 

 

فرمول 1-1

فرمول 1- محاسبه کارآیی تراریختی با استفاده از فرمول فوق انجام گردید. در این فرمول، نمایه # نشاندهنده تعداد کلونیهای رشد کرده در محیط آنتی بیوتیکی (آمپی سیلین) پس از تراریختی می باشد.

 

 

شکل 3- این شکل بخشی از توالی DNA الگو به کار گرفته شده در تکثیر کاست کلرامفنیکل را نمایش می دهد. پیکان ها در واقع جایگاه و جهت گیری نقاط شروع کننده تکثیر کاست ژنی در پلاسمید pKD3 می باشند.P1: نقطه شروع کننده 1، :P2 نقطه شروع کننده 2،C1 و C2: نقطه شروع آغازگر های عمومی به منظور تأیید صحت قرارگیری کاست کلرامفنیکل در جایگاه مورد انتظار در ژنوم میزبان می باشند (8).

 

 


طراحی آغازگر و تکثیر کاست کلرامفنیکل: به منظور تکثیر کاست حامل ژن کلرامفنیکل (cat) آغازگر های طویل forward و revers به ترتیب، با اندازه 66 و 65 نوکلئوتیدی طراحی و انتخاب گردید. بیست و یک نوکلئوتید از جفت آغازگر های طراحی شده با جایگاه شروع ( P1و P2) بر روی پلاسمید pKD3 (Genbank AY048742) یکسان (داتسنکو و وانر، 2000) و مابقی نوکلئوتیدها با نواحی داخلی (46 نوکلئوتید ابتدایی) ژن virG دارای همخوانی کامل بودند. این پلاسمید از سویه BW25993 (lacIq hsdR514 ΔaraBAΔAH33 ΔrhaBAΔLD78) مطابق مرحله قبل استخراج گردید (شکل 3).

واکنش PCR به منظور تکثیر DNA در حجم 100 میکرولیتر انجام گرفت. هر واکنش شامل 10 میکرولیتر از هر آغازگر (غلظت جفت آغازگرها 10 میلی مولار)، 1 میکرولیتر (40 میلی مولار) از مخلوط نوکلئوتید های dATP، dCTP، dGTP و dTTP، 1 میکرولیتر از آنزیم DNA پلی مراز HF(High Fidelity PCR Mix، فرمنتاز)، 10 میکرولیتر از بافر 10x(MgCl2 به همراه بافر بود)، 1 میکرولیتر از  DNAپلاسمیدی pKD3  (با غلظت 89 میکروگرم در هر میلی لیتر) بود. چرخه های PCR شامل مرحله واسرشت شدن ابتدایی در دمای 94 درجه سانتی گراد به مدت 3 دقیقه و 30 دوره سه مرحله ای شامل واسرشت شدن ابتدایی در دمای 94 درجه سانتی گراد به مدت 30 ثانیه، اتصال آغازگر به رشته الگو در دمای 56 درجه سانتی گراد به مدت 35 ثانیه، طویل سازی قطعه مورد نظر در 72 درجه سانتی گراد به مدت 1 دقیقه و 30 ثانیه و در پایان، مرحله طویل سازی نهایی در دمای 72 درجه سانتی گراد به مدت 10 دقیقه بود. محصول PCR پس از الکتروفورز بر روی ژل آگارز 1 درصد  در مقایسه با مارکر مولکولی مورد تأیید قرار گرفت و سپس با استفاده از کیت (Gel Purification kit ,QIAGEN، آمریکا) خالص سازی گردید. آغازگر های طراحی شده به منظور تکثیر کاست آنتی بیوتیکی کلرامفنیکل عبارت بودند از :

VRGHF:5´ATGAATCAAATTCACAAATTTTTTTGTAATATGACCCAATGTTCAGTGTA

GGCTGGAGCTGCTTCG3´

VRGHR:5´TCAGAAGGTATATTTCACACCCAAAATACCTTGGGTGTCTCTGTCATAT

GAATATCCTCCTTAGT 3´

تراریختی و غربالگری: باکتری شیگلا حامل پلاسمید pKD46 در 50 میلی لیتر از محیط SOB واجد آنتی بیوتیک آمپی سیلین (با غلظت نهایی 100 میکرولیتر در میلی لیتر) و L- آرابینور (با غلظت نهایی 10 میلی مولار) مخلوط گردید و در دمای 30 درجه سانتی گراد گرمادهی شد، پس از رسیدن تراکم سلولی به OD (چگالی نوری) 6/0 در فرکانس 600 نانومتر، مطابق دستورالعمل مرحله قبل، یاخته مستعد الکتریکی تهیه و 100 میکرولیتر از آن با 10 میکرولیتر از کاست آنتی بیویتیکی کلرامفنیکل در کووت مخلوط و مطابق با مرحله قبل شوک الکتریکی انجام گردید. پس از شوک الکتریکی به میزان 1 میلی لیتر از محیط LB مایع بدون آنتی بیوتیک به مخلوط اضافه و در گرمخانه به مدت 4 ساعت در دمای 37 درجه سانتی گراد همراه همزن با سرعت 200 دور در دقیقه گرمادهی گردید و سپس 50 میکرولیتر از باکتری الکتروترانسفورم شده به محیط حاوی آنتی بیوتیک کلرامفنیکل (5/12 میکرولیتر در میلی لیتر) منتقل شد و به مدت 34 ساعت در دمای 30 درجه سانتی گراد انکوبه گردید. غربالگری با واکنش PCR انجام شد. در مورد نمونه شاهد نیز مطابق مرحله قبل اجرا گردید (8).

