نوع مقاله: مقاله پژوهشی

نویسندگان

1 عضو هیات علمی گروه علوم زیستی، دانشکده علوم پایه، دانشگاه کردستان، سنندج، ایران

2 علوم زیستی، دانشکده علوم ، دانشگاه کردستان، سنندج، ایران

چکیده

ال- دوپا (3و 4 دی هیدروکسی فنیل ال- آلانین) اولین بار در دهه 1960میلادی معرفی شد و همچنان به‌عنوان موثرترین دارو در درمان بیماری پارکینسون است. در این مطالعه، برای نخستین بار جداسازی سویه های باکتری نمک دوست نسبی تجزیه کننده ی ال-تیروزین و امکان استفاده از آنها بعنوان کاتالیزگر در زی‌تبدیلی ال-تیروزین به ال-دوپا انجام شد. با استفاده از تکنیک غنی سازی در محیط حاوی ال-تیروزین، سویه باکتری تجزیه کننده ال-تیروزین که بیشترین توانایی را در زی تبدیلی ال-تیروزین به ال-دوپا را دارا بود با استفاده از روش های فنوتیپی و ملکولی شناسایی و توالی نوکلئوتیدی 16S rDNA آن در بانک ژنی NCBI به عنوانsp. SL7 Halobacillus ثبت شد. با هدف افزایش راندمان واکنش زی تبدیلی و جلوگیری از تجزیه بیشتر متابولیت تولیدی (ال-دوپا)، میزان ال-دوپای تولید شده تحت استراتژی سلولهای در حال استراحت و با استفاده از روش های بهینه سازی تک فاکتوری در سویه مذکور سنجش شد. براساس نتایج بدست آمده، بهترین شرایط برای زی تبدیلی عبارت است از ال- تیروزرین در غلظت 5/1 گرم در لیتر.، توده زیستی در غلظت 5/7 گرم در لیتر، یون مس در غلظت 03/0 گرم در لیتر و پپتون در غلظت 1 گرم در لیتر بعنوان سوبسترای کمکی. تحت شرایط بهینه شده فوق غلظت ال- دوپای بدست آمده پس از 36 ساعت گرماگذاری 75/0 گرم در لیتر با راندمان مولی 2/46% است. مطالعه اخیر نخستین گزارش از زی تبدیلی ال- تیروزین به ال- دوپا بوسیله سول های در حال استراحت سویه باکتری نمک دوست نسبی sp. SL7 Halobacillus است.

کلیدواژه‌ها

موضوعات

عنوان مقاله [English]

Isolation and Identification of Halobacillus sp. SL-7: A moderately halophilic bacterium with potential biological converting L-tyrosine into L-dopa

نویسندگان [English]

  • Morahem Ashengroph 1
  • Mina Sayyadi 2

1 Associate Professor in Industrial Microbiology, University of Kurdistan, Faculty of Sciences, Department of Biological Sciences, Sanandaj, Iran.

2 Biological sciences, Faculty of sciences, University of Kurdistan, Sanandaj, Iran

چکیده [English]

L-DOPA (L-3, 4-dihydroxyphenylalanine) was first discovered in the 1960s as the most effective treatment for Parkinson's disease. In the present research, for the first time, isolation and identification of L-tyrosine-degrading moderately halophilic bacteria and evaluation their ability as biocatalyst for the bioconversion of L-tyrosine into L-dopa was studied. Using enrichment technique in tyrosine-containing medium, the L-tyrosine-degrading strain SL-7 with the highest ability to bioconvert L-tyrosine into L-dopa was phenotypically and molecularly characterized and its 16S rDNA sequence was submitted as Halobacillus sp. SL-7. In order to increase the reaction efficiency and prevent the degradation of the metabolites (L-dopa), One-factor-at-a-time optimization method was used to improve the yield of L-dopa in conversion reaction under resting cells of Halobacillus sp. SL-7. Based on our results, the optimum bioconversion conditions for the production of L-dopa can be summarized as follows: initial tyrosine concentration 1.5 g/l, biomass concentration 7.5 g/l, copper concentration 0.03 g/l and peptone at the concentration 1 g/l as cosubstrate. Under these conditions, the maximal L-dopa concentration (0.75 g/l with a molar yield of 46.2%) was achieved after a 36 h reaction. This is the first report on the potential of resting cells of Halobacillus sp. SL-7, A moderately halophilic bacterium with ability biological converting L-tyrosine into L-dopa.

