نوع مقاله: مقاله پژوهشی

نویسندگان

1 گروه زیست شناسی سلولی و مولکولی، دانشکده علوم پایه، دانشگاه مراغه، مراغه، ایران

2 گروه بیوتکنولوژی دانشگاه علوم پزشکی شیراز ایران

3 دانشگاه ازاد بناب

چکیده

زمینه: ژن بتالاکتامازTEM یکی از مهمترین ژن‌های بتالاکتاماز پلاسمیدی در باکتری‌های خانواده انتروباکتریاسه است که عامل بیش از 90 درصد مقاومت سویه‌های اشرشیاکلی به داروهای بتالاکتام و از علل مهم بروز مقاومت‌های چندگانه دارویی در عفونت‌های بیمارستانی می‌باشد. هدف از این مطالعه بررسی مقاومت آنتی‌بیوتیکی در بیماران سرپایی و تعیین شیوع ژن TEM در سویه‌های ESBL می‌باشد. روش بررسی: در این مطالعه تعداد 266 نمونه بالینی اشرشیاکلی یوروپاتوژن از آزمایشگاه‌های شهرستان بناب جمع‌آوری و تأیید شد. آزمایش حساسیت آنتی‌بیوتیکی به روش دیسک دیفیوژن (تست کیربای-بویر) و تست تأییدی به روش دیسک ترکیبی برای شناسایی سویه‌های مولد ESBL انجام شد. DNA ایزوله‌های مولد ESBL استخراج گردید و آزمایش PCR برای ژن TEM انجام شد. یافته‌ها: بیشترین میزان مقاومت سوش ها در برابر آمپی‌سیلین (3/67 %) و بیشترین میزان حساسیت آنها در برابر ایمی پنم(5/92 %) دیده شد و در این مطالعه فراوانی جدایه های مقاوم به چند دارو زیاد بود که 45 درصد از جدایه ها به سه یا بیشتر از سه آنتی‌بیوتیک مقاوم بودند. همچنین از 154 سویه E.coli تحت بررسی 58 سویه ( %7/37) ، تولیدکننده ESBL بودند. 51/65 درصد از سویه‌ها حاوی ژن bla TEM بودند. نتیجه‌گیری: بر اساس نتایج این مطالعه ژن بتا لاکتاماز TEM بیش از 50 درصد بتالاکتامازهای وسیع الطیف را در اشرشیاکلی کد می‌نماید. بنابراین توصیه می‌شود شناسایی این ژن در سویه‌های بیمارستانی این باکتری‌ها در مجموعه آزمایشات روتین آزمایش‌های میکروبیولوژی قرار گیرد. این اقدام می‌تواند باعث تسریع در روند تشخیص و درمان بیماران گردد.

کلیدواژه‌ها

موضوعات

عنوان مقاله [English]

Evaluation of the Frequency of TEM beta-lactamase gene in patients with urinary tract infections in Bonab County

نویسندگان [English]

  • reza masoomi Jahandizi 1
  • mansoor aletaha 2
  • Mirkamiar Moosavi 3

1 Department of Cellular and molecular Biology, Faculty of Science, university of Maragheh, Maragheh, Iran

2 Biotechnology departement, medical university of Shiraz, shiraz Iran

3 Islamic Azad university of bonab

چکیده [English]

Background: TEM beta lactamase gene is one of the important plasmid genes in Enterobacteriaceae which is the cause of over 90% of Escherichia coli isolates resistance to beta lactam antibiotics. The aim of this study was to detect the prevalence of antibiotic resistance and TEM gene.
Materials and Methods: 266 clinical isolates of E.coli were collected from laboratories in Bonab County. Phenotypic screening and confirmation tests for extended spectrum beta lactamases (ESBLs) were carried out using disk diffusion (Kirby Bauer) method. All of the ESBL producing isolates were tested by PCR using specific primers.
Results: our results showed that, the maximum resistance was seen for ampicillin (67.3 %) and the maximum sensitivity was seen for imipenem (92.5%). In this study 45 % isolates were multidrug resistance, which showed at least resistance for three antibiotics. Out of 154 isolates, 58 (37.7%) cases were ESBL producers which 65.51% of isolates contained TEM gene.
Conclusion: This study showed that, TEM gene encodes over 50% of ESBLs in E.coli. Therefore, we recommend detection of this gene as a routine bacteriologic procedure in management of the nosocomial infections caused by enteric bacteria.

کلیدواژه‌ها [English]

  • Escherichia coli
  • ESBLs
  • TEM beta lactamase gene
  • Bonab County

بررسی فراوانی ژن بتا لاکتاماز TEM در ایزوله های عفونت ادراری بیماران در شهرستان بناب

رضا معصومی جهاندیزی1*، سید منصور آل طه2 و میر کامیار موسوی3

1 ایران، مراغه، دانشگاه مراغه، دانشکده علوم پایه، گروه زیست شناسی سلولی و مولکولی

2 ایران، شیراز، دانشگاه شیراز، گروه بیوتکنولوژی پزشکی

3 ایران، بناب، دانشگاه آزاد اسلامی واحد بناب، گروه میکروبیولوژی

تاریخ دریافت: 7/2/98                  تاریخ پذیرش: 12/5/98

چکیده

ژن بتالاکتامازTEM یکی از مهمترین ژن‌های بتالاکتاماز پلاسمیدی در باکتری‌های خانواده انتروباکتریاسه است که عامل بیش از 90% مقاومت سویه‌های E.coliبه داروهای بتالاکتام بوده و از علل مهم بروز مقاومت‌های چندگانه دارویی در عفونت‌های بیمارستانی می‌باشد. هدف از این مطالعه بررسی مقاومت آنتی‌بیوتیکی در بیماران سرپایی و تعیین شیوع ژن TEM در سویه‌های بتا لاکتاماز وسیع الطیف می‌باشد. در این مطالعه تعداد 266 نمونه بالینی E.coli یوروپاتوژن از آزمایشگاه‌های شهرستان بناب جمع‌آوری و تأیید شد. آزمایش حساسیت آنتی‌بیوتیکی به روش دیسک دیفیوژن (تست کیربای- بویر) و تست تأییدی به روش دیسک ترکیبی برای شناسایی سویه‌های مولد بتا لاکتاماز وسیع الطیف انجام شد. DNA ایزوله‌های مولد بتا لاکتاماز وسیع الطیف استخراج گردید و روش واکنش زنجیره ای پلی مرازی (PCR) برای بررسی بیان ژن TEM انجام شد. بیشترین میزان مقاومت سوش ها در برابر آمپی‌سیلین (%3/67 ) و بیشترین میزان حساسیت آنها در برابر ایمی پنم (%5/92) دیده شد. در این مطالعه فراوانی جدایه های مقاوم به چند دارو زیاد بود که 45% از جدایه ها به سه یا بیشتر از سه آنتی‌بیوتیک مقاوم بودند. همچنین از 154 سویه E.coli  تحت بررسی 58 سویه ( %7/37) ، تولیدکننده بتا لاکتاماز وسیع الطیف بودند. %51/65 از سویه‌ها حاوی ژن bla TEM  بودند. بر اساس نتایج این مطالعه ژن بتا لاکتاماز TEM  بیش از %50 بتالاکتامازهای وسیع الطیف را در E.coliکد می‌نماید. بنابراین توصیه می‌شود شناسایی این ژن در سویه‌های بیمارستانی این باکتری‌ها در مجموعه آزمایشات روتین آزمایش‌های میکروبیولوژی قرار گیرد. این اقدام می‌تواند باعث تسریع در روند تشخیص و درمان بیماران گردد.