 تأیید انجام نوترکیبی هومولوگ: به منظور تأیید انجام نوترکیبی آغازگر های خارجی در محدوده 300 نوکلئوتید در بالادست و پایین دست ژن virG بدون جایگاه برش آنزیمی و با توجه به اطلاعات موجود در بانک ژنی طراحی و سنتز شد (سینا کلون، ایران). توالی آغازگر های خارجی بالادست و پایین دست ژنvirG عبارت بودند از:

EVRGF: 5¢ GTAAAACGACGGCCAGT 3¢

EVRGR: 5¢ GCATTAGTTTCTGCAATACC 3¢

واکنش PCR مطابق دستور العمل ارائه شده جهت تکثیر ژن virG اجرا گردید با این تفاوت که از پرگنه باکتری به عنوان الگو و دمای اتصال آغازگر ها 59 درجه سانتی گراد انتخاب شد و سپس محصول PCRبر روی ژل آگارز 1 درصد الکتروفورز و صحت انجام نوترکیبی مورد تأیید قرار گرفت.

حذف کاست آنتی بیوتیکی کلرامفنیکل توسط پلاسمید pCP20: پلاسمید pCP20 (کرپانوف و واکرناجل، 1995) مطابق مراحل قبل از سویه میزبان آن (BT340) استخراج و طبق روش مرحله  قبل به سویه حامل کاست کلرامفنیکل (دارای توالیهای FRT در هر دو طرف) الکتروترانسفورم گردید. پلاسمید فوق دارای ژنهای آمپی سیلین و  کلرامفنیکل به عنوان ژنهای گزارشگر (reporter gene) می باشد. به علاوه، این پلاسمید نیز مانند پلاسمید pKD46 ، دارای منشاء همانند سازی وابسته به دما (temperature sensitive) بوده به طوری که در این پلاسمید آنزیم FLP مخمری تحت پروموتور λPR  فاژ لامبدا قرار گرفته و تحت کنترل رپرسور λcI857  می باشد. در این مرحله به منظور القای بیان پروتئین FLP در سویه شیگلا بومی جهش یافته (virGΔ)، شوک گرمایی از 30 به 42 درجه سانتی گراد انجام گردید. سپس به منظور غربالگری و تأیید حذف کاست آنتی بیوتیکی کلرامفنیکل واکنش PCR با آغازگر های خارجی انجام و محصول PCR توالی یابی شد (شرکت تکاپوزست، ایران). دستور PCR طبق روش انجام شده به منظور تکثیر ژن virG بود با این تفاوت که دمای اتصال آغازگر ها 53 درجه سانتی گراد انتخاب گردید (8).

 

شکل 4- الکتروفورز محصول PCR تکثیر ژن زیر واحد A شیگا توکسین روی ژل آگاروز 1%. 1) نشانگر وزن مولکولیbp DNA 100(کره جنوبی، BioNEER)، 2) محصول PCR ژن زیر واحد A شیگا توکسین در باکتری شماره 1 (قطعه bp 622)، 3) محصول PCR ژن زیر واحد A شیگا توکسین در باکتری شماره 2 (قطعه bp 622))،4) محصول PCR ژن زیر واحد A شیگا توکسین در باکتری شماره 3 (قطعه bp 622)، 5) محصول PCR سویهشیگلا فلکسنریb2 (12022ATCC) به عنوان کنترل منفی.

نتایج

 به منظور شناسایی و تعیین گونه و سرووار باکتریهای شیگلا از واکنشهای بیوشیمیایی، آنتی سرمی و PCR استفاده شد. نتایج واکنشهای بیوشیمیایی و آنتی سرمی حضور گونه شیگلا دیسانتری را در نمونه های دریافتی از بیمارستانهای میلاد و مفید تهران تأیید نمود. به منظور تعیین سرووار گونه های شیگلا، ژن زیر واحد A شیگا توکسین (مختص شیگلا دیسانتری تیپ 1) با انجام روش PCR و الکتروفورز بر روی ژل آگاروز 1 درصد تأیید گردید (شکل 4، ستونهای 2، 3 و 4).

 در ابتدا به منظور اطمینان از صحت حضور کامل ژن virG در سویه بومی، اقدام به طراحی آغازگرهای اختصاصی  (VRGF و VRGR)  گردید. آغازگر ها به گونه ای طراحی گردیدند که حداقل تمام طول ژن از طریق واکنش PCR تکثیر گردد. محصول واکنش PCR ژن virG، پس از الکتروفورز و رنگ آمیزی بر روی ژل آگاروز 1 درصد مورد بررسی قرار گرفت. همانطور که انتظار می رفت، قطعه 3379 جفت بازی بر روی ژل مشاهده گردید که از لحاظ اندازه با ژن هدف ما (virG) همخوانی کامل داشت (شکل نشان داده نشده است).