کلیدواژه‌ها [English]

  • Bioconversion
  • L-tyrosine
  • L- dopa
  • Resting cell
  • Halobacillus sp. SL-7

جداسازی و شناسایی باکتری نمک دوست نسبیSL-7Halobacillus sp. با پتانسیل زی تبدیلی ال-تیروزین به ال-دوپا

مراحم آشنگرف* و  مینا صیادی

ایران، سنندج، دانشگاه کردستان، دانشکده علوم پایه، گروه علوم زیستی

تاریخ دریافت: 7/1/97                  تاریخ پذیرش: 25/10/97

چکیده

ال- دوپا (3و 4 دی هیدروکسی فنیل ال- آلانین) اولین بار در دهه 1960میلادی معرفی شد و همچنان به­عنوان موثرترین دارو در درمان بیماری پارکینسون است. در این مطالعه، برای نخستین بار جداسازی سویه های باکتری نمک دوست نسبی تجزیه کننده ی ال-تیروزین و امکان استفاده از آنها بعنوان کاتالیزگر در زی­تبدیلی ال-تیروزین به ال-دوپا انجام شد. با استفاده از تکنیک غنی سازی در محیط حاوی ال-تیروزین، سویه باکتری تجزیه کننده ال-تیروزین که بیشترین توانایی را در زی تبدیلی ال-تیروزین به ال-دوپا را دارا بود با استفاده از روش های فنوتیپی و ملکولی شناسایی و توالی نوکلئوتیدی 16S rDNA آن در بانک ژنی NCBI به عنوانsp. SL7 Halobacillusثبت شد. با هدف افزایش راندمان واکنش زی تبدیلی و جلوگیری از تجزیه بیشتر متابولیت تولیدی (ال-دوپا)، میزان ال-دوپای تولید شده تحت استراتژی سلولهای در حال استراحت و با استفاده از روش های بهینه سازی تک فاکتوری در سویه مذکور سنجش شد. براساس نتایج بدست آمده، بهترین شرایط برای زی تبدیلی عبارت است از ال- تیروزرین در غلظت 5/1 گرم در لیتر.، توده زیستی در غلظت 5/7 گرم در لیتر، یون مس در غلظت 03/0 گرم در لیتر و پپتون در غلظت 1 گرم در لیتر بعنوان سوبسترای کمکی. تحت شرایط بهینه شده فوق غلظت ال- دوپای بدست آمده پس از 36 ساعت گرماگذاری 75/0 گرم در لیتر با راندمان مولی 2/46% است. مطالعه اخیر نخستین گزارش از زی تبدیلی ال- تیروزین به ال- دوپا بوسیله سول های در حال استراحت سویه باکتری نمک دوست نسبی sp. SL7 Halobacillus است.

واژه ­های کلیدی: زی تبدیلی، ال- تیروزین، ال- دوپا، سلول در حال استراحت، sp. SL7 Halobacillus 

*  نویسنده مسئول، تلفن: 33664600-087 ، پست الکترونیکی: m.ashengroph@uok.ac.ir

مقدمه

 

