نوع مقاله: مقاله پژوهشی

چکیده

 GR-RBP2 یکی از 8 عضو خانواده GR-RBP در گیاه آرابیدوپسیس است که پس از ترجمه درمیتوکندری جای می گیرد. مطالعه حاضر به منظور بررسی پروتئومیکی گیاهان تراریخت شده با GR-RBP2 در مقایسه با گیاه وحشی صورت گرفته است. در این مطالعه ژن GR-RBP2 از گیاه آرابیدوپسیس جداسازی و در پلاسمید pBIN19 کلون شد. سپس پلاسمید نوترکیب از طریق باکتریAgrobacterium tumefaciens  و به روش Floral Dipping به گیاه آرابیدوپسیس انتقال یافت. با انتقال cDNA کامل GR-RBP2 بیست و یک لاین به دست آمد. گیاهان تراریخت شده از نظر فنوتیپی و زمان گلدهی تفاوتی را با گیاه وحشی نشان نداده و قادر به تولید بذر بودند. میزان بیان ژن در سه لاین تراریخت شده مختلف و گیاه وحشی تعیین شد. میزانmRNA  درگیاهان تراریخت شده 2 برابر بیشتر از گیاه وحشی بود. آنالیز پروتئومیکی با استفاده از دو سیستم ژل مختلف صورت گرفت: 2D IEF/ SDS PAGE و 2D Blue-native/SDS PAGE. تمام ژلها با نقره رنگ آمیزی شدند. نتایج حاصل از ژل الکتروفورز 2 بعدی نشان داد که پروتئین GR-RBP2 در لاینهای تراریخت شده افزایش بیان داشته است. این نتایج نشان داد که پروتئینهای زنجیره تنفسی در لاینهای تراریخت شده مورد بررسی و گیاه وحشی به فراوانی وجود دارد. کمپلکس V زنجیره تنفسی (کمپلکس (F1 تا حدودی تخریب شده بود اما این امردر تمام لاینهای تراریخت شده و گیاه وحشی مشابه بود. آنالیز طیفهای MS به شناسایی 110 لکه پروتئینی منجر شد که 6 لکه پروتئینی در لاینهای تراریخت شده در مقایسه با گیاه وحشی افزایش نشان داد. نگاهی به برخی پروتئینهای شناخته شده نشان داد که هیچ تغییرعمده ای که نشاندهنده تحریک یا سرکوب برخی مسیرهای متابولیکی باشد وجود ندارد.

کلیدواژه‌ها

عنوان مقاله [English]

Proteomic analysis of transgenic Arabidopsis plants over expressing GR-RBP2 in comparison with Wild Type

چکیده [English]

Glycine-Rich RNA Binding Protein2 (GR-RBP2) is one of the eight GR-RBP family members in Arabidopsis thaliana which is located in mitochondria after translation. Here we employed a proteomic approach to compare transgenic Arabidopsis plants over expressing GR-RBP2 with Wild Type. In this study, GR-RBP2 gene was isolated from Arabidopsis and cloned into pBIN19 vector. Recombinant vector was transferred to Arabidopsis (Col-0) via Agrobacterium tumefaciens by Floral Dipping method. Transformation with full length cDNA of GR-RBP2 yielded 21 lines. Over expressing plants are indistinguishable from WT seedlings. The whole lines are unchanged with regard to flowering time and are fully fertile. Gene expression levels were determined in different over expressing lines compare with WT seedlings. The mRNA level in over expressing lines was 2 times higher than WT. Proteomic analysis of over expressing lines were carried out on two different gel systems: 2D IEF/ SDA PAGE and 2D Blue-native/SDS PAGE. All gels were silver stained. 2D gel electrophoresis revealed that GR-RBP2 was induced in over expressing lines. Results showed that respiratory chain looks very much in the same investigated lines and WT. Complex V was partially degraded (F1 complex), but this also is the same in all samples. Approximately 110 spots were identified by mass spectrometry. Six protein spots were increased in over expressing lines compared to WT. A look at some well known proteins showed that there is no major change indicating induction or repression of metabolic pathways.