با توجه به اینکه روش recombineering یک روش قدرتمند، کارآ و در عین حال دقیق می باشد، بنابراین، در ابتدا نسبت به آگاهی دقیق از توالی ژن virG در سویه بومی اقدام شد، زیرا طراحی آغازگرهای حامل مناطق مشابه با ژن virG (VRGHF و VRGHR) که در این روش استفاده می شود با اطلاع کامل و دقیق از توالی ژن هدف امکان پذیر است. از این رو، همسانه سازی ژن virG در حامل pGEM-7zf انجام شد. در ابتدای این مرحله،  جهت خطی نمودن حامل  pGEM-7zfبه منظور الحاق ژن virG، از واکنش هضم آنزیمی توسط آنزیم محدودکننده SmaI استفاده گردید، در اثر برش آنزیمی حامل  pGEM-7zf قطعه 2997 جفت بازی با انتهای صاف (Blunt ends) به دست آمد (شکل 5، ستون 3). پس از الحاق ژن virG در حامل pGEM-7zf، اندازه قطعه مشاهده شده بر روی ژل آگاروز 1 درصد مطابق انتظار بود (شکل 5 ستون 2، قطعه  bp6376). برای تأیید همسانه سازی، واکنش PCR انجام و محصول PCR  بر روی ژل آگاروز 1 درصد مورد بررسی قرار گرفت. تشکیل قطعه 3379 جفت بازی صحت همسانه سازی ساختار pGEMvirG را نشان داد.

 

شکل 5- الکتروفورز الحاق ژن virG و هضم آنزیمی حامل pGEM-7zf بر روی ژل آگاروز 1 درصد .1) نشانگر وزن مولکولیKb DNA1 (آلمان، فرمنتاز)، 2) محصول واکنش الحاق ژن virG به حامل pGEM-7zf، 3) برش آنزیمی حامل pGEM-7zf با استفاده از آنزیم محدود کننده SmaI، قطعه bp 2297 نشان دهنده خطی شدن حامل پیش از انجام واکنش الحاق می باشد.

به منظور تأیید بیشتر همسانه pGEMvirG  توالی یابی ژن virG با آغازگر های عمومی13M حامل (pGEM-7zf) انجام گردید. نتایج تعیین توالی قطعه تکثیر یافته، هم خوانی کامل (100 درصد) با توالی ژن virG استاندارد (شماره دسترسی CP000035) تهیه شده از پایگاه داده های ژنومی (NCBI) را نشان داد و صحت حضور کامل توالی ژن virG را در سویه تراریخت شده تأیید نمود.

با توجه به اینکه در تکنیک recombineering از پلاسمید های متعددی شامل pKD46 (مقاوم به آنتی بیوتیک آمپی سیلین)، pKD3 (حامل ژن مقاوم به آنتی بیوتیک کلرامفنیکل) و pCP20 (مقاوم به آنتی بیوتیکهای آمپی سیلین و کلرامفنیکل) استفاده می گردد، بنابراین ضروری است حساسیت آنتی بیوتیکی سویه بومی مشخص گردد. در مرحله ارزیابی حساسیت آنتی بیوتیکی، نتایج عدم مقاومت سویه بومی را نسبت به غلظتهای انتخاب شده از آنتی بیوتیکهای آمپی سیلین (با غلظت 100 میکروگرم در میلی لیتر) و کلرامفنیکل (با غلظت 5/12 میکروگرم در میلی لیتر) در مقایسه با سویه شاهد (شیگلا دیسانتری مقاوم به آمپی سیلین و کلرامفنیکل، تهیه شده از بانک میکروبی دانشکده دامپزشکی دانشگاه تهران) که پیش تر حساسیت و یا عدم حساسیت آنها مورد تأیید قرار گرفته بود را نشان داد.

با توجه به اینکه حضور پلاسمید pKD46 با هدف افزایش فرکانس نوترکیبی در باکتری کاندید حذف ژنی،  ضروری می باشد و از طرف دیگر این پلاسمید در خانواده پلاسمید های با تعداد رونوشت پایین (Low copy number) قرار می گیرد، بنابراین لازم است تا کارآیی انتقال این پلاسمید در شیگلا بومی مورد بررسی قرار گیرد،  لذا با استفاده از فرمول 1-1 کارآیی ورود این پلاسمید با توجه به غلظت DNA پلاسمیدی بر حسب میکروگرم بر میلی لیتر مورد ارزیابی قرار گرفت. نتایج محاسبات حاصل از تراریختی پلاسمید pKD46 به باکتری شیگلا بومی، نشان داد که با افزایش مقدار پلاسمید از 1 به 10 میکرولیتر (در غلظت یکسان)، کارآیی تراریختی به میزان تقریباً 10 برابر افزایش می کند. این نسبت در واقع نشان می دهد که با افزایش 10 برابری مقدار پلاسمید، تعداد سویه های مقاوم بر روی محیط انتخابی (حاوی آمپی سیلین) نیز به همین میزان افزایش را از خود نشان می دهند.

پس از اطمینان از حضور پلاسمید pKD46 در سویه شیگلا بومی، با استفاده از آغازگر های طراحی شده  (VRGHF و VRGHR) ویژه حذف ژن virG، واکنش تکثیر کاست کلرامفنیکل با واکنش PCR با استفاده از پلاسید pKD3 به عنوان الگو صورت گرفت. پس از تکثیر کاست کلرامفنیکل (ناحیه شروع کننده 1P + 46 نوکلئوتید آغازی ژن virG + توالی FRT +  ژن مقاوم به کلرامفنیکل (cat)+ توالی FRT + ناحیه شروع کننده 2P + 45 نوکلئوتید انتهایی ژن virG ) (شکل 6) و انتقال آن به سویه شیگلا بومی حامل پلاسمید pKD46 ، عمل غربالگری بر روی محیط حاوی کلرامفنیکل (غلظت 5/12 میکروگرم در میلی لیتر) انجام گردید.