بیماری پارکینسون برای اولین بار توسط دانشمند بریتانیایی دکتر جیمز پارکینسون در سال ۱۸۱۷ میلادی توصیف شد. او این بیماری را فلج لرزان نامید که امروزه آن را تحت عنوان بیماری پارکینسون می‌شناسند. بیماری پارکینسون یک بیماری دستگاه عصبی مرکزی در بزرگ‌سالان مسن­تر می باشد که مشخصه آن سفتی عضلانی پیش‌رونده تدریجی، لرزش و از دست رفتن مهارت­های حرکتی است. این اختلال هنگامی رخ می­دهد که نواحی خاصی از مغز توانایی خود در تولید دوپامین (یکی از ناقلین عصبی در مغز) را از دست می­دهند (18). ال- دوپا اولین بار در دهه 1960 میلادی معرفی شد و با اینکه پس از کشف این دارو، ده­ها داروی جدید برای بیماری پارکینسون معرفی شد، با این وجود همچنان به­عنوان موثرترین دارو در درمان بیماری پارکینسون می باشد (14). به رغم فراوانی روش های سنتزی در تولید داروهای شیمیایی، امروزه استفاده از فرآیندهای زیست تبدیل میکروبی در تولید متابولیت های طبیعی دارویی با ارزش افزوده بالا، سهم مهمی از سرمایه گذاری­های مرتبط با شرکت­های داروسازی و زیست فناوری را در برگرفته است. منظور از زیست تبدیل میکروبی، استفاده از سلول­های کامل میکروبی یا آنزیم­هایشان به­عنوان زیست کاتالیزگر برای تبدیل سوبستراهای طبیعی به ترکیبات طبیعی با ساختار مشابه اما با ارزش افزوده­ی بالا می باشد. در واقع سلول میکروبی به­عنوان زیست کاتالیزگر قادر به ایجاد ترکیبات شیمیایی خاص و باارزش از طریق حذف، اضافه نمودن و یا اصلاح استخلاف های عاملی در جایگاه های مشخص از سوبستراهای به­کار گرفته به­عنوان پیش ساز می باشد (1و 2). زی تبدیل میکروبی ال- تیروزین به ال- دوپا، فرآیندی همسو و متناسب با محیط زیست بوده (شیمی سبز) و ال- دوپای تولید شده بوسیله این فرآیندها جزء ترکیبات طبیعی طبقه بندی می شوند و بنابراین در بازارهای دارویی با استقبال بالایی از سوی مصرف کنندگان مواجه می شود (14 و 16 و 18). با توجه به اینکه بسیاری از داروهای سنتزی موجود در بازار دارویی بصورت راسمیک هستند و از آنجایی که انانتیومرهای نوری این داروهای کایرال از نظر خواص فارماکوسنتیکی و فارماکودینامیکی با هم تفاوت دارند بطوری که یکی از انانتیومرها دارای یک اثر زیستی خاص و انانتیومر دیگر دارای همان اثر، اثری کمتر، اثری متضاد و یا بی اثر دارد و نظر به اینکه در فرآیند زیست تبدیل میکروبی تنها یکی از ایزومرهای مورد نظر بصورت خالص سنتز می شود، بنابراین به کمک فرآیند زیست تبدیل میکروبی ال- تیرزوین می توان به تک ایزومر ال- دوپا (انانتیومر دارای اثر دارویی) دست یافت (4 و 15).  زی تبدیلی ال- تیروزین به ال- دوپا در طیف وسیعی از میکروارگانیسم­ها متعلق به جنس­های قارچی و باکتریایی شامل   Aspergillus (4)،Actinomycetes (15)،Yarrowia  (3)،Brevundimonas  (17)، Vibrio (22)، Pseudomonas (23) و Bacillus (16) گزارش شده است. باکتریهای نمک دوست با توجه به داشتن ویژگی­هایی مانند سریع الرشد بودن، نیاز غذایی کم و توانایی استفاده از انواع ماکروملکول­ها به­عنوان تنها منبع دریافت انرژی و همچنین عدم ایجاد آلودگی برای استفاده در فرآیندهای صنعتی مناسب هستند (10). علیرغم قابلیت بالای باکتری­های نمک دوست در تولید انواع آنزیم­های هیدرولیتیک که باعث ارزشمندی این میکرواورگانیسم­ها در فرآیندهای مختلفی از جمله پاکسازی زیستی (12) و زی تبدیلی شده (6)، با این وجود تا به امروز، مطالعه­ای در ارتباط با کاربرد باکتری­های نمک دوست در زی تبدیلی ال- تیروزین به ال-  دوپا صورت نگرفته است. بنابراین، در این پژوهش، برای نخستین بار زی تبدیلی میکروبی ال- تیروزین به ال- دوپا با استفاده از سویه­های باکتری نمک دوست نسبی به­عنوان کاتالیست­های سبز ایمن مورد مطالعه قرار گرفته است.    

مواد و روشها

مواد شیمیایی و محیط های کشت: ال- تیروزین و ال- دوپای بکار گرفته شده در واکنش­های زی تبدیلی از شرکت سیگماخریداری شد. محیط کشت لوریا برتانی (10 گرم در لیتر تریپتون، 5 گرم در لیتر عصاره مخمر و 5 گرم در لیتر نمک کلرید سدیم) از سیگما خریداری شد. نمک سولفات مس از شرکت دیفکوخریداری شد. نمک­های کلرید سدیم، کلرید منیزیم، سولفات منیزیم، کلرید کلسیم، کلرید پتاسیم، بیکربنات سدیم و برمید سدیم از شرکت مرک خریداری شد. گلوکز، گلیسرول، عصاره مخمر، پپتون، تریپتون و کلرید آمونیوم از هایمدیا خریداری شد. مواد و وسایل مورد نیاز برای انجام واکنش PCR  و همچنین پرایمرهای رفت (fd1) و برگشت (rp2) جهت شناسایی سویه های باکتری از شرکت فزاپژوه تهیه شد.