کلیدواژه‌ها [English]

  • GR-RBP2
  • Proteomic analysis
  • Mitochondria
  • Gene Transformation

بررسی پروتئومیکی گیاهان تراریخت شده باGR-RBP2  در مقایسه با گیاه وحشی 

مهناز اقدسی

گرگان، دانشگاه گلستان، دانشکده علوم، گروه زیست شناسی 

تاریخ دریافت: 8/6/88                 تاریخ پذیرش: 8/3/90 

چکیده

 GR-RBP2 یکی از 8 عضو خانواده GR-RBP در گیاه آرابیدوپسیس است که پس از ترجمه درمیتوکندری جای می گیرد. مطالعه حاضر به منظور بررسی پروتئومیکی گیاهان تراریخت شده با GR-RBP2 در مقایسه با گیاه وحشی صورت گرفته است. در این مطالعه ژن GR-RBP2 از گیاه آرابیدوپسیس جداسازی و در پلاسمید pBIN19 کلون شد. سپس پلاسمید نوترکیب از طریق باکتریAgrobacterium tumefaciens  و به روش Floral Dipping به گیاه آرابیدوپسیس انتقال یافت. با انتقال cDNA کامل GR-RBP2 بیست و یک لاین به دست آمد. گیاهان تراریخت شده از نظر فنوتیپی و زمان گلدهی تفاوتی را با گیاه وحشی نشان نداده و قادر به تولید بذر بودند. میزان بیان ژن در سه لاین تراریخت شده مختلف و گیاه وحشی تعیین شد. میزانmRNA  درگیاهان تراریخت شده 2 برابر بیشتر از گیاه وحشی بود. آنالیز پروتئومیکی با استفاده از دو سیستم ژل مختلف صورت گرفت: 2D IEF/ SDS PAGE و 2D Blue-native/SDS PAGE. تمام ژلها با نقره رنگ آمیزی شدند. نتایج حاصل از ژل الکتروفورز 2 بعدی نشان داد که پروتئین GR-RBP2 در لاینهای تراریخت شده افزایش بیان داشته است. این نتایج نشان داد که پروتئینهای زنجیره تنفسی در لاینهای تراریخت شده مورد بررسی و گیاه وحشی به فراوانی وجود دارد. کمپلکس V زنجیره تنفسی (کمپلکس (F1 تا حدودی تخریب شده بود اما این امردر تمام لاینهای تراریخت شده و گیاه وحشی مشابه بود. آنالیز طیفهای MS به شناسایی 110 لکه پروتئینی منجر شد که 6 لکه پروتئینی در لاینهای تراریخت شده در مقایسه با گیاه وحشی افزایش نشان داد. نگاهی به برخی پروتئینهای شناخته شده نشان داد که هیچ تغییرعمده ای که نشاندهنده تحریک یا سرکوب برخی مسیرهای متابولیکی باشد وجود ندارد.

واژه های کلیدی: GR-RBP2 ، آنالیز پروتئومیکی, میتوکندری و انتقال ژن

نویسنده مسئول، تلفن: 09101062204 ، پست الکترونیکی:  Aghdasi46@yahoo.com

مقدمه

 

در یوکاریوتها تنظیم بیان ژن فرآیندی پیچیده بوده که در سطوح مختلفی صورت می گیرد. یکی از روشهای اصلی تنظیم بیان ژن در یوکاریوتها تنظیم پس از رونویسی است. سطوح مختلف تنظیم پس از رونویسی شامل پردازش، انتقال، پایداری و ترجمه mRNA است. در این مراحل تنظیم بیان ژن  بطور مستقیم و یا غیر مستقیم صورت می گیرد. درحالت اول تنظیم بیان ژن با اتصال پروتئین اتصالی RNA صورت میگیرد. اما در شکل دوم پروتئین اتصالی RNA  عمل سایر فاکتورهای تنظیمی را تعدیل می کند(9 و 10).