 

 

شکل 6- الکتروفورز محصول PCR کاست کلرامفنیکل. 1) نشانگر وزن مولکولیKb DNA 1 (آلمان، فرمنتاز)، 2 الی5) تشکیل قطعه 1103 جفت بازی، تکثیر کاست آنتی بیوتیکی کلرامفنیکل را با استفاده از پلاسمید pKD3 را نشان می دهد.

پس از انجام تراریختی کاست کلرامفنیکل در سویه حامل pKD46 و نیز القای بیرونی این پلاسمید توسط قند ال – آرابینوز (L-Arabinose) انتظار می رود که پدیده نوترکیبی بین ژن virG و کاست کلرامفنیکل صورت گیرد. رشد سویه های مقاوم به آنتی بیوتیک کلرامفنیکل در فاز ابتدایی، صحت قرار گیری کاست کلرامفنیکل در ژنوم شیگلا را به صورت فنوتیپی تأیید می نماید. اما با توجه به اینکه در تکنیک recombineering  از مناطق با هومولوژی پایین (بین 30 تا 50 نوکلئوتید) استفاده می گردد، بنابراین احتمال قرار گیری نا به جا (غیر از جایگاه مورد انتظار) کاست کلرامفنیکل وجود دارد. لذا به منظور اطمینان از صحت انجام نوترکیبی صحیح، واکنش PCR با استفاده از آغازگر های خارجی (External) نسبت به کاست کلرامفنیکل انجام گردید. این آغازگرها به گونه ای طراحی شدند که مناطق بالادست و پایین دست ژن هدف (virG) را تکثیر می نمایند. در صورت صحت وقوع رخداد نوترکیبی و حذف ژن virG، تکثیر قطعه DNA شامل مجموع نواحی بالادستی ژن virG (250 جفت باز)، کاست کلرامفنیکل (1103 جفت باز)، نواحی پایین دستی ژن virG (247 جفت باز) می باشد، با اندازه برابر با 1600 جفت باز را نشان می دهد. با توجه به محاسبات فوق، حضور قطعه 1600 جفت بازی در شکل 7 صحت وقوع نوترکیبی بین ژن virG با کاست آنتی بیوتیکی کلرامفنیکل را  تأیید نمود (ستونهای 2 و 3). در انتهای این مرحله با توجه به افزایش دما به بالاتر از 30 درجه، پلاسمید pKD46 از سویه شیگلا بومی حذف گردید. کشت سویه تخیف حدت یافته virGΔ در محیط حاوی آمپی سیلین و عدم رشد بر روی این محیط صحت ادعای فوق را تأیید نمود (شکل نشان داده نشده است).

 

شکل 7- الکتروفورز محصول PCR سویه جهش یافته شیگلا با استفاده از آغازگر های خارجی. 1) نشانگر وزن مولکولیKb DNA 1(آلمان، فرمنتاز)، 2 و 3) وجود قطعه1600جفت بازی وقوع رخداد نوترکیبی در سویه شیگلا را تأیید می کند.4) نمونه کنترل منفی، از آب دیونیزه به عنوان DNA الگو، در واکنش PCR استفاده شده است.

در مرحله پایانی، با توجه به اینکه حضور ژن مقاوم آنتی بیوتیکی به عنوان یک عامل تهدید کننده در انتشار و گسترش ژنهای مقاوم مطرح می باشد بنابراین، در این مرحله نسبت به حذف این ژن با استفاده از پلاسمید pCP20  اقدام گردید. انجام شوک گرمایی (دمای بالاتر از 40 درجه  سانتی گراد) سبب می شود تا رپرسور λ cI857از فرم طبیعی خود خارج گردد و باعث بیان آنزیم FLP ریکامبیناز در سویه شیگلای حامل جهش در ژن virG (virG::catΔ) گردد. این آنزیم سبب حذف کاست کلرامفنیکل از طریق نوترکیبی بین توالیهای FRT می گردد. همان طور که در شکل 8 مشاهده می شود، قطعه 670 جفت بازی نمایانگر حذف کاست کلرامفنیکل در شیگلا حامل جهش در ژن virG  (ΔvirG) از طریق انجام نوترکیی بین توالیهای FRT می باشد (ستونهای 4، 5) به علاوه، محصول PCR سویه وحشی شیگلا، قبل و پس از انجام نوترکیبی با استفاده از آغازگر های خارجی ژن virG، به ترتیب در ستونهای 2 و 3 نشان داده شده است (شکل 8).

 

شکل 8- الکتروفورز محصول PCR سویه شیگلا دیسانتری بومی با استفاده از آغازگر های خارجی. 1) نشانگر وزن مولکولیKb DNA 1(آلمان، فرمنتاز)، 2) محصول PCR تشخیص ژن virG، قبل از ایجاد جهش در باکتری شیگلا ( bp3806)، 3) محصول PCR ژن virGپس از انجام نوترکیبی4و 5) محصول PCR پس از حذف کاست آنتی بیوتیکی کلرامفنیکل توسط پروتئین FLP حاصل از پلاسمید pCP20 (قطعهbp  670)، 6) نشانگر با وزن مولکولیbp  100DNA (آلمان، فرمنتاز).