نمونه برداری و تکنیک غنی سازی: نمونه برداری بصورت تصادفی از عمق 20 سانتی متری و در حجم های 100 میلی لیتری (ظروف درب دار استریل) از نقاط مختلف دریاچه حوض سلطان قم، دریاچه بختگان فارس، سواحل دریای خزر و خلیج فارس انجام گرفت. این نمونه­ها پس از انتقال به آزمایشگاه در دمای 4 درجه سانتی گراد تا هنگام استفاده نگهداری شدند. برای غنی سازی باکتری­های نمک دوست نسبی در محیط حاوی ال- تیروزین، 25 میلی لیتر از نمونه­های آب شور جمع آوری شده به لوله­های فالکون استریل منتقل و در دور  rpm 5000 به مدت 20 دقیقه سانتریفیوژ شد. سپس محلول رویی را دور ریخته و مقدار 500 میکرولیتر از مایع تحتانی به­عنوان مایه تلقیح به محیط­های کشت غنی کننده لوریا برتانی آگار حاوی 100 گرم در لیتر نمک کلرید سدیم منتقل شد. به محیط­های کشت مذکور اسید آمینه ال- تیروزین در غلظت نهایی 5/2 گرم در لیتر، پس از استریل شدن توسط فیلترهای سرسرنگی 25/0 میکرونی، افزوده شد. پلیت­ها به مدت 24 تا 48 ساعت در دمای 30 درجه سانتی گراد گرماگذاری شدند. سویه­های جدا شده به ­صورت کلنی های تک، به محیط­های لوریا برتانی آگار حاوی 100 گرم در لیتر نمک کلرید سدیم، به صورت کشت خطی انتقال داده شدند. سویه­های خالص شده به محیط­های اسلنت دار جهت آزمایشات بعدی انتقال داده شدند (5).

جداسازی سویه­های باکتری نمک دوست نسبی با پتانسیل تجزیه کنندگی ال- تیروزین: برای جداسازی سویه­های باکتری نمک دوست نسبی با قابلیت تجزیه کنندگی ال- تیروزین، از محیط پایه نمکی پیشنهادی توسط Nieto و همکاران (11)، با اندکی تغییرات، با ترکیب زیر استفاده شد (گرم در لیتر): کلرید سدیم 100، کلرید کلسیم 36/0، کلرید پتاسیم 2، کلرید منیزیم 7، سولفات منیزیم هفت آبه 6/9، بیکربنات سدیم 06/0، برمید سدیم 026/0 و آگار 20 . به محیط مذکور به میزان 5/2 گرم در لیتر ال- تیروزین به­عنوان تنها منبع کربن و ازت اضافه شد. محیط­های کشت مذکور به مدت 24 تا 48 ساعت در شرایط دمایی 30 درجه سانتی گراد گرماگذاری شدند.