تاکنون تعداد 196 پروتئین در گیاه آرابیدوپسیس شناخته شده که توانایی اتصال به RNA را دارند. این پروتئینها، پروتئین اتصالی RNA یا  RNA Binding Proteinنامیده می شوند. گروهی از این پروتئینها یک منطقه غنی از اسید آمینه گلیسین در خود داشته و اصطلاحاً پروتئین اتصالی RNA غنی از گلیسین یا GR-RBP نام دارند. خانواده GR-RBP در گیاه آرابیدوپسیس هشت عضو دارد که به نامهای GR-RBP1 تا  GR-RBP8معرفی شده اند (13، 11). تمام اعضای این خانواده دارای یک پایانه آمینی و یک پایانه کربوکسیلی محافظت شده هستند. پایانه آمینی در شناسایی RNA نقش داشته و اصطلاحاً به آن RRM یا  RNA Recognition Motif گفته می شود (10، 8). در پایانه کربوکسیلی نیز یک منطقه غنی از گلیسین وجود دارد که به نظر می رسد در بر هم کنش پروتئین-پروتئین نقش داشته باشد (13). شواهد نشان می دهد که انواع GR-RBP ها در کنترل وقایع پس از رونویسی نقش مهمی را ایفاء می کند )15، 9). همچنین نشان داده شده است که برخی از اعضای این خانواده در مقاومت به تعدادی از تنشهای محیطی نقش دارند. به عنوان مثال گیاهان تراریخت شده باGR-RBP7  و  GR-RBP8نسبت به سرما مقاوم بوده و یا گیاهان تراریخت شده باGR-RBP4  نسبت به شوری مقاوم هستند (12).

یکی از انواع GR-RBP ها GR-RBP2 است که در میتوکندری جای دارد. پروتئین حاصل از این ژن از 153 اسید آمینه ساخته شده است (13). به منظور مطالعه نقش GR-RBP2 در مقاومت به تنشهای محیطی ابتدا ژن مورد نظر در گیاه آرابیدوپسیس تراریخت شده و پس از بررسی ویژگیهای ریختی و مورفولوژیکی، بیان ژن و پروتئومیکس گیاهان به دست آمده مورد بررسی قرار گرفته تا در ابتدا گیاهان تراریخت شده در شرایط طبیعی با گیاه شاهد مورد مقایسه قرار گیرند.

مواد و روشها

مواد گیاهی و شرایط کشت: بذور آرابیدوپسیس (کلمبیا- صفر) به مدت 5 دقیقه در اتانول 70 درصد ضدعفونی شده و به دنبال آن 5 بار با آب مقطر استریل شستشو داده شدند.

بذور گیاهان تراریخت شده نیز با بخارحاصل از اسید کلریدریک- آب ژاول ضدعفونی شده و در محیط کشت 1/2 MS حاوی 8 درصد آگار کشت شدند. به منظور شکستن خواب بذور قبل از انتقال به اتاقک کشت به مدت 4-2 روز در تاریکی و در دمای  4 درجه سانتی گراد نگهداری شدند.

خالص سازی  DNAژنومیک وPCR :  DNAژنومیک گیاه آرابیدوپسیس با استفاده از کیت ویژه استخراج DNA (The pure gene DNA isolation,Amersham Pharmaciabiotec, England)  استخراج شد. جداسازی ژن مورد نظر به روش PCR و با استفاده از پرایمر های رفت و برگشت ویژه صورت گرفت. با انجام PCR قطعه حد واسط به طول تقریبی 500bp تکثیر شد.

کلون کردن ژن GR-RBP2 در پلاسمید pGEM-T Easy Vector : به منظور تکثیر بیشترژن  GR-RBP2این قطعه توسط آنزیم T4 DNA ligase در پلاسمیدpGEM-T Easy Vector  کلون شد. سپس پلاسمید نوترکیب به باکتری Ecoli سویه αDH5 منتقل شدند. باکتریهای حامل پلاسمید نوترکیب بر روی محیط کشت حاوی آمپی سیلین گزینش شدند. این پلاسمید ها به روش لیز قلیایی استخراج و به منظور اثبات قطعه مورد نظر از آنزیم ECOR1 استفاده شد.

ساخت پلاسمید pBIN19/35S/NOS : ابتدا پلاسمید pUC18 به کمک آنزیم EcoRV برش داده شده و سپس قطعه CaMV35s-NOS از آن جداسازی شد. سپس ناقل pBIN19به کمک  EcoR1و  HindIII برش داده شد و قطعه CaMV35s-NOS  در این ناقل کلون شد. عملیات کلون کردن توسط آنزیم T4 DNA ligase صورت گرفت. به منظور جلوگیری از خودجوشی پلاسمید از آنزیم الکالین فسفاتاز استفاده شد. پس از انتقال پلاسمید نوترکیب به باکتری Ecoli سویه αDH5 گزینش بر روی محیط کشت حاوی آمپی سیلین انجام شد. پلاسمید های نوترکیب به روش لیز قلیایی استخراج و به منظور اثبات قطعه مورد نظر از آنزیمهای  Xba1وXmn1 استفاده شد.