واژه های کلیدی: E.coli ، ESBL ، ژن بتالاکتاماز TEM، شهرستان بناب

* نویسنده مسئول، تلفن: 09126721790 ، پست الکترونیکی: Masoomi_r@modares.ac.ir 

مقدمه

 

عفونت مجاری ادراری، Urinary Tract Infections (UTI)، یکی از شایع‌ترین عفونت‌های باکتریایی است. در این میان E.coli ارگانیسمی است که در حدود % 90-75 از موارد جدا شده را تشکیل می‌دهد. مقاومت E.coliبه آنتی‌بیوتیک‌های گوناگون در مناطق مختلف متفاوت بوده، و عامل مهمی برای درمان این بیماران است. وقوع عفونت مجاری ادراری در جامعه ناشی از سویه‌های E.coliمولد بتالاکتاماز با طیف گسترده، به صورت جهانی در حال افزایش است. با توجه به افزایش روز افزون تیپ‌های مختلف آنزیم‌های ESBL، بویژهbla TEM و تأثیر متفاوت آنها بر روی آنتی‌بیوتیک‌های مختلف، تعیین دقیق تیپ‌های مختلف آنزیم‌های ESBL با روش‌های مولکولی مانند PCR از نظر شناخت مقاومت‌های منطقه‌ای بسیار مهم است. راهکارهای مختلفی توسط باکتری‌ها برای مصونیت از اثرات زیان‌بار آنتی‌بیوتیک‌ها وجود دارد. یکی از مهم‌ترین این مکانیسم‌ها، که در باکتری‌های گرم منفی علیه آنتی‌بیوتیک‌های بتالاکتام به کار گرفته می‌شود تولید آنزیم‌های بتالاکتاماز است(24). بتا لاکتاماز وسیع الطیف، توانایی بتالاکتامازی را به باکتریهای گرم منفی در برابر آنتی بیوتیکها اعطا می کند. این مساله موجب مقاومت این میکروارگانیسمها در برابر آنتی بیوتیکهای بتا لاکتام می گردد. نتایج تحقیقات مونتراورز و همکارانش نشان دهنده تاثیر بهتر ترکیبات مهار کننده بتالاکتاماز برای خنثی کردن اثر مقاومتی ESBL می باشد (29). ژنهای متعددی مثل CTX-M-65 (9) وCTX-M-14  و CTX-M-1 (33). در بتالاکتامازی وسیع الطیف ایفای نقش می کنند.

بر اساس برخی تحقیقات مقاومت باکتریایی در برابر بعضی آنتی بیوتیکها مثل سفالوسپورین ها و کوتریموکسازول ها در حال افزایش است (6). معرفی و بکارگیری آنتی‌بیوتیک‌های جدید و وسیع الطیف در درمان عفونت‌های باکتریایی، مقاومت‌های چندگانه دارویی به داروهای بتالاکتام و سایر آنتی‌بیوتیک‌ها لازم و ضروری می باشد. به واسطه اهمیت E.coliدر بروز عفونت های بیمارستانی و اکتسابی از جامعه و امکان انتقال ژن‌های مقاومت آنتی‌بیوتیکی از این باکتری به باکتری‌های دیگر مطالعاتی در ارتباط با میزان مقاومت آنتی‌بیوتیکی این باکتری در نقاط مختلف ایران انجام شده است(3).

شناسایی عوامل بیماری‌زای مهم و شایع بیمارستانی و تعیین الگوی دقیق مقاومت آنتی‌بیوتیکی در جهت کنترل شیوع این‌گونه عوامل لازم بنظر می‌رسد. E.coli عامل طیف وسیعی از بیماری‌ها مثل عفونت‌های گوارشی، اسهال، کولیت خونریزی دهنده، سندرم اورمی همولیتیک، عفونت مجاری ادراری و مثانه، مننژیت نوزادان و سپتی سمی می باشد. در مطالعه ملزر و همکاران %8/60 باکتریمی های منجر به مرگ، ناشی از E.coli تولید کنندهESBL  بوده است (26). هدف از این مطالعه بررسی مقاومت آنتی‌بیوتیکی در بیماران سرپایی و تعیین میزان شیوع ژن TEM در سویه‌های بتا لاکتاماز وسیع الطیف می‌باشد. علاوه بر این تاثیر آنتی بیوتیکهای مختلف بر روی E.coli نیز بررسی شد و حساسیت آنها مورد سنجش قرار گرفت.

مواد و روشها

نمونه گیری: 266 نمونه باکتری که توسط آزمایشگاه‌ها و مراکز

درمانی شهرستان بناب به‌عنوان E.coli تشخیص داده شده بودند، جمع‌آوری و جهت انجام آزمایشات تأییدی بر روی آنها به آزمایشگاه تحقیقات میکروب‌شناسی منتقل شدند. به همراه نمونه‌ها، برخی از مشخصات بیماران مانند نام و نام خانوادگی، جنسیت، عدم مصرف آنتی‌بیوتیک و تاریخ نمونه‌گیری نیز ثبت گردید.

محیط‌های کشت: برای انجام کارهای آزمایشگاهی و کشت باکتریها از محیط های کشت مختلف زیر استفاده شد.

ائوزین متیلن بلو آگار؛ یک محیط افتراقی برای باکتری‌های گرم منفی و خصوصاً E.coli است. محیط تریپل شوگر آیرون آگار (TSI)، محیط سیمون سیترات آگار، محیط MR/VP براث ( محیط حاوی گلوکز و فسفات بوده و بسته به نوع باکتری یکی از دو واکنش تخمیر اسیدی مخلوط و تخمیر بوتیلن گلیکول در آن صورت می‌گیرد) پس از تلقیح باکتری در این محیط، 48 ساعت در دمای 37 انکوبه شدند و سپس معرف‌های مربوطه اضافه شدند. محیط کشت SIM آگار؛ از این محیط به منظور بررسی حرکت باکتری، تولید ایندول و تولید سولفید هیدروژن استفاده ‌شد. محیط مولر هینتون براث و محیط مولرهینتون آگار برای تست آنتی بیوگرام استفاده ‌شدند. از محیط پایه تریپتون سویا براث (TSB Tryptone Soy Broth) جهت فریز کردن استفاده شد.

معرف‌ها: در این تحقیق از معرف کواکس، معرف MR ، معرف VP استفاده شد. این محلول‌ها در یخچال و ظروف شیشه ای قهوه‌ای نگهداری شدند.

محلول‌های بیوشیمیایی: استاندارد نیم مک فارلند: این محلول در لوله‌های درب دار در حرارت اتاق و در جای تاریک نگهداری شد. محلول کدورتی معادل با 108×5/1 باکتری در هر میلی‌لیتر را نشان داد. بافر الکتروفورز 10x) TBE (؛ برای استفاده در تانک الکتروفورز یا ساخت ژل، به شکل X 10تهیه شد. محلول اتیدیوم بروماید (x1000) ؛ به عنوان محلول تانک رنگ‌آمیزی استفاده شد.

ژل الکتروفورز: با توجه به محصول DNA و نیز محصول PCR دو غلظت متفاوت % 8/0 و % 5/2 آگارز در بافر 1X TBE تهیه شد.