بررسی  تولید  ال  دوپا  از  ال  تیروزین  تحت  واکنش

سلول­های رویشی: سویه­های باکتریایی با قابلیت تجزیه کنندگی ال- تیروزین در محیط آبگوشتی لوریا برتانی حاوی 100 گرم در لیتر نمک کلرید سدیم به مدت 24 ساعت کشت داده شدند. سپس اسید آمینه ال- تیروزین، پس از فیلتراسیون از طریق پالایه های غشایی میلی پور22/0 میکرونی، در غلطت نهایی 5/2 گرم در لیتر به محیط افزوده شدند. پس از طی 24 ساعت گرمخانه گذاری اضافی، ابتدا کل مایع رویی از توده سلولی با استفاده از سانتریفیوژ کردن (×g5000 به مدت 20 دقیقه) جدا گردید. در ادامه، میزان ال تیروزین مصرف شده و ال دوپای تولید شده در مخلوط واکنش زی تبدیلی، از روش اسپکتروفتومتری براساس روش پیشنهادی Rani و همکاران (13) استفاده شد. برای تعیین کمی میزان تیروزین مصرف شده در مخلوط واکنش زیست تبدیلی، میزان 1 میلی لیتر از معرف سولفات مرکوریک 5/2 میلی مولار به 1 میلی لیتر سوپرناتانت کشت واکنش زی تبدیلی اضافه شد. سپس نمونه ها به مدت 10 دقیقه در حمام آب گرم در حال جوش گرماگذاری شدند. سپس نمونه ها از حمام آب گرم خارج شده و پس از سرد شدن در دمای آزمایشگاه، 1 میلی لیتر نیتریت سدیم و 1 میلی لیتر مولیبدات سدیم اضافه شد. سپس جذب محلول کلوئیدی (زرد رنگ) تشکیل شده در طول موج 447 نانومتر توسط دستگاه اسپکتروفتومتری (Analytik Jena’s spectrophotometer SPECORD 210.Germany) قرائت شد. برای رسم منحنی استاندارد، ابتدا غلظت های مختلفی از محلول­های استانداد ال- تیروزین تهیه شده که شامل 15، 25، 50، 75 و 100 میلی گرم در لیتر بود توسط دستگاه خوانده شده و سپس به کمک رسم منحنی کالیبراسیون و تهیه معادله خط منحنی استانداد (y= 0.0133x- 0.0824, R2= 0.9823)، غلظت ال- تیروزین موجود در مخلوط واکنش زی تبدیلی تعیین گردید. در ادامه و با هدف تعیین میزان ال- دوپای تشکیل شده در واکنش زی تبدیلی، میزان 1 میلی لیتر از هر یک از معرف­های زیر شامل اسید کلریدریک 2 مولار، مولیبدات سدیم 15 درصد وزنی/حجمی، نیتریت سدیم 15 درصد وزنی/حجمی و هیدروکسید سدیم 2 مولار به 1 میلی لیتر سوپرناتانت اضافه شد. سپس نمونه­ها به مدت 30 دقیقه در دمای آزمایشگاه گرماگذاری شدند. جذب محلول کلوئیدی (قرمز پرتفالی) تشکیل شده در طول موج 496 نانومتر قرائت شد. برای رسم منحنی استاندارد، ابتدا غلظت­های مختلفی از محلول­های استانداد ال- دوپا تهیه شده که شامل 15، 25، 50، 75 و 100 میلی گرم در لیتر بود توسط دستگاه خوانده شده و سپس به کمک رسم منحنی کالیبراسیون و تهیه معادله خط منحنی استانداد (y= 0.0185x- 0.148, R2= 0.9914)، غلظت ال- دوپای موجود در مخلوط واکنش زی تبدیلی تعیین گردید.

شناسایی ملکولی سویه باکتری SL-7: استخراج DNA ژنومی سویه SL-7 به روش فنل- کلروفرم روی سوسپانسیون حاصل از کشت خالص 24 ساعته باکتری در محیط کشت مایع لوریا برتانی حاوی 100 گرم در لیتر نمک کلرید سدیم انجام شد (8). واکنش PCR در حجم نهایی 25 میکرولیتر مخلوط واکنش، متشکل از 5/12 میکرولیتر ماسترمیکس (بافر PCR، MgCl2، dNTPs، آنزیم Taq-polymerase)،  1 میکرولیتر پرایمرهای بالادست (fd1: AGAGTTTGATCCTGGCTCAG ) و پایین دست (rp2: ACGGCTACCTTGTTACGACTT ) (21) با غلظت تقریبی 10 میکرومولار، 1 میکرولیتر DNA الگو (غلظت تقریبی 50 نانوگرم بر میکرولیتر) و 5/9 میکرولیتر آب PCR با استفاده از دستگاه ترموسایکلر (مدل C1000 کمپانی Bio-Rad کشور آلمان) انجام گرفت. برنامه تکثیری با واسرشت اولیه در دمای 95 درجه سانتی گراد به مدت 1 دقیقه سپس 30 سیکل به صورت واسرشت شدن در دمای 95 درجه سانتی گراد به مدت 45 ثانیه، چسبیدن پرایمر به DNA ژنومی در دمای 50 درجه سانتی گراد به مدت 45 ثانیه و تکثیر DNA در دمای 72 درجه سانتی گراد به مدت 2 دقیفه انجام شد. بسط نهایی در دمای 72 درجه سانتی گراد به مدت 10 دقیقه انجام گرفت. محصول PCR به منظور تعیین توالی به شرکت زیست فناوران ارسال شد. نتایج مربوط به تعیین توالی های رفت و برگشت پس از ویرایش توسط نرم افزار BioEdit به صورت یک توالی کامل تهیه شد. سپس توالی های بدست آمده توسط نرم افزار BLAST موجود در بانک ژنی NCBI (http://www.ncbi.nlm.nih.gov/blast) با باکتری­های موجود مقایسه شد و نزدیک ترین سویه­های باکتری براساس توالی 16S rDNA و به کمک ترسیم درخت فیلوژنیک با استفاده از نرم افزار MEGA. 6 تعیین شد (19).