کلون کردن GR-RBP2 در پلاسمید pBIN19/35S/NOS :به منظورانتقال ژن GR-RBP2 ، پلاسمید pBIN19/35S/NOS با آنزیم SmaI برش داده شد. سپس ژن تکثیر شده توسط آنزیم T4 DNA ligase در پلاسمید نوترکیب کلون شد.

انتقال ژن به آگروباکتریوم و گیاه آرابیدوپسیس: برای انتقال پلاسمید نوترکیب pBIN1935S/GR-RBP2/NOS به آگروباکتریوم pGV2260 از روش الکتروشوک استفاده شد. انتقال آگروباکتریوم حامل پلاسمید نوترکیب pBIN1935S/GR-RBP2/Nos به گیاهچه های گلدارآرابیدوپسیس به روشFloral Dipping  صورت گرفت (5).

استخراجRNA,RT-PCR  و :Q-PCR استخراج RNA از گیاهچه های 10 روزه با استفاده از RNeasy plant mini kit (QIAGEN USA, Valencia, CA).  انجام گرفت. غلظت RNA استخراج شده توسط اسپکتروفتومتر در طول موج 260nm تعیین شد. به منظور حذف DNA ژنومیک 10 نانوگرم از RNA استخراج شده با 2 واحد ازDNase  (DNA- free, Ambion, Austin, USA)  تیمار شد. پس از تایید عدم وجود DNA ژنومیک به کمک PCR ، 1 نانوگرم از RNA تیمار شده جهت ساخت cDNA استفاده شد. RT-PCR به کمکM-MLV reverse transcriptase  (Promega, Madison, WI)انجام شد. Q-PCR با استفاده از دستگاهABI-prism 7700 equence detection system و SYBR Green method وAtACTIN  به عنوان ژن مرجع صورت گرفت. توالی پرایمر های رفت و برگشت مورد استفاده به شرح ذیل می باشد: tcacttcggtgacgttgttg 3´)` 5´ ,´(5´atgtgacgaccattcagttcct 3 و (5´gccaagtgattgtggagactc3´, 5´gacccaaagacggagactctt3´). این آزمایش با 3 بار تکرار صورت گرفته است.

استخراج میتوکندری: در ابتدا گیاهچه های وحشی و تراریخت شده آرابیدوپسیس در فضای گلخانه در شرایط بلند روز به مدت 4-3 هفته کشت شدند. استخراج میتوکندری از 30 گرم برگ تازه و به روش سانتریفیگاسیون افتراقی صورت گرفت (6). به منظور جلوگیری از پروتئولیز پروتئینها از Protease inhibitor Coctail Complet (Roche, Indianapolis, IN, USA) استفاده شد. میزان پروتئین به روش برادفورد و همکاران (1976) سنجش شده است (4).

2D Blue-Native/ Tricine SDS PAGE : پس از استخراج میتوکندریها میزان خلوص نمونه تهیه شده به روش فوق تعیین شد (3). 100 میکروگرم از پروتئین در 75 میکرولیتر از بافر ACA (6-امینو-کاپروییک اسی 6 میلی مولار- محلول تریس 50 میلی مولار با (pH 7 حل شده و سپس 15میکرولیتر از N–دودسیل مالتوزید 10 درصد به آن اضافه شد. آنگاه به مدت 30 دقیقه در 30000 دور سانتریفیوژ شدند. سپس محلول رویی با 20 میکرولیتر از محلول کوماسی بلو مخلوط و در ژل آکریلامید (از نوع گرادیان) 5/4 تا 10 درصد بارگیری شد.