به منظور تأیید بیشتر حذف ژن virG در سویه بومی، محصول PCR حاصل از مرحله آخر (قطعه 670 جفت بازی)،  تعیین توالی و با نرم افزار (Chromas version 2.33) مورد بازخوانی قرار گرفت. نتایج حاصل از بازخوانی ناحیه توالی یابی شده و مقایسه آن با ژن virG پیش از وقوع رخداد جهش نشان داد که تعداد 3220 جفت باز از ژن virG در سویه بیمارستانی شیگلا دیسانتری تیپ 1 حذف گردیده است.

بحث

تا کنون تلاشهای بسیار زیادی جهت تولید یک واکسن ایمن ومؤثر برعلیه عامل بیماری اسهال خونی در جهان صورت گرفته است. ولی هیچ کدام از آنها به دلایلی مانند: ایمن نبودن در کودکان، عدم تحریک مناسب ایمنی مخاطی، پیچیده بودن روند تولید واکسن و گران بودن مجوز استفاده در حجم وسیع و عمومی را دریافت نکرده اند و گاهی مصرف آنها به یک کشور خاص و در گروه سنی خاصی محدود شده است. یکی از مهم ترین راهکارهای تولید واکسن علیه شیگلوز تولید واکسنهای زنده مهاجم و تخفیف حدت یافته می باشد زیرا این واکسنها علاوه بر داشتن مصرف خوراکی، توانایی بالایی را در تحریک سیستم ایمنی مخاطی و فعال کردن شدید سیستم ایمنی دارا هستند (9 و 14). میترتو همکاران در سال 1984 سویه جهش یافته T32-ISTRATI را با استفاده از تکنیک پاساژ متوالی در شیگلا فلکسنری 2a ایجاد نمودند. این کاندید واکسنی پس از 32 مرتبه کشت متوالی در محیط  نوترینت آگار جداسازی و از نظر ایجاد ورم ملتحمه در چشم خوکچه هندی (تست Sereny) منفی گزارش گردید (21). ونکاتسن و همکاران در سال 1990 سویه کاندید واکسنی T32-ISTRATI را از لحاظ فنوتیپی و ژنوتیپی ارزیابی نمودند. ارزیابی ها حذف سه لکوس virG، invA وIpaABCD رادر پلاسمید تهاجمی شیگلا نشان داد. همچنین کاندید واکسنی شیگلا فلکسنری 2a وابسته به استرپتومایسین (SmD) نیز با روشی مشابه که در ساخت T32-ISTRATI به کار رفت، در سال 1972 ایجاد شد. تکنیک پاساژ متوالی معایبی همچون عدم اختصاصیت، برگشت پذیری به نوع وحشی و ناپایداری ژنتیکی را دارد، بنابراین به منظور ایجاد جهش اختصاصی و هدفمند در باکتری مناسب نمی باشد (19، 27 و 33).

امروزه با پیشرفت روشهای مهندسی ژنتیک تکنیکهای مختلفی به منظور ایجاد جهش و گسستگی در ژنها استفاده می گردد که بیشترین آنها بر پایه غیر فعال کردن ژنها از طریق دخول کاست ژنی و یا حذف ژن قرار گرفته است (2 و 11). یکی از مهم ترین روشها، استفاده از پلاسمیدهای انتحاری می باشد. یوشیکاوا و همکاران در سال 1995 با ایجاد دو جهش در ژنهای virG و thyA توانستند سویه تخفیف حدت یافته شیگلا فلکسنری 2a را با استفاده از ترانسپوزون Tn10 و فاژP1 ایجاد کنند. عدم ایجاد التهاب و حفاظت در برابر شیگلا از نتایج آن در مدل حیوانی خوکچه هندی بود (36).

 سویه کاندید واکسنی  CVD1203(ΔvirG، ΔaroA) توسط نورجیا و همکاران در سال 1994 با استفاده از پلاسمید های انتحاری pFJ201، pKTN701 ساخته شد (24). نتایج بالینی این سویه واکسنی در خوکچه هندی و انسان در دُز متوسط (در حدود 106 CFU) نشان از تحمل پذیری بالای آن داشت اما در دُز های بالاتر(در حدود 108 - 109CFU) بخشی از دریافت کنندگان به سویه واکسنی واکنش منفی نشان دادند (15، 24). بنابراین ایجاد تخفیف حدت بیشتر از طریق غیر فعال نمودن مسیر های بیوسنتزی، متابولیکی و نیز توکسینی مورد توجه قرار گرفت. همچنین علاوه بر(virG, ΔaroAΔ)CVD1203 ، (guaBAΔ) CVD1204، (virG, ΔguaBAΔ) CVD1205،  (Δset, Δsen, ΔguaBA, ΔvirG) CVD1207  و CVD1208 (setΔΔsen, ΔguaBA, )، بر پایه استفاده از پلاسمید های انتحاری و پدیده تبادل آللی طراحی و ساخته شد. نتایج بالینی سویه های تولید شده نشان دادند که حذف و غیر فعال نمودن این ژنها تحمل پذیری و ایمنی زایی بالایی را در انسان سبب می گردد (12، 14، 15 و 26). ونکاتسن و همکاران در سال 2002 با ایجاد جهش در دو ژن virGو stxA سویه کاندید واکسنی WRSd1را ایجاد نمودند. در این تحقیق از پلاسمید انتحاری pCVD442 و محیط حاوی کلرات پتاسیم به منظور حذف ژنهای virG و stx استفاده گردید (34). سدورژ و همکاران در سال 2008 سویه کاندید واکسنیSC599، را از سویه شیگلا دیسانتری تیپ 1 حامل جهش حذفی در ژنهای virG، entF (ژن مسئول بیوسنتز انتروکلین)، fepA (گیرنده دریافت کننده انتروکلین) و fes (مسئول رها سازی Fe3+ از انتروکلین) وstx ساختند. در این تحقیق از پلاسمید انتحاری pJM703/1 و کاست بیانی npt1-sacB-sacR استفاده شد. نتایج بالینی این سویه در داوطلبان انسانی ایمنی محافظتی مناسبی را از خود نشان داد (26). به کارگیری پلاسمید های انتحاری به منظور حذف ژن در باکتریها معایبی را دارا می باشند که از آن جمله می توان به مواردی مانند استفاده از پلاسمید های متعدد، هزینه بالا و زمان زیاد، تکثیر قطعات مشابه با طول بالا و نیز احتمال از بین نرفتن پلاسمید انتحاری در میزبان مورد نظر اشاره کرد.