تشخیص دقیق باکتری E.coliدر تمامی ایزوله‌ها:

بررسی مورفولوژی کلنی در محیط ائوزین متیلن بلو آگار: تمامی نمونه‌هایی که در آزمایشگاه‌های تشخیص طبی، به عنوان E.coli شناسایی شده بودند به آزمایشگاه تحقیقاتی میکروب‌شناسی انتقال داده شدند و سپس بر روی محیط ائوزین متیلن بلو آگار کشت داده و 24 ساعت در 37 درجه سانتی گراد انکوبه شدند. پس از این مرحله سویه‌هایی که شکل کلنی آنها به کلنی E.coli شباهت داشت در محیط‌های افتراقی ،, TSI سیمون سیترات آگار،  SIM, MR/VP کشت داده شدند و پس از 18-24 ساعت مورد ارزیابی قرار ‌گرفتند.

کشت واکنش‌های محیطTSI : یک کلنی منفرد از باکتری توسط آنس به صورت عمودی در لوله حاوی محیط TSI تلقیح شد و سپس در همان راستا خارج شد. قسمت شیب‌دار لوله بصورت زیگزاگ کشت داده شد. در ادامه لوله‌ها به مدت 24 ساعت در داخل انکوباتور 37 درجه سانتی گراد قرار داده شدند. تخمیر لاکتوز توسط اشرشیا کلی موجب تولید اسید شده و سطح شیب‌دار محیط به شکل زرد-رنگ دیده شد. در اثر تولید گاز توسط برخی سویه ها، حباب‌هایی در لوله نمایان شد. در اثر احیای تیوسولفات توسط باکتری سولفید هیدروژن (H2S ) تولید شده که با یون فریک یا فرو ترکیب شده و یک رسوب سیاهرنگ در عمق محیط کشت تولید می شود.

کشت در محیط سیمون سیترات آگار: همزمان با کشت در محیط تریپل شوگر آیرون آگار، با آنس یک کلنی از باکتری برداشته شد و در محیط سیمون سیترات آگار کشت داده شد. پس از انکوباسیون به مدت 24 ساعت رنگ محیط تغییر نکرد. و واکنش سیترات در E.coli منفی شد.

کشت در محیط SIM: محیط SIM یک محیط نیمه جامد بوده و کشت باکتری در آن بصورت عمودی و عمقی انجام شد.  برای بررسی تولید H2S ، ایندول و حرکت باکتری از آن استفاده شد. تولید سولفید هیدروژن در E.coli منفی اما تولید ایندول و حرکت مثبت شد.

کشت در محیط MR/VP : این محیط به حالت براث (مایع) است. پس از آماده‌سازی، و پنبه­گذاری، لوله‌ها اتوکلاو شدند. سپس باکتری در آن کشت داده شد. با استفاده از یک لوپ استریل یک تا 2 کلنی در محیط تلقیح، و 48 ساعت در انکوباتور 37 درجه قرار داده شد. محیط MR/VP کشت داده شده به دو قسمت مساوی تقسیم شد. در مرحله آخر معرف‌های مربوطه اضافه شد. در یک لوله3 قطره معرف MR ( به ازاء هر میلی لیتر یک قطره) و در لوله دیگر (VP) چند قطره آلفا نفتول و هیدروکسید پتاسیم %10 اضافه گردید (3 قطره آلفا نفتول و2 قطره KOH به ازاء هر میلی لیتر از محیط کشت ) لوله حاوی معرفMR  پس از 15 دقیقه اگر قرمز رنگ شد، نشانه مثبت بودن تست است.

لوله حاوی معرف VP به مدت 45-30 دقیقه در انکوباتور 35 درجه قرار داده شد. محصول قرمز رنگ نشانه تست  مثبتVP است، تست MR و VP در E.coliبه ترتیب مثبت و منفی شد.

تعیین حساسیت سویه‌ها نسبت به آنتی‌بیوتیک‌ها

تست غربالگری سویه‌های مقاوم نسبت به سفالوسپورین­های منتخب و سایر آنتی‌بیوتیک‌ها به روش دیسک دیفیوژن: ابتدا از سویه‌های ذخیره شده در فریزر70- یک کشت تازه بر روی محیط بلاد آگار تهیه شد و سپس یک تا سه کلنی از کشت خالص باکتری در محیط مولر هینتون براث (5-4میلی لیتر) تلقیح گردید و به مدت یک ساعت انکوبه شد. سپس کدورت سوسپانسیون میکروبی را با محلول نیم مک فارلند استاندارد کرده و با استفاده از سواپ پنبه‌ای استریل آغشته در سوسپانسیون، بر روی محیط مولر هینتون آگار کشت گسترده، داده شد و پس از 15-10 دقیقه دیسک‌های آنتی‌بیوتیکی منتخب به فاصله 3-2 سانتی‌متر (مرکز به مرکز) از هم قرار داده شدند. نمونه ها به مدت 24 ساعت در داخل انکوباتور 37 درجه انکوبه شدند. قطر هاله‌های ممانعت از رشد توسط خط کش اندازه گیری شد. با استفاده از جداول شرکت Rosco که منطبق با CLSI (Clinical and Laboratory Standards Institute) بود، باکتری‌ها به سه گروه حساس، حساسیت متوسط و مقاوم تقسیم شدند و نتایج هرکدام از ایزوله‌ها برای تمام دیسک‌های استفاده شده ثبت شد.

تست حساسیت ضد میکروبی نسبت به دیسک های ترکیبی برای تأیید سویه های مولد بتالاکتاماز وسیع الطیف به روش انتشار دیسک: سویه هایی که نسبت به سفالوسپورین های منتخب یا آزترونام مقاومت داشتند انتخاب و بر روی محیط مولر هینتون آگار کشت داده شدند. بر روی پلیت ها علاوه بر دیسک های سفتازیدیم، سفوتاکسیم و سفپیم تکی (با غلظتهای 30 میکروگرم بر میلی لیتر )، دیسک های ترکیبی (سفتازیدیم + کلاوولانیک اسید، سفوتاکسیم + کلاوولانیک اسید و سفپیم + کلاوولانیک اسید) نیز قرار داده شدند. پلیت ها به مدت 24 ساعت در دمای37 درجه انکوبه شدند. در پایان قطر هاله اطراف دیسک های ترکیبی نسبت به دیسک های تکی بر مقیاس میلیمتر مقایسه گردید. تفاوت 5 میلی متری قطر هاله دیسک ترکیبی نسبت به دیسک تکی، نشان دهنده مولد بتالاکتاماز وسیع الطیف بودن ایزوله است.

برای تأیید سویه های مولد بتالاکتاماز وسیع الطیف از تست انتشار دیسک و بر اساس استاندارد CLSI استفاده شد. در تست های آنتی بیوگرام و تایید تولید بتالاکتامازهای وسیع الطیف از سویه کنترل منفی E.coliATCC 25922 و کلبسیلا پنومونیه ATCC 7881 بعنوان کنترل مثبت استفاده شد.

آزمایش های مولکولی

استخراجDNAژنومی از باکتری: برای بدست آوردن اسید نوکلئیک خالص، چربی ها و پروتئین ها به روش جوشانیدن از نمونه ها حذف شدند. نمونه ها در پلیت های حاوی محیط کشت مغذی بلاد آگار کشت داده شدند و در دمای 37-35 درجه به مدت 24 ساعت انکوبه شدند. تعدادی از کلنی های رشد یافته را به لوله اپندرف 5/1 میلی لیتر حاوی  5/0 میلی لیتر آب مقطر استریل انتقال داده و سپس این سوسپانسیون میکروبی به مدت 5 دقیقه در بن‌ماری در حال جوش قرار داده شد. در مرحله بعد نمونه به مدت 10 دقیقه در سرعت چرخش 14000  دور بر دقیقه سانتریفوژ گردید و فاز رویی حاوی DNA  برداشته شد و در دمای 20- درجه سلسیوس قرار داده شد.