2D IEF/Tricine SDS PAGE : آنالیز پروتئینهای میتوکندری به روش 2D IEF/Tricine SDS PAGE صورت گرفت. این روش با استفاده ازIPG Phore System  Amersham Pharmaciabiotec, England)) با استفاده از ژلImmobilin   Dyestripانجام شد (3). 100 میکرو گرم از پروتئین در 10 میکرولیتر از محلول قلیایی A (اوره 8 مولار- محلول 4 درصد تریتون X-100- تریس 40 میلی مولار- DTT با غلظت 50 میلی مولار و محلول 1/0 مولار فنیل متیل سولفونیل فلوراید) حل شده و پس از 1 ساعت انکوبه کردن در حرارت اتاق 340 میکرو لیتر از محلولDrystrip  به آن اضافه شد. همه ژلها با نقره رنگ آمیزی شدند.

شناسایی پروتئینها و بررسی اسپکترومتری جرم: پس از بریدن لکه های پروتئینی از ژل دوبعدی؛ این پروتئینها در اپندورف حاوی lμ250 از محلول mM25 NH4HCO3 به مدت 30 دقیقه انکوبه شدند. در نهایت پروتئینها پس از لیپوفیلیزه شدن با  lμ 20 از محلول هضم ( gμ 05 تریپسین ‌] Promega, Madison, WI [ در lμ 20 از محلول mM50 (NH4HCO3به مدت 4 ساعت در 37 درجه سانتی گراد انکوبه گردید. در مرحله بعد به نمونه ها lμ 100 از محلول mM 50 NH4HCO3 اضافه و به مدت 30 دقیقه انکوبه شدند. سپس فاز رویی جداسازی و در ظرفی جداگانه نگهداری شد.

خالص سازی پپتید های جداسازی شده با استفاده از (Millipore, Bedford, MA) Zip-Tips و با استفاده از روش کار پیوست صورت گرفت. آنالیز پپتید های جداسازی شده به کمک دستگاه اسپکتروفتومتری جرمی از نوع MALDI TOF/ TOF صورت گرفت. سکوانسینگ پپتید ها و شناسایی پروتئینها با کمک برنامه ProteinProbe و Peptide Sequencing مربوط به نرم افزارBioLynx Version 3.4, Micromass)) صورت گرفت. کلیه عملیات مربوط به مقایسه سکوانهای به دست آمده در سایت آرابیدوپسیس(www.Arabidopsis.org)  صورت گرفت. محاسبه وزن مولکولی وPI  پروتئینها به کمکCOMPUTE pI/Mw (www.expasy.ch) صورت گرفت.

نتایج

تکثیر و خالص سازی ژن GR-RBP2 از گیاه آرابیدوپسیس با استفاده از PCR صورت گرفت. با انتقال ژن GR-RBP2 به گیاه آرابیدوپسیس و گزینش دانه رستهای تراریخت شده بر روی محیط کشت حاوی کانامایسین 21 گیاهچه تراریخت شده به دست آمد.

ویژگیهای ریختی گیاهان تراریخت شده در مقایسه با گیاه وحشی (کلمبیا-صفر): گیاهان تراریخت شده با GR-RBP2 در مقایسه با گیاه وحشی فنوتیپ طبیعی داشته و از نظر شکل ظاهری و زمان گلدهی تفاوتی را نشان ندادند. کلیه گیاهان تراریخت شده قادر به تولید بذر بوده و بذر ها نیز قابلیت رویش داشتند.

بررسی بیان ژن: به منظور اطمینان از آنکه تغییرات احتمالی پروتئومیکی به دست آمده ناشی از تغییرات در سطح mRNA پروتئین مورد نظر است بیان ژن GR-RBP2 در گیاه وحشی در مقایسه با گیاهان تراریخت شده مورد بررسی قرار گرفت. تجزیه بیان ژن در گیاهچه های 10 روزه که بر روی محیط کشت 1/2 MS در شرایط روز بلند کشت شده بودند با روشRT-PCR  و Q-PCR صورت گرفت. نتایج نشان داد که میزان بیان ژن در گیاهان تراریخت شده به طور معنی داری از گیاهچه های وحشی بالاتر است. شکل 1 نشان دهنده بیان ژن GR-RBP2 در گیاه وحشی در مقایسه با 3 لاین تراریخت شده است. تجزیه بیان ژن سایر لاینها در این شکل نشان داده نشده است.