 تکنیکی که در تحقیق حاضر از آن استفاده گردید تکنیک حذف ژن با استفاده از سیستم نوترکیبی فاژی یا recombineering بود. مزایای این روش نسبت به سایر روشها شامل سادگی روش، هزینه پایین، افزایش فرکانس نوترکیبی، انتخاب مناطق مشابه (هومولوژی) کوتاه تر و مهم تر از دیگر موارد، زمان کمتر می باشد. این تکنیک برای اولین بار توسط داتسنکو و وانر در سال 2000 ابداع گردید اما سپس در سویه های دیگری شامل سالمونلا، یرسینیا و سراشیا گسترش پیدا نمود (22 و 27). نتایج به کار گیری این روش در دیگر سویه ها نشان داد که یکی از فاکتور های تأثیر گذار در کاربرد این تکنیک در میزبانهای متفاوت می تواند به اثر تخریبی بیان فاژ های لامبدا در آنها برگردد. همچنین در این تحقیقات نشان داده شد که افزایش طول کاست آنتی بیوتیکی میزان فرکانس نوترکیبی را افزایش می دهد (7-8، 23، 37). در سال 2006 توسط رنلوو همکاران سویه های جهش یافته ای در ژنهای virG، asd،set1A،sen،msbB2، msbB1، uhP T و ipa  H9/8 در شیگلا فلکسنری2a (WRSf2)، ژنهای virGو stxAB در شیگلا دیسانتری تیپ1 (WRSd1) و ژنهای virG، sen و ipaB در شیگلا سونه ای (WRSs) ایجاد گردیدند. تکنیک به کار گرفته شده به منظور ایجاد این سویه ها روش recombineering بود. نتایج این تحقیق کارآیی این تکنیک را در باکتری شیگلا نشان داد (25).

 با توجه به نتایج بالینی سویه های واکسنی تولید شده به نظر می رسد ژن virG یک انتخاب مهم باشد چرا که حذف این ژن تهاجم به سلولهای هلا را تحت تأثیر قرار نمی دهد اما گسترش بین سلولی باکتری شیگلا را به شدت کاهش می دهد. در تحقیق حاضر با توجه به نقش اساسی ژن virG در آلودگی بدن میزبان به عنوان اولین ژن هدف در تولید سویه کاندید واکسنی شیگلا دیسانتری تیپ 1 انتخاب گردید. در این مطالعه از پلاسمید pKD46 و دستورالعمل داتسنکو و وانر در سال 2000 به منظور تراریختی استفاده گردید. پلاسمید pKD46 پلاسمیدی با توانایی تکثیر پایین می باشد که توانایی تنظیم بیان دقیق ژنهای لامبدا (Exo, Beta, Gam) را می دهد که در مقایسه با پلاسمید pKM208 به کار گرفته شده توسط رانلو و همکاران اندازه کوچکتری (Kb4/6) دارد و نیز القا پذیری آن از طریق L- آرابینوز می باشد. در این تحقیق آغازگر های با طول به ترتیب 66 و 65 جفت بازی (منطقه هومولوگ  با ژن virG به ترتیب شامل 46 و 45 جفت باز ) طراحی و استفاده شد. یاماموتو و همکاران در سال 2009 توانستند با بهره گیری از این تکنیک در ژنوم ویبریوکلرا ایجاد تغییر نمایند. در این مطالعه طول مناطق هومولوگ استفاده شده به ترتییب از 50 ، 100 تا 1000 نوکلئوتید انتخاب شد. نتایج مطالعه یاماموتو و همکاران نشان داد که با افزایش طول منطقه هومولوگ با ژن هدف، فرکانس نوترکیبی نیز به طور چشمگیری افزایش پیدا می کند.، به طور مثال با افزایش طول ناحیه هومولوگ از 50 به 1000 نوکلئوتید تعداد سویه های جهش یافته به نسبت تقریبی 2/3 برابر افزایش را نشان دادند (35).

یکی از مشکلات تکنیک recombineering، غربالگری سویه جهش یافته پس از حذف کاست آنتی بیوتیکی با واسطه آنزیم FLP بود، به طوری که به منظور شناسایی سویه جهش یافته صحیح بین 10 تا 20 سویه مورد ارزیابی و آنالیز با واکنش PCR قرار گرفت. یکی از دلایل کاهش کارآیی نوترکیبی احتمالاً می تواند به حذف و یا اختلال در جایگاههای FRT قرار گرفته در دو طرف کاست آنتی بیوتیکی، مربوط شود. قرار گیری غیر اختصاصی جایگاههای FRT در ژنوم شیگلا امکان نوترکیبی اشتباه را افزایش می دهد. در نظر است تا در مطالعات بعدی به مطالعه و ارزیابی قدرت تهاجم آن در سلولهای هلا، تجویز خوراکی در حیوان آزمایشگاهی، سنجش پتانسیل در ایجاد ایمنی محافظتی و نیز به عنوان سویه والد در تولید کاندید واکسنی با چندین جهش حذفی اقدام گردد.