روش تعیین غلظت و خلوصDNA : برای تعیین غلظت DNA ، استوک تهیه شده 1:100 رقیق شد. میزان جذب نوری در طول موج های 280 و 260 نانومتر توسط اسپکتروفوتومتر اندازه گیری شد. نسبت میزان جذب نوری260 به 280 نشانگر کیفیت DNA نمونه است. جذب نوری (OD) در طول موج 260 نانومتر بیانگر غلظت DNA در نمونه و OD در طول موج 280 نانومتر نشان دهنده غلظت پروتئین در نمونه می باشد. در صورتی که نسبت  بین 8/1 تا 2 باشد DNA در کیفیت خوبی جهت انجام PCR  قرار دارد. پس از خواندن جذب نوری نمونه ها، با استفاده از فرمول زیر غلظت DNA تعیین شد.

فاکتور رقت × (ng/µl)50 ×260OD  ꞊ ((ng/µl غلظت DNA

واکنش زنجیره ای پلیمرازی (PCR): DNA ایزوله هایی که تست فنوتیپی تولید بتالاکتاماز وسیع الطیف در آنها مثبت شده بود، استخراج شد. سپس وارد مرحله PCR شدند. بدین منظور با استفاده از پرایمرهای اختصاصی(12) قطعات ژنی تکثیر شدند.

TEM – F: 5′- AGTGCTGCCATAACCATGAGTG -3′

TEM – R: 5′- CTGACTCCCC GTCGTGTAGATA -3′

شکل 1- توالی پرایمرهای پیشرو و معکوس

نمونه هایDNA  و مواد مورد نیاز را از فریزر و یخچال خارج نموده و اجازه داده شد تا ذوب شده و به دمای اتاق برسند. به تعداد نمونه ها و نیز کنترل مثبت و کنترل منفی، میکروتیوب های مخصوصPCR  به ترتیب شماره گذاری شده و در جا لوله ای قرار داده شدند. با هر سری آزمایش PCR، یک کنترل مثبت و یک کنترل منفی در نظر گرفته شد.

کنترل منفی: این کنترل جهت بررسی وجود آلودگی نمونه ها باDNA  به کار می رود و در صورت وجودDNA  آلوده کننده، از آن به عنوان الگو کپی برداری شده و در نهایت بر روی ژل آگارز لکه ناشی از تکثیر آن مشاهده می گردد. محتویات آن شامل تمام مواد مورد نیاز در یک واکنش PCR بجزDNA  الگو می باشد.

برای انجام آزمایشPCR  از حجم نهایی واکنش، یعنی 25 میکرولیتر شامل: 5/12 میکرولیتر Master mix 1X (حاوی  MgCl25 /1میلی مول), 2میکرولیتر DNA الگو،2 میکرولیتر از هر کدام از جفت پرایمرها و 5/6 میکرولیتر هم آب مقطر دو بار تقطیر استریل استفاده شد. برنامه زمانی و دمای PCR در جدول

1 آورده شده است.

 

جدول 1 - برنامه زمانی و دمای PCR ژن TEM

برنامه

پدیده

دما

زمان

دور (سیکل )

برنامه 1

واسرشتگی اولیه

C0 94

5 دقیقه

1

برنامه 2

واسرشتگی(Denaturation)

برگشت (Annealing)

توسعه (Extension)

C0     94   C0   61

C0 72

 60 ثانیه

  60 ثانیه

60 ثانیه

30

30

30

برنامه 3

توسعه نهایی (Final Extension)

C072

  5 دقیقه

1

 


آشکار سازی محصولات PCR با روش الکتروفورز ژل آگارز

روش انجام الکتروفورز بر روی ژل آگارز: برای بررسی نتیجه آزمایشات مختلف، از جمله استخراج DNA و PCR از الکتروفورز بر روی ژل آگارز استفاده شد. با برقراری میدان الکتریکی مناسب بر روی ژل آگارز، قطعات DNA در حضور محلول بافر مناسب، بر اساس بار الکتریکی، اندازه و شکل خود به طرف الکترود آند حرکت می‌کنند. با این روش قطعات DNA براساس طول خود از همدیگر جدا می گردند.

2 میکرولیتر لودینگ بافر با 5 میکرولیتر محصولPCR  مخلوط و به داخل چاهک های ژل هدایت شد و در یکی از چاهک ها نیز 2 میکرولیتر مارکر قرار داده شد. برای رنگ آمیزی، ژل های آگارز به مدت 20-10 دقیقه در محلول اتیدیوم بروماید ( mg/l 1-5/0) قرار داده شدند. ژل ها پس از آبکشی، در دستگاهGel-Documentation  (BioRad ) مورد بررسی قرار گرفتند.

آزمون آماری داده ها: برای بررسی وجود ارتباط بین داده های به دست آمده در مراحل مختلف این تحقیق، اطلاعات مربوط به داده ها وارد نرم افزار آماری SPSS شده و مورد تجزیه و تحلیل قرار گرفتند. نمودار ها توسط نرم افزار SPSS نسخه 21 و نرم افزار prism نسخه 6 رسم شدند.

نتایج

کشت مجدد و تأیید نمونه ها:  پس از دریافت نمونه ها؛ جهت تأیید ایزوله ها، کشت باکتری بر روی محیط ائوزین متیلن بلو آگار، محیط های تریپل شوگر آیرون آگار (TSI )، سیمون سیترات آگار، SIM و MR/VP انجام شد و از بین نمونه ها، 266 ایزوله که از نظر مورفولوژی کلنی ها، رنگ آمیزی گرم، مشخصات بیوشیمیایی مانند اسید- اسید بودن در لوله  TSI ، منفی شدن تست سیترات، تولید ایندول، متحرک بودن و تولید H2S تأیید شدند.

توزیع سنی بیماران: همه 266 جدایه E.coliمورد بررسی، از بیماران سرپایی جمع آوری شدند. از مجموع مراجعین 249 نفر زن (%3/93) و 17 نفر (%4/6 ) مرد بودند. سن بیماران در محدوده 42 تا 15 سال، با میانگین 26 سال بود.

توزیع سنی بیماران مورد مطالعه در جدول شماره -2 آورده شده است. لازم به ذکر می باشد که تمام نمونه های جدا شده از جنس مذکر در گروه سنی 35-26 قرار داشتند.

جدول 2 - توزیع فراوانی افراد بر اساس گروه های سنی

گروه های سنی (سال)

25- 15

35-26

 45-36

تعداد

111

131

24

درصد

%7/41

%2/49

%9

نتایج تست آنتی‌بیوگرام: مقاومت و حساسیت به آنتی بیوتیک های انتخاب شده بر روی محیط کشت مولر هینتون توسط دیسک ها انجام گرفت (شکل- 2) و خلاصه آنها در جدول- 3 نمایش داده شده است.

با توجه به جدول، بیشترین مقاومت آنتی بیوتیکی مربوط به آمپی سیلین با % 3/67 و کمترین مقاومت آنتی بیوتیکی به ایمی پیم % 3/5 مشاهده شد و بیشترین حساسیت آنتی بیوتیکی مربوط به ایمی پیم با % 5/92 مشاهده گردید. قابل ذکر می باشد که %45 از سویه های جدا شده از E.coli به بیش از سه آنتی بیوتیک مقاومت نشان داد که این نشان دهنده مقاومت چند دارویی در این جدایه ها می باشد. بیشترین مقاومت آنتی بیوتیکی در گروه سنی 35-26 سال مشاهده شد (شکل -3  سمت راست ).