مطالعات بعدی نیز تنها بر روی 3 لاین 33، 36 و 38 صورت گرفته است. در روی ژل حاصل از تکنیک2D Blue- Native/ SDS PAGE پروتئینهای متعددی مشاهده شد که از آن جمله کمپلکس های پروتئینی زنجیره تنفسی را می توان نام برد. کمپلکس V زنجیره تنفسی تا حدودی تخریب شده بود. که این امردر هر سه لاین تراریخت شده و نیز گیاه وحشی مشابه بوده است. میزان کمپلکس I زنجیره تنفسی نسبت به حالت ابر کمپلکس آن با کمپلکس III2 کمتر است. این امرنیز در کلیه گیاهان مورد بررسی یکسان بوده است (شکل 2).

نتایج حاصل از تکنیک IEF/SDS و آنالیز طیفهای MS به شناسایی حدود 110 لکه پروتیئنی در گیاه وحشی و تراریخت شده انجامید. در جدول 1 مشخصات برخی از پروتئینهای شناسایی شده آمده است.

 

 

 
   

 

 

 

 

 

 

 

 

 

 


شکل 1- بیان ژن GR-RBP2 در گیاه وحشی در مقایسه با 3 لاین تراریخت شده مورد بررسی.

 

جدول 1-  مشخصات تعدادی از پروتئینهای میتوکندریای شناخته شده گیاه آرابیدوپسیس

شماره لکه                               پروتئین شناسایی شده                             جرم مولکولی

1                                        ATP سینتاز، زیر واحد d                              19.5

2                                        ATP سینتاز، زیر واحد 'δ                            18.5

3                                        کمپلکس 1، زیر واحد 18 کیلو دالتونی               17.9

4                                       پروتئین ناشناخته میتوکندریایی                           18.4

5                                         GR-RBP                                              11.6         

9                                       نوکلئوزید دی فسفات کیناز                            17.1 

10                                      اینوزیتول-5- منوفسفات دهیدروژناز                 18.6

13                                      ATP سینتاز، زیر واحد δ                             22.2

14                                      سوپر اکسید دسموتاز                                   22.5 

18                                      پروتئین ناشناخته میتوکندریایی                         19.7         

21                                      ATP سینتاز، زیر واحد 24 کیلو دالتونی               24

26                                      پیروات دهیدروژناز، زیر واحد E1β                    29          

29                                      سوکسینیل کوانزیم لیگاز A، زیر واحد β             42.4

30                                     ATP سینتاز، زیر واحد β                              54.2

33                                      NAD مالات دهیدروژناز                              33.3

35                                     سوکسینیل کوانزیم لیگاز A، زیر واحد α             31.7

37                                     سیتوکروم b5 ردکتاز                                      27.3

41                                     پورین میتوکندریایی                                       29.1

42                                      پورین میتوکندریایی                                      29.3   

55                                     ATP سینتاز، زیر واحد α                                 55

 

الف)

 

ب) 

شکل 2- ژل الکتروفورز حاصل از سیستم 2D Blue-Native/Tricine SDS PAGE درالف(گیاه وحشی ((Wt وب) تراریخت شده (لاین 33). I : کمپلکسI , II : کمپلکس II , VکمپلکسV F1 ,: منطقه F1 کمپلکس V, I+III2: ابر کمپلکسی از کمپلکس I+III2 زنجیره تنفسی

 

 

در این مقایسه پروتئین GR-RBP2 لکه شماره 5 است. میزان حضور لکه شماره 5 در گیاه وحشی بسیار کمرنگ بوده، در حالی که در لاینهای تراریخت شده امکان تشخیص آن به راحتی وجود داشت (شکل 3).

مقایسه این دو ژل نشان می دهد که در لاینهای تراریخت شده با ژن GR-RBP2، پروتئینهای ATP سنتتاز ساب یونیت  d(لکه 1) ATP سنتتاز ساب یونیت' δ (لکه 2)- کمپلکس I زیر واحد 18 کیلو دالتونی (لکه 3)- پروتیئن ناشناخته میتوکندریایی (لکه 4)- 5 مونو فسفات اینوزین دهیدروژناز (لکه 10)- ATP سنتتاز ساب یونیت δ (لکه 13) افزایش بیان داشته اند (شکل 3). اما در مورد سایر پروتئنها تفاوتی را نشان نمی دهد.