نتیجه گیری

سیستم نوترکیبی Red روشی سریع، ارزان، ساده و قدرتمند می باشد که در مقایسه با روشهای پیشین که دارای مهندسیهای گسترده و در عین حال وقت گیر بودند بسیار کارآ و مقرون به صرفه تر می باشند. این تکنیک با توجه به کارآیی بالای آن قادر است در شناسایی ژنهای ناشناخته باکتری با عملکرد نامعلوم، شناسایی فاکتور های مستعد بیماریزایی باکتریایی و نیز در تولید واکسنهای خوراکی دارای چندین جهش به کار گرفته شود.

تشکر و قدردانی: در پایان از مهندس غفاری، اشرافی، خرمالی در آزمایشگاه میکروبیولوژی دانشکده دامپزشکی دانشگاه تهران و مهندس زند در دانشکده علوم پایه دانشگاه جامع امام حسین (ع) و از کارکنان مرکز تحقیقات بیوتکنولوژی کاربردی دانشگاه علوم پزشکی بقیه الله (عج) که در انجام این تحقیق کمک و یاری نموده اند کمال تشکر و قدردانی به عمل می آید.

 

1-     Alexander, W. A. Hartman, A. B. Oaks, E.V. Venkatesan, M. M. (1996). Construction and characterization of virG (icsA)-deleted E.coli K12- S.flexnerri hybrid vaccine strains. Vaccine. 14:1053-1061.

2-     Aleyasin, A. Tahmasebi-Mirgani, M. (2008). Investigation of 844ins67 polymorphism of cystathionine beta synthase in folic acid pathway as a maternal risk factor of Down Syndrom among Iranian mothers. IBJ. 21:877-890.

3-     Banish, L. D. Sims, R. Sack, D. Montali, R. J. Phillips, L. Bush, M. (1993).Prevalence of shigellosis and other enteric pathogens in a zoologic collection of primates. J Am Vet Med Assoc.203:126-132.

4-     Bennish, M.L. (1991).  Potentially lethal complications of shigellosis. Rev Infect Dis. 13: 319–324.

5-     Bernardini, M. L. Mounier, J. d'Hauteville, H. Coquis-Randon, M. Sansonetti, P. J. (1989). Identification of icsA, a plasmid locus of Shigella flexneri that governs bacterial intra- and intercellular spread through intraction with F-actin. Proc Natl Acad Sci USA. 86:3867-3871.

6-     Chaveroche, M. K. Ghigo, J. M. and d’Enfert C. (2000). A rapid method for efficient gene replacement in the Filamentous fungus Aspergillus nidulans. Nucleic Acids Res.28: 97.

7-     Court, D. L.  Sawitzke J. A. Thomason L. C. (2002). Genetic engineering usinghomologous recombination. Annu Rev Genet. 36:361-388.

8-     Datsenko, K. A. Wanner, B. L. (2000). One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. ProcNatl Acad Sci U S A. 97:6640-6645.

9-      Fries, L. F, Montemarano, A. D. Mallet, C. P, Taylorm, D. N. Hale, T. L and Lowell, G. H. (2001). Safety and immunogenicityof a proteosome-Shigella flexneri 2a lipopolysaccharide vaccine administered intranasally to healthy adults. Infect. Immun. 69: 4545–4553.

10-  Girard, M. P. Steele, D. Chaignat,C. L.Kieny, M. P. (2006). A review of vaccine research and development: human enteric infections. Vaccine. 24:2732–2750.

11-  Haddad Mashadizadeh, A.A. Zomorodipour, A. Hosseini, S. J. Sabouni. F. (2008). In silico investigation and synchronous application of introns 1 and 2 of human beta-globin to increase the expression of human coagulation Factor IX. IBJ. 21:918-930.

12-  Hartman, A. B. Venkatesan, M. M. (1998). Construction of a stable attenuated shigella sonnei ∆virG vaccine strain, WRSS1, and protective efficacy and immunogenicity in the guinea pig keratoconjuntivitis model. Infect Immun. 66:4572-4576.

13-  http://www.clcbio.com

14-  Jennison,A.V. Verma, N. K. (2004).  Shigella flexneri infection: pathogenesis and vaccine development. FEMS Microbiol Rev. 28:43-58.

15-  Kotloff, K. L. Pasetti, M. F. Barry, E. M. Nataro, J. P. Wasserman, S. S.Sztein, M. B. and et al. (2004). Deletion in theShigella enterotoxin genes further attenuates Shigella flexneri2a bearing guanine auxotrophy in a phase 1 trial of CVD 1204and CVD 1208. J Infect Dis. 190:1745–1754.

16-  Kotloff,K. L. Winickoff, J. P. Ivanoff, B. Clemens, J. D. Swerdlow, D. L. Sansonetti, P. J.and et al.(1999). Global burden of Shigella infections: implications for vaccine development and implementation of control strategies. Bull. World Health Organ.77: 651–666.