 

شکل 2- آنتی بیوگرام به روش انتشار دیسک برای تعیین مقاومت آنتی بیوتیکی (غلظت آنتی بیوتیک ها 30 میکروگرم بر میلی لیتر).

نتایج شناساییباکتریهایتولیدکننده ESBL : برای شناسایی باکتری های تولید کننده ESBL، آزمون غربالگری برای 266 نمونه باکتری انجام شد. 154 (% 9/57) نمونه باکتری وارد مطالعه شدند، که 112 باکتری بر طبق معیار های CLSI  و 42 باکتری دیگر با توجه به مقاومت به گروه های مختلف آنتی بیوتیکی انتخاب شدند. در آزمون نهایی (دیسک ترکیبی ) 58 سویه E.coli (%7/37 ) از 154 سویه به عنوان باکتری های تولید کنندهESBL مشاهده شدند. در ضمن همه 58 سویه ی مولد ESBL در دسته ای که طبق معیارهای CLSI انتخاب شده بودند، قرار داشتند. همه بیماران مونث بودند. گروه سنی 35-26 بیشترین موارد ESBL مثبت (%6/58) را نشان داد (شکل-4). از 154 گروه باکتریE.coliکه برای ESBL مورد ارزیابی قرار گرفته بودند، هر کدام از آنتی بیوتیک های مورد استفاده در این مطالعه نسبت به مولد بودن ESBL سنجش شده و نتیجه در جدول-4 گزارش گردید. در کل بیشترین میزان مولد ESBL در نمونه های مقاوم به آنتی بیوتیک آمپی سیلین (%8/94) و کمترین مقدار در نمونه های مقاوم به آنتی بیوتیک ایمی پنم (%9/6) مشاهده شد.

نتایج شناسایی ژنTEM : ژن  TEM یکی از ژن های مولد ESBL می باشد. پس از استخراج DNA وجود ژن TEM به کمک روش PCR بررسی شد. از 266 نمونه E.coliمورد بررسی 40 نمونه (%03/15) دارای ژن TEM بودند، و از 58 نمونه ESBL مثبت، 38 نمونه (%51/65) TEM مثبت بودند، که همه نمونه ها مربوط به خانم ها بود. همانطور که در شکل 5 مشاهده می شود ژن TEM در منطقه bp 431 مشاهده می شود. در بعضی از جدایه هایی که فاقد ESBL بودند نیز ژن TEM نیز شناسایی شد.

 

جدول 3 - تست آنتی بیوگرام، آنتی بیوتیکهای مختلف با سه درجه مقاوم، متوسط و حساس

 

آمپی سیلین

سیپروفلوکساسین

سفتراکسیون

ایمی پیم

آمیکاسین

سفیپیم

آزوترنام

سفوتاکسیم

سفتازیدیم

 

درصد مقاومت

3/67

6/52

8/50

3/5

2/16

7/41

1/42

5/48

5/30

درصد متوسط

6/5

11

3

3/2

3/29

8

4/6

4/3

3/8

درصد حساسیت

1/27

1/36

2/42

5/92

5/54

50

5/51

1/48

3/61

            

شکل3- ارتباط مقاومت آنتی بیوتیکی با گروه های سنی (سمت راست) ، مقاومت و حساسیت انواع آنتی بیوتیک ها (سمت چپ)

 

شکل 4- نمودار ارتباط گروه های سنی با باکتری های مولد ESBL (گروه سنی 35-26 سال دارای بیشترین فراوانی ESBL می باشند.)

 

جدول 4- مقایسه مقاومت آنتی بیوتیکی سویه های E.coliمولد ESBL (آنتی بیوتیک های مورد استفاده نسبت به مولد بودن ESBL )

آنتی بیوتیک

نمونه های ESBL مثبت

تعداد

درصد

 

آمپی سیلین

مقاوم

55

%8/94

حساس

0

%0

حساسیت متوسط

3

%2/5

کل

58

%100

 

آمیکاسین

مقاوم

29

%50

حساس

21

%2/36

حساسیت متوسط

8

%8/13

کل

58

%100

 

سفپیم

مقاوم

45

%6/77

حساس

9

%5/15

حساسیت متوسط

4

%9/6

کل

58

%100

 

ایمیپنم

مقاوم

4

%9/6

حساس

54

%1/93

حساسیت متوسط

0

%0

کل

58

%100

 

سیپروفلوکساسین

مقاوم

37

%8/63

حساس

14

%1/24

حساسیت متوسط

7

%1/12

کل

58

%100

 

سفتریاکسون

مقاوم

47

%81

حساس

9

%5/15

حساسیت متوسط

2

%4/3

کل

58

%100

 

سفتازیدیم

مقاوم

40

%1/69

حساس

15

%9/25

حساسیت متوسط

3

%2/5

کل

58

%100

 

سفوتاکسیم

مقاوم

50

%2/86

حساس

8

%5/13

حساسیت متوسط

0

%0

کل

58

%100

 

آزترونام

مقاوم

46

%3/79

حساس

9

%5/15

حساسیت متوسط

3

%2/5

کل

58

%100

 

 

شکل 5 -  الکتروفورز محصول PCR برای ژن TEM. ردیف 1: نمونه PCR مثبت ژن TEM، ردیف 2: نمونه PCR مثبت ژن TEM، ردیف 3: مارکر (100bp DNA ladder,)،  ردیف 4: کنترل مثبت ژن TEM، ردیف 5: کنترل منفی، ردیف 6: بلانک


بحث

در مطالعه ما در بین جدایه های مورد بررسی، مقاومت به آمپی سیلین بسیار بالا بود (%3/67)، که با نتایج سایر مطالعات در ایران و دیگر نقاط جهان که میزان مقاوت بالایی را گزارش کرده بودند مطابقت دارد، به طوریکه در ایران در سال 1390 مهاجری و همکاران مقاومت %77 ی را برای آمپی سیلین گزارش کردند(3) و میر صالحیان و همکاران مقاومت %5/98 ی را در بین نمونه ها مشاهده کرده بودند(27). در پژوهش لی و همکاران، مقاومت %60 ی، نسبت به آمپی سیلین مشاهده شد (23). در کشور های توسعه یافته مقاومت برای آمپی سیلین در مقایسه با سایر کشور ها پایین تر است، مطالعه ای در کشور یونان نشان دهنده مقاومت %50 نسبت به آمپی سیلین می باشد(25).

در این مطالعه فراوانی مقاومت جدایه های E.coli نسبت به سفتری آکسون، سفوتاکسیم و سفتازیدیم بترتیب %8/50، %5/48 و %5/30 بود که با نتایج مهاجری و همکارانش که به ترتیب. % 5/27 ، % 27 و %5/22 ، مقاومت آنتی بیوتیکی را مشاهده کرده بودند، متفاوت می باشد(3).