بهینه سازی تولید ال-دوپا از ال-تیروزین در سویه SL-7 تحت سلول­های در حال استراحت: بعد از شناسایی فنوتیپی و مولکولی سویه جدا شده، به منظور بهبود راندمان تولید ال- دوپا، اثر چندین پارامتر در مخلوط واکنش زی تبدیلی تحت استراتژی سلول در حال استراحت مورد بررسی و بهینه سازی قرار گرفت. آزمایشات در داخل ارلن­های 250 میلی لیتری حاوی 50 میلی لیتر بافر فسفات نمکی (  NaCl 100g/l; pH 7وK2HPO4/KH2PO4, 100 mM) و غلظت های مختلف ال- تیروزین (5/0، 1، 5/1، 2 و 5/2 گرم بر لیتر)، غلظت­های مختلف از توده سلولی (5/2، 5، 5/7، 10 و 5/12 گرم بر لیتر بر حسب وزن خشک)، غلظت­های مختلف یون مس (01/0، 02/0، 03/0، 04/0 و 05/0 گرم در لیتر) و همچنین اثر منابع کربن و ازتی معدنی و آلی مختلف شامل گلوکز، گلیسرول، پپتون، تریپتون، کلرید آمونیوم و عصاره مخمر در غلظت های نهایی 1 گرم در لیتر، تحت شرایط سلول­های در حال استراحت انجام شد. همه آزمایشات زی­تبدیلی در دمای 30 درجه سانتی گراد و دور شیکر rpm 150در یک دوره گرماگذاری 24 ساعت صورت گرفت. به منظور تهیه سلول­های در حال استراحت باکتری نمک دوست نسبی جداسازی شده و استفاده از آنها به­عنوان بیوکاتالیزگر در آزمایشات زی­تبدیلی، سلول­های باکتری در محیط مایع LB  حاوی 100 گرم در لیتر در دمای 30 درجه سانتی گراد و دور شیکر rpm 150 به مدت 28 ساعت (تا رسیدن به انتهای فاز رشد لگاریتمی) کشت داده شدند. سپس توده سلولی به کمک سانتریفیوژ برداشت و پس از شستشوی سلول­ها در بافر فسفات، از سلول­های برداشت شده به­عنوان کاتالیزگر در آزمایشات زی­تبدیلی استفاده شد (5).

نتایج

غنی سازی و جداسازی سویه های باکتری نمک دوست

نسبی تجزیه کننده ال- تیروزین با قابلیت زی تبدیلی ال- تیروزین به ال- دوپا: ­پس از انجام نمونه گیری از آب­های شور مناطق مختلف و غنی سازی در محیط حاوی ال- تیروزین، حدود 40 سویه باکتری نمک دوست نسبی جداسازی شدند که در میان آنها تنها 11 سویه توانایی در مصرف ال- تیروزین به­عنوان تنها منبع کربن و ازت در محیط پایه نمکی از خود نشان دادند.

 

 

شکل 1- تولید زیستی ال- دوپا از ال- تیروزین تحت سلول­های رویشی سویه­های باکتری نمک دوست نسبی تجزیه کننده ال- تیروزین. نتایج ارائه شده میانگین سه بار آزمایش بوده و بار1± معرف انحراف معیار است.

 

در ادامه و با هدف انتخاب سویه برتر، سویه­های مذکور جهت آزمایشات زی تبدیلی ال- تیروزین به ال- دوپا تحت شرایط سلول­های رویشی انتخاب شدند. 11 سویه باکتری با قابلیت استفاده از ال- تیروزین به­عنوان تنها منبع کربن و ازت، در محیط لوریا برتانی حاوی 100 گرم در لیتر نمک کلرید سدیم  به مدت 24 ساعت کشت داده شدند. سپس سوبسترای ال- تیروزین در غلظت نهایی 5/2 گرم در لیتر به محیط زی­تبدیلی افزوده شد. بعد از 24 ساعت واکنش تحت سلول های رویشی، از آنالیز اسپکتروفتومتری استفاده شد. براساس نتایج بدست آمده، از میان سویه­های باکتری مذکور، سلول­های رویشی سویه SL-7 بالاترین میزان تولید ال-دوپا (48/0گرم در لیتر) را نشان داد  (شکل 1). سویه SL-7 به­عنوان سویه برتر مورد شناسایی فنوتیپی و مولکولی جهت آزمایشات زی­تبدیلی ال- تیروزین به ال- دوپا  قرار گرفت.

شناسایی فنوتیپی