نگاهی به برخی پروتیئنهای شناخته شده میتوکندریایی نظیرنوکلئوزید دی فسفات کیناز(لکه 9)- سوپر اکسید دسموتاز(لکه 14 )- پیرووات دهیدروژناز (لکه 26)- پورین (لکه 41 و 42)- NAD مالات دهیدروژناز(لکه 33) و سیتوکروم B ردکتاز نشان می دهد که هیچ تغییر مشخصی که نشان دهنده فعال شدن یا سرکوب مسیرهای متابولیکی باشد وجود ندارد (شکل 3).

 

 

 

الف)

 

                                                                             ب)

 

شکل3- ژل الکتروفورز حاصل از تکنیک IEF/SDS درالف) گیاه وحشی (,(Wt ب) تراریخت شده (لاین 33) درIEP بین 3 و 10 و وزن مولکولی بین 30 تا 50 کیلو دالتون. ژلها با نقره رنگ آمیزی شدند. محل پروتئین GR-RBP2 با دایره مشخص شده است.لکه 1: ATP سنتتاز ساب یونیت  ,dلکه 2ATP : سنتتاز ساب یونیت' δ, لکه 3: کمپلکس I زیر واحد 18 کیلو دالتونی,  لکه 4: پروتیئن ناشناخته میتوکندریایی, لکه 10 : 5 مونو فسفات اینوزین دهیدروژناز, لکه 13: ATP سنتتاز ساب یونیت δ.

 

بحث

میتوکندری اندامکی است که در گیاهان نقشهای متعددی را بر عهده دارد. این اندامک به طور غیر مستقیم در فتوسنتز و نیز یک مرحله از تنفس نوری دخالت دارد.

امروزه آنالیز پروتئومیک به یک ابزار قوی در تحقیق فرآیند های پیچیده سلولی تبدیل شده است. این روش در مطالعات ژنتیکی و فیزیولوژی گیاهان نیز بسیار موفق بوده است (16). به عنوان مثال مقایسه الگوهای پلی پپتیدی حاصل از الکتروفورز تأثیر شوری را در سنتز پروتئینهای گیاه تحت تنش نشان می دهد (1). اخیراً نیز تغییرات الگوی بیان پروتئینها در مراحل مختلف باززایی گیاهان در شرایط کشت بافت نیز مورد توجه قرار گرفته است (2).

آنالیز پروتئوم میتوکندریای به کمک ژل الکتروفورز دو بعدی و رنگ آمیزی نقره (در شرایط استاندارد) توانسته 650 پروتیئن مختلف را شناسایی کند(11و 14). نتایج نشان داده که تعداد کل ژنهای آرابیدوپسیس که پروتئینهای میتوکندری را کد می کند بین 1500 تا 2000 است. بر طبق این مطالعات حدود 10 درصد از میزان کل ژنوم آرابیدوپسیس بایستی پروتیئنهایی را کد کند که در میتوکندری جای دارد (7).

GR-RBP2  یک پروتئین میتوکندریایی است. این پروتئین از 153 آمینو اسید ساخته شده است. اسید آمینه های 33-1 سکوانسهای گذر پروتئین مزبور هستند که آن را به سمت میتوکندری هدایت می کند (13). نتایج حاصل از تحقیق حاضر نشان داد که تراریخت کردن گیاه آرابیدوپسیس با ژن GR-RBP2 تغییری در میزان و نوع پروتئینهای گیاه آرابیدوپسیس در شرایط طبیعی به وجود نمی آورد. در بین 110 پروتئین مورد بررسی تنها بیان برخی از زیر واحد های ATP سنتتاز تغییر نشان داده است. در ارتباط با پروتیئنهای شناخته شده میتوکندریایی که در مسیرهای متابولیکی اصلی نقش دارند. نیز شواهدی که نشان دهنده تغییری در مسیرهای متابولیکی باشد یافت نشده است. این نتایج نشان می دهد که در شرایط طبیعی پروتئین GR-RBP2 تغییراتی را در بیان سایر پروتئینها به وجود نمی آورد. احتمالاً در شرایط استرس GR-RBP2 بیان پروتئینهایی را تغییر می دهد که در مقاومت گیاه در شرایط استرس نقش دارند. بررسی گیاهان تراریخت شده در مقایسه با گیاه وحشی در شرایط استرسی مختلف نظیر شوری، سرما و یا خشکی می تواند مدعای فوق را به اثبات رسانده و نقشGR-RBP2  را در گیاهان نشان دهد.