 بالا بودن سطح بهداشت در کشورهای پیشرفته و برنامه ریزی خوب در آنها موجب کاهش مقاومت آنتی بیوتیکی نسبت به کشورهای جهان سوم شده است، به طوریکه در مطالعه کیفر و همکاران در برزیل، نرخ سویه های مقاوم اشرشیاکلی به سفوتاکسیم و سفتازیدیم %6/14 گزارش شده است(22). در مطالعه مانتاداکیس مقاومت نسبت به سفوتاکسیم %7/3 و سفتازیدیم %4 بود. همچنین %7/41 از ایزوله ها نسبت به سفپیم مقاومت داشتند که این می تواند بخاطر طیف اثر بیشتر سفالوسپورین های نسل چهارم بر باکتری های گرم منفی روده ای و دیگر اینکه مواجهه کمتر ایزوله ها با سفپیم باشد(25). این تفاوت می تواند بیانگر افزایش مقاومت به سفالوسپورین های وسیع الطیف در طی سال های اخیر باشد. این روند می تواند بعنوان یک هشدار در درمان عفونت های ناشی از این باکتری باشد و با توجه به اینکه E.coli بعنوان یکی از شایعترین باکتری های جدا شده از بیماران ادراری و حتی شایعترین عامل عفونت مجاری ادراری در محیط های بیمارستانی و جامعه می باشد، معمولاً درمان آن با سفالوسپورین ها موفقیت آمیز نبوده و اغلب به شکست درمانی منجر می شود و همین امر منجر به استفاده از داروهای وسیع الطیف مثل فلوروکینولون ها و کارباپنم ها شده که سویه های مقاوم به این داروها نیز در حال افزایش است. این گروه از مقاومت های دارویی نه تنها در بناب بلکه در اکثر شهرهای ایران و دنیا گزارش شده و شیوع آن در حال افزایش است(30). نتایج آزمایش حساسیت ضد میکروبی مطالعه حاضر نشان می دهند که بیشترین میزان مقاومت در بین سفالوسپورین های نسل سوم و چهارم  به سفتریاکسون و سفوتاکسیم بوده و کمترین میزان به سفپیم می باشد. و این منطبق بر این اصل کلی است که از نسل اول به نسل چهارم سفالوسپورین ها، فعالیت بر ضد باکتری های گرم منفی بیشتر می شود. از خانواده های آمینوگلیکوزیدها و منوباکتام ها دو آنتی بیوتیک به ترتیب آمیکاسین و آزترونام انتخاب شد و از فلوروکینولون ها یک آنتی بیوتیک با نام سیپروفلوکساسین به عنوان نماینده انتخاب شد که مقاومت نسبت به آزترونام، آمیکاسین و سیپروفلوکساسین به ترتیب %1/42، %2/16 و %6/52 بود. مهاجری و همکارانش برای آزترونام مقاومت %27ی گزارش کردند(3). در برخی مطالعات مقاومت %89 ی به آزترونام در E.coliجدا شده از عفونت ادراری گزارش شده است(27). تحقیقی در ترکیه میزان مقاومت نسبت به آمیکاسین را %11 گزارش کرده است که با مطالعه ما همخوانی دارد(31). البته تعداد قابل توجهی از سویه ها نسبت به آمیکاسین حساسیت متوسطی داشتند که این می تواند مقاومت چند دارویی در سویه های مولد  TEMنسبت به آمینوگلیکوزید ها را هشدار دهد. در بین جدایه های مورد بررسی در مطالعه ما نسبت به سیپروفلوکساسین %6/52 مقاومت مشاهده شد. در مطالعاتی دیگر، مقاومت آنتی بیوتیکی %21 در بین سویه های اشرشیاکلی نسبت به سیپروفلوکساسین مشاهده شده است(4). این مقاومت در مطالعه دازا و همکارانش %35 گزارش شده است(11). اختلافات مشاهده شده این نتایج با سایر شهرها و کشورها مربوط به تفاوت در الگوی مصرف آنتی بیوتیک، منطقه جغرافیایی، تفاوت در الگوی مقاومت در مناطق مختلف، روش های مختلف آنتی بیوگرام و مصرف بی رویه آنتی بیوتیک در کشور ما می باشد، همچنین بالا بودن میزان مقاومت سویه های مقاوم به بعضی از سیپروفلوکساسین مناسبترین دارو برای درمان عفونت های ادراری ناشی از E.coliذکر شده است ولی نتایج محققان نشان می دهد که مقاومت نسبت به این دارو در حال افزایش است(15).

کمترین مقاومت به آنتی بیوتیک در ایمی پنم (%3/5) و بیشترین حساسیت نیز مربوط به این آنتی بیوتیک بود. که با نتایج سایر مطالعات در ایران و سایر نقاط جهان که میزان حساسیت بالایی را گزارش کرده بودند مطابقت دارد، به طوریکه در مطالعه مهاجری و همکاران(3)، %100 حساسیت برای ایمی پنم در E.coliجدا شده از عفونت ادراری گزارش شده است. در مطالعات دیگری هم حساسیت به ایمی پنم بالا (%100) بوده است(5،25).

در مطالعه حاضر، 58 سویه E.coli از 154 سویه (%7/37) به عنوان باکتری های تولید کننده ESBL مشاهده شدند. آمار شیوع E.coli مولد ESBL در ایران متفاوت بوده، و بیشترین آمار (%68) از کرمان گزارش شده است(20). در مطالعه ملزر و همکاران %8/60 باکتریمی های منجر به مرگ، ناشی از E.coli تولید کننده ESBL  بوده است(26).

در تحقیقات متعددی، فراوانی هایی مانند %6/60 ، %21 ، %3/44 شیوع ESBL نیز گزارش شده است (8،27،28). در این مطالعه %7/37 از ایزوله ها بعنوان مولدESBL تأیید شدند که آمار قابل توجهی بنظر می رسد. بالا بودن میزان ESBL در نمونه های مورد مطالعه می تواند بدلیل استفاده بی رویه از آنتی بیوتیک های وسیع الطیف مثل سفالوسپورین های نسل سوم و فلوروکینولون ها و تعداد زیاد نمونه ها در این مطالعه نسبت به مطالعات دیگر باشد. بالی و همکاران در ترکیه فراوانی ESBL در ایزوله های E.coliرا %14/69 گزارش کردند، که بالاتر از فراوانی ESBL در مطالعه حاضر می باشد(7). فراوانی ESBL در جوامع مختلف متفاوت می باشد. در برخی از آنها میزان آن کمتر از نتایج این مطالعه می باشد (12،19،35). در بعضی موارد نیز فراوانی آنها مشابه نتایج مطالعه حاضر می باشد (14،17). در برخی تحقیقات هم ایزوله های مولد ESBL در حال افزایش می باشند (32). نتیجه مطالعات جمیل و همکارانش نشان دهنده شیوع 33% ی  ESBL در باکتریهای E.coli در افراد مبتلا به عفونت مجاری ادراری می باشد(18).