17-  Lan R. Alles, M. C. Donohoe, K. Martinez, M. B. Reeves, P. R. (2004).Molecular evolutionary relationships of entroinvasive Escherichia coli and shigella spp. Infect Immun. 72:5080-5088.

18-  Lesic, B. Rahme,  L. G. (2008). Use of the lambda Red recombinase system to rapidly generate mutants in Pseudomonas aeruginosa. BMC Mol Biol. 9:20.

19-  Lett, M.C. Sasakawa, C. Okada, N. Sakai, T. (1989). virG, a plasmid-coded virulence gene of Shigella flexneri: identification of the VirG protein and determination of the complete coding sequence. J Bacteriol. 171:353-359.

20-  Maloy, S.R. and Nunn, W.D. 1981. Selection for loss of tetracycline resistance by Escherichia coli. J. Bacteriol. 145:1110-1111.

21-  Meitert, T. Pencu, E. Ciudin, L. and Tonciu, M. (1984). Vaccine strain Sh. flexneri T32-ISTRATI. Studies in animals and volunteers. Antidysentery immunoprophylaxis and immunotherapy by live vaccine VADIZEN (Sh. flexneri T32-ISTRATI). Arch. Roum. Pathol. Exp. Microbiol. 43, 251–278.

22-  Moreno, R. S. Acosta, S. Hernalsteens, J. P. and et al. (2006). Use of the lambda Red recombinase system to produce recombinant prophages carrying antibiotic resistance genes. BMC Molecular Biology. 7:1-12.

23-  Murphy, K. C. (1998). Use of bacteriophage λ recombination functions to promote gene replacement in Escherichia coli. J Bacterio. 180:2063-2071.

24-  Noriega, F. R. Wang, J. Y. LosonskY, G. Maneval, D. R. Hone, D. M. and Levin, M. M. (1994). Construction and Characterization of Attenuated AaroA AvirG Shigella flexneri 2a Strain CVD 1203, a Prototype Live Oral Vaccine. Infect. Immun.62:5168-5172.

25-  Ranallo, R. T. Barnoy, S. Thakkar, S. Urick, T. Venkatesan, M. M.(2006). Developing live Shigella vaccines using lambda red recombineering. FEMS Immunol Med Microbiol. 47:462-469.

26-  Sadorge, Ch. Ndiaye, A. Beveridge, N. Frazer, S. Giemza, R. Jolly, N. and et al. (2008). Phase 1 clinical trial of live attenuated Shigella dysenteriae type-1 ΔicsA Δent Δfep ΔstxA:HgR oral vaccine SC599 in healthy human adult volunteers. Vaccine. 26: 978—987.

27-  Serra-Moreno, R. Acosta, S. Hernalsteens, J. P. Jofre, J. and Muniesa, M. (2006).Use of the lambda Red recombinase system to produce recombinant prophages carrying antibiotic resistance genes. BMC Mol Biol.31:1-12.

28-  Suzuki, T. Sasakawa, C. (2001). Molecular basis of intracellular spreading of Shigella. Infect Immun.69:5959-5966.

29-  Talukder, K. A. Dutta, D.K. Safa A, Ansaruzzaman M, Hassan, H. Alam, K. Islam, K. M. N. Carlin, N. I. A. Nair, G. B and Sack, D. A. (2001). Altering trends in the dominance of Shigella flexneri serotypes and emergenceof serologically atypical S. flexneri strains in Dhaka, Bangladesh. J. Clin. Microbiol. 39:3757–3759.

30-  Toshihiko, S. Shinsuke, S. and Chihiro, S.(1996). Functional Analysis of Shigella VirG Domains Essential forInteraction with Vinculin and Actin-based Motility. J Bio Chem. 271:21878–21885.

31-  Venkatesan MM, Goldberg MB. Complete DNA sequence and analysis of the large virulence plasmid of Shigella flexneri. Infect Immun. 2001;69:3271-3285.

32-  Venkatesan, M. M. Buysse, J. M. Kopecko, D. J. (1988). Characterization of invasion plasmid antigen genes (ipaBCD) from Shigella flexneri. Proc Natl Acad USA. 85:9317-9321.

33-  Venkatesan, M. M. Fernandez-Prada, C. Buysse, J. M. Formal, S. B. and Hale, T. L. (1991).Virulence phenotype and genetic characteristics of the T32-ISTRATI Shigella flexneri 2a vaccine strain. Vaccine. 9: 358–363.

34-  Venkatesan, M. M. Hartman, A. B. Newland, J. W. Ivanova, V. S. Hale, T. L. McDonough, M. and et al. (2002). Construction, Characterization, and animal Testing of WRSd1, a Shigella Dysenteriae 1 Vaccine. Infect Immun. 70:2950-2958.

35-  Yamamoto, Sh. Izumiya, H. Morita, M. Arakawa, E. Watanabe, H. (2009). Application of λ Red recombination system to Vibrio cholerae genetics: Simple methods for inactivation and modification of chromosomal genes. Gene. 438:57–64.

36-  Yoshikawa, M. Sasakawa, Ch. Okada, N. Takasaka, M. Nakayama, M. Yoshikawat, Y. and et al. (1995). Construction and evaluation of a virG thyA double mutant of Shigella flexneri 2a as a candidate live attenuated oral vaccine. Vaccine. 13: 1436-1440.

37-  Zhang, Y. Buchholz, F. Muyrers, J. P. Stewart, A. F. (1998).  A new logic for DNA engineering using recombination in Escherichia coli. NatGenet. 20:123-128.