تشکر و سپاسگزاری

از دکتر پیتر براون و همکاران ایشان در دانشگاه هانوور به جهت همکاری در انجام Mass spectrometry و آنالیز داده های آن تشکر و قدردانی می گردد.

1-     امین پناه، ه. (1383). اثر نیترات کلسیم بر الگوی الکتروفورزی پروتئینها و میزان پروتئینهای محلول جوانه‎های برنج در شرایط شوری. مجله زیست شناسی ایران. جلد 17، شماره 1، ص 11-23.

2-     ابراهیم زاده، م. (1387). بررسی تغییرات پروتئینها در مراحل مختلف رویانزائی بدنی از قطعات برگ. مجله زیست شناسی ایران. جلد 21، شماره 3، ص 369-381.  

 

3- Berkemeyer, M., Schieble, R. and Ocheretina, O. 1998., A novel non-redox-regulated NAD- dependent malate dehydrogenase from chloroplasts of Arabidopsis thaliana L. J. Biol. Chem. 273: 27927-27933.

4- Bradford, M.M. 1976., A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Analytical Biochem. 72: 248-254.

5- Clough, S.J. and Bent, A.F.  1998,. Floral dip: a simplified method for Agrebacterium-mediated transformation of Arabidopsis thaliana. Plant J.16:734-745

6- Day, Da. and Neuburger, M. 1985., Douce, R. Biochemical  characterization of   chlorophyll-free mitochondria from pea leaves. Aust. J.Plant Physiol. 12: 219-228

7- Emanuelsson, O., Nielsen, H., Brunak, S. and  Von heijene, G. 2000., Predicting subcellular localization of proteins based on their N-terminal amino acid sequence. J. Mol. Biol. 300:1005-1016

8- Gomez, J., Sanchez-Martinez, D., Stiefel, V., Ringau, J., Puigdomenech, P. and Pages, P. 1998., A gene induced by the plant hormone abscisc acid in response to water stress encodes a glycine-rich protein. Nature. 334: 262-264

9- Higgins, C.F. 1991,. Stability and degredation of mRNA. Current Opinion in Cell Biology. 3: 1013-1018

10- Kenan, D.J., Query, C.C. and Keen, J.D. 1991,. RNA recognition: towards identifying determinants of specificity. Trends in Biochemical Schience. 16: 214-220

11- Kruft, V., Eubel, H., Jansch, L., Werhahn, W., and Braun, H.P. 2001., Proteomic approach to identity novel mitochondrial proteins in Arabidopsis. Plant Physiol. 127: 1694-1710.

12- Kwak, K.J., Kim, Y.O. and Kang, H. 2005., Characterization of transgenic Arabidopsis plants overexpressing GR-RBP4 under high salinity, dehydration, or cold stress. J. experimental Botany. 421:3007-3016

13- Lorkovic, Z.J. and Barta, A. 2002., Genomic analysis: RNA recognition motif (RRM) and K homology (KH) domain RNA-binding proteins from flowering plant Arabidopsis thaliana. Nucleic Acids Reseaarch. 30: 623-635

14- Schagger, H., Cramer, WA. and Von Jagow, G.1994., Analysis of molecular masses and oligomeric states of protein complexes by blue native electrophoresis and isolation of membrane protein complex by two-dimentional native electrophoresis., Anal. Biochem. 217: 220-230

15- Simpson, G.G. and Fillipowicz, W. 1996,. Splicing of precursors to mRNA in higher plants: mechanism, regulation and sub-nuclear organization of spliceosomal machinery. Plant Molecular Biology. 32:1-41

16- Thiellement, H., Bahrman, N., Damerval, C., Polmion,C., Rossignol, M., Santoni, V., Vienne, D. and Zivy, M.1999.,  Proteomics for genetic and physiological studies in plants. Electrophoresis. 20: 2013-2026