در مطالعه ی میر صالحیان و همکاران بتالاکتاماز TEM با شیوع %5/55 ی به عنوان رایج ترین ESBL شناخته شد(27). نتایج تحقیق سلطان دلال و همکاران نشان داد که جدایه های E.coli ، %8/57 دارای ژن  TEM بودند(2). در مطالعه حسینی مزینانی و همکاران %60 و استانگ و همکارانش %67 جدایه های E.coliحاوی ژن blaTEM بودند(16،37). و ژن  bla CTX-M در %55 نمونه ها وجود داشته است(21). که با نتایج کالبو و همکارانش در اسپانیا مطابقت دارد(10). در مطالعه انجام شده توسط بالی و همکاران میزان این ژن در میان نمونه های E.coli کمی بیشتر بوده است ( %72) (7). در مطالعات ریو و همکاران نمونه های E.coli دارای ژن TEM از فراوانی بالایی برخوردار بودند(34). مطالعات نشان می دهد که در کشورهای اروپایی فراوانی ژن TEM مربوط به سویه های E.coli مولد ESBL پایین می باشد (%10) (36). فرهادی و همکارانش تاثیر برخی از ترکیبات فلز روی بر روی مقاومت وسیع الطیفی مربوط به ژن-15  CTX-M در باکتری کلبسیلا پنومونیا را بررسی کردند. نتیجه مطالعات آنها نشان داد که حساسیت باکتری در برابر داروهای ترکیبی بالاتر می باشد(13). داوری و همکارانش با استفاده از مدلسازی بیوانفورماتیکی ماده ای با کد DB01753 را به عنوان مهارکننده آنزیم بتالاکتاماز CTX-M-9 مشخص کردند. این ماده با اسید آمینه های مختلف مانند، سرین 237و 274، آسپاراژین 104، گلوتامات 166و تیروزین 105 پیوند هیدروژنی می دهد(1).

نتیجه گیری

با توجه به نتایج، مقاومت به سفالوسپورین های وسیع الطیف و دیگر آنتی بیوتیک های مورد مطالعه، بالا می باشد علاوه بر این میزان شیوع ESBL و ژن TEMنیز از آمار بالایی برخوردار است. پیامد این مساله، طولانی شدن دوره بیماری و مدت بستری، افزایش هزینه های درمانی و تجویز آنتی بیوتیک های وسیع الطیف می باشد. بنابر این تجویز سفالوسپورین ها و فلوروکینولون ها باید با احتیاط بیشتری صورت گیرد. حساسیت اکثر جدایه های مورد مطالعه به ایمی پنم و ارزشمند بودن این دارو ما را به این نتیجه می رساند که در درمان عفونت باکتریال، با کمک متخصصین آزمایشگاه و به دنبال تعیین الگوی حساسیت دقیق، از یک بتالاکتام در ترکیب با یک بازدارنده بتالاکتاماز استفاده شود. با این روش از گسترش بتالاکتامازهای وسیع الطیف در بین سویه های مختلف باکتریایی کاسته شده و از گسترش عفونت های مقاوم و نیز روز افزون شدن مرگ و میر در مراکز درمانی پیشگیری می شود. تولید ESBL تهدیدی بزرگ برای مصرف سفالوسپورین با طیف وسیع به شمار می رود، بنابراین برای درمان عفونت هایی که مشکوک به ارگانیسم های تولید کننده ESBL اند، باید آنتی بیوتیکی مناسب و با دقت زیاد انتخاب شود. سویه هایی که حساسیت آن ها در برابر سفتازیدیم، سفوتاکسیم و سفتریاکسون کاهش پیدا کرده است باید از نظر داشتن ژن های ESBL مورد بررسی قرار بگیرند.

1- داوری، ک،نوروزی ، ج، حسینی، ف،  اخوان سپهی، ع، ساکو میرزائی، س(1398).  کشف مهارکننده علیه بتا لاکتاماز CTX-M-9 باکتری E.coli با استفاده از مطالعات داکینگ ملکولی، MM/PBSA و دینامیک ملکولی.  دوره 32، شماره 1، 33-46.

2- سلطان دلال، م، م ، مبصری گ.، فلاح مهرابادی ج، اشراقیان م.ر. رستگار لاری ع. ملا آقامیرزایی ه. صباغی آ. آذر سا م(1390).  شناسایی ژن مقاومت بتا لاکتاماز CTX-M-1 در اشریشیا کلی جدا شده از نمونه های بالینی با روش واکنش زنجیره ای  پلیمراز . (PCR) مجله دانشکده پزشکی ، دانشگاه علوم پزشکی تهران، دوره 69، شماره 1، فروردین 1390 ، 16-21.

3- مهاجری، پ ، ایزدی ب، رضایی، م، فلاحی، ب خادمی ح. رویا ابراهیمی، (1390) بررسی تولید بتالاکتاماز وسیع الطیف در اشریشیاکلی های جدا شده از عفونتهای ادراری و الگوی مقاومت آنتیبیوتیکی در کرمانشاه. مجله دانشگاه علوم پزشکی اردبیل، دوره اول شماره 11 ، 86-94.

4- نخعی مقدم م.، مشرفی، ش(1391). تعیین الگوی مقاومت آنتی بیوتیکی ایزوله های ادراری اشرشیاکلی و شیوع بتالاکتامازهای طیف وسیع در بین آنها. مجله دانشگاه علوم پزشکی و خدمات بهداشتی درمانی سیزوار، دوره شانزدهم، شماره 4، 223- 228.

 

5. Andrade, S. S., Sader, H. S., Jones, R. N., Pereira, A. S., Pignatari, A. C.C., & Gales, A. C.  2006. Increased resistance to first-line agents among bacterial pathogens isolated from urinary tract infections in Latin America: time for local guidelines? Memórias do Instituto Oswaldo Cruz, 101(7): 741-748.

6. Balasubramanian, S., Kuppuswamy, D., Padmanabhan, S., Chandramohan, V., Amperayani, S. 2018. Extended-spectrum beta-lactamase-producing community-acquired urinary tract infections in children: Chart review of risk factors. Journal of Global Infectious Diseases. 10(4): 222-225.

7. Bali, E. B., Acik, L., & Sultan, N. 2010. Phenotypic and molecular characterization of SHV, TEM, CTX-M and extended-spectrum-lactamase produced by Escherichia coli, Acinobacter baumannii and Klebsiella isolates in a Turkish hospital .African Journal of Microbiology Research, 4(8): 650-654.

8. Behrooozi, A., Rahbar, M., Vand Yousefi J. 2010. Frequency of extended spectrum beta-lactamase (ESBLs) producing Escherichia coli and klebseilla pneumonia isolated from urine in an Iranian 1000-bed tertiary care hospital. African Journal of Microbiology Research, 4(9): 881-884.

9. Brown, A.C, Chen, J.C.  Francois Watkins, L.K.  Campbell, D.,  Folster, J.P. Tate, H.,  Wasilenko, J,  Van Tubbergen, C,  Friedman, C.R. 2018. CTX-M-65 extended-spectrum Beta-lactamase producing salmonella enterica serotype infantis, United States. Emerging Infectious Diseases. 24(12): 2284-2291.

10. Calbo, E., Romani, V., Xercavins, M., Gomez, L., Vidal, C. G., Quintana, S. Vila J. Garau, J. 2006. Risk factors for community-onset urinary tract infections due to Escherichia coli harbouring extended-spectrum beta-lactamases. Journal of Antimicrobial Chemotherapy, 57(4): 780-783.

11. Daza, R., Gutierrez, J., & Piedrola, G. 2001. Antibiotic susceptibility of bacterial strains isolated from patients with community-acquired urinary tract infections. International journal of antimicrobial agents, 18(3): 211-215.

12. Edelstein, M., Pimkin, M., Palagin, I., Edelstein, I., Stratchounski, L. 2003. Prevalence and molecular epidemiology of CTX-M extended-spectrum β-lactamase-producing Escherichia coli and Klebsiella pneumoniae in Russian hospitals. Antimicrobial agents and chemotherapy, 47(12): 3724-3732.

13. Farhadi, T., Fakharian, A. Ovchinnikov, R.S. 2018. Virtual Screening for Potential Inhibitors of CTX-M-15 Protein of Klebsiella pneumoniae. Interdisciplinary Sciences: Computational Life Sciences, 10(4): 694-703.

14. Goyal, A., Prasad KN., Prasad A., Gupta S., Goshal U. Ayyagari A. 2009. Extended spectrum beta-lactamases in Escherichia coli & Klebsiella pneumoniae & associated risk factor. Indian Journal of Medical Research. 129(6): 695-700.

15. Guest, J.F, Morris, A. 1997. Community-acquired pneumonia: the annual cost to the National Health Service in the UK. European Respiratory Journal, 10(7): 1530-1534.

16. Hosseini-Mazinani, S. M., Eftekhar, F., Milani, M., & Ghandili, S. 2007. Characterization of beta-Lactamases from Urinary Isolates of Escherichia coli in Tehran. Iranian Biomedical Journal, 11(2): 95-99.

17. Hussain M, Hasan F., Shah A.A., Hameed A., Jung M., Rayamajhi N., Cha SB., Yoo HS. 2011. Prevalence of Class A and AmpC b-Lactamases in Clinical Escherichia coli Isolates from Pakistan Institute of Medical Science, Islamabad, Pakistan. Japanese journal of infectious diseases, 64(3): 249-252.

18. Jamil, J., Haroon, M., Sultan, A., Khan, M.A., Gul, N. 2018.  Prevalence, antibiotic sensitivity and phenotypic screening of esbl/mbl producer e. Coli strains isolated from urine; district swabi, kp, pakistan. Journal of the Pakistan medical association. 68(11): 1704-1707.

19. Jitsurong, S., & Yodsawat, J. 2006. Prevalence of extended-spectrum beta-lactamases (ESBLs) produced in blood isolates of gram-negative bacteria in a teaching hospital in southern Thailand. Southeast Asian Journal of Tropical Medicine and Public Health., 37(1): 131-135.

20. Kalantar D, Mansouri Sh. 2010. Emergence of multiple β- lactamases produced by Escherichia coli clinical isolates from hospitalized patient in Kerman, Iran. Jundishapur Journal of Microbiology, 3(4): 137-145.

21. Kharrat, M., Chebbi, Y., Ben Tanfous, F., Lakhal, A., Ladeb, S. Othmen, T.B.,Achour, W. 2018. Extended spectrum beta-lactamase-producing Enterobacteriaceae infections in hematopoietic stem cell transplant recipients: Epidemiology and molecular characterization. International Journal of Antimicrobial Agents, 52(6): 886-892.

22. Kiffer, C., Hsiung, A., Oplustil, C., Sampaio, J., Sakagami, E., Turner, P., & Mendes, C. 2005 Antimicrobial susceptibility of Gram-negative bacteria in Brazilian hospitals: the MYSTIC Program Brazil 2003. Brazilian Journal of Infectious Diseases, 9(3): 216-224.

23. Lee, S.J., Lee, D. S., Choe, H. S., Shim, B. S., Kim, C. S., Kim, M. E., & Cho, Y.-H. 2011. Antimicrobial resistance in community-acquired urinary tract infections: results from the Korean Antimicrobial Resistance Monitoring System. Journal of infection and chemotherapy, 17(3): 440-446.

24. Li, Q., Lee, J. Y., Castillo, R., Hixon, M. S., Pujol, C., Doppalapudi, V. R. Chan, M. F. 2002. NB2001, a novel antibacterial agent with broad-spectrum activity and enhanced potency against β-lactamase-producing strains.   Antimicrobial agents and chemotherapy, 46(5): 1262-1268.

25. Mantadakis, E., Tsalkidis, A., Panopoulou, M., Pagkalis, S., Tripsianis, G., Falagas, M. Chatzimichael, A. 2011. Antimicrobial susceptibility of pediatric uropathogens in Thrace, Greece.  International urology and nephrology, 43(2): 549-55.

26. Melzer M, Petersen I. 2007. Mortality following bacteraemic infection caused by extended spectrum beta-lactamase (ESBL) producing E. coli compared to non-ESBL producing E. coli. The Journal of infection, 55(3): 254-259.

27. Mirsalehian A, Akbari-Nakhjavani A., Peymani A., Kazemi B., JabalAmeli F., Mirafshar SM. 2008. Prevalence of extended spectrum B-lactamase -producing enterobacteriaceae by phenotypic and Genotypic Methods in Intensive Care Units in Tehran, Iran. Daru-Journal of Pharmaceutical Science, 16(3): 169-173.

28. Mirzaee, M., Owlia, P., & Mansouri, S. 2009. Distribution of CTX-M β-lactamase Genes Among Escherichia coli Strains Isolated from Patients in Iran. Laboratory Medicine, 40(12): 724-727.

29. Montravers, P. Bassetti, M. 2018. The ideal patient profile for new beta-lactam/beta-lactamase inhibitors.  Current opinion in infectious diseases, 31(6): 587-593.

30. Peirano, G., Richardson, D., Nigrin, J., McGeer, A., Loo, V., Toye, B. Pitout, J. D. D. 2010. High prevalence of ST131 isolates producing CTX-M-15 and CTX-M-14 among extended-spectrum-β-lactamase-producing Escherichia coli isolates from Canada. Antimicrobial agents and chemotherapy, 54(3): 1327-1330.

31. Pullukcu H., Aydemir S., Tasbakan I. M., Cilli F., Tunger A., Ulosoy S. 2008. Susceptibility of Extended-Spectrum Beta-Lactamase-Producing Escherichia coli Urine Isolates to Fosfomycin, Ciprofloxacin, Amikacin and Trimethoprim-Sulfamethoxazole. Turkish Journal of Medical Sciences. 38(2): 175-180.

32. Qi C., Pilla V., Yu J.H., Reed K. 2010. Changing prevalence of Escherichia coli with CTX-M–type extended-spectrum β-lactamases in outpatient urinary E. coli between 2003 and 2008, Diagnostic microbiology and infectious disease, 67(1): 87-91.

33. RodrAguez-Revuelta, M.J., Lopez-Cerero, L., Serrano, L., Luna-Lagares, S., Pascual, A., RodrAguez -Baao, J. 2018. Incidence and Risk Factors for Acquisition of Extended-Spectrum Beta-Lactamase-Producing Enterobacteriaceae in Newborns in Seville, Spain: A Prospective Cohort Study. International Journal of Antimicrobial Agents, 52(6): 835-841

34. Ryoo, N. H., Kim, E.C., Hong, S. G., Park, Y. J., Lee, K., Bae, I. K., song EH.Jeong, S. H. 2005. Dissemination of SHV-12 and CTX-M-type extended-spectrum β-lactamases among clinical isolates of Escherichia coli and Klebsiella pneumoniae and emergence of GES-3 in Korea. Journal of Antimicrobial Chemotherapy, 56(4): 698-702.

35. Saurina, G., Quale, J. M., Manikal, V. M., Oydna, E., & Landman, D. 2000. Antimicrobial resistance in Enterobacteriaceae in Brooklyn, NY: epidemiology and relation to antibiotic usage patterns. Journal of Antimicrobial Chemotherapy, 45(6): 895-898.

36. Schito, G. C., Naber, K. G., Botto, H., Palou, J., Mazzei, T., Gualco, L., & Marchese, A. 2009. The ARESC study: an international survey on the antimicrobial resistance of pathogens involved in uncomplicated urinary tract infections. International journal of antimicrobial agents, 34(5): 407-413.

37. Stange, C., Yin, D., Xu, T., Guo, X., Schafer, C., Tiehm, A. 2019. Distribution of clinically  relevant antibiotic resistance genes in Lake Tai, China. The Science of the total environment, 655(10): 337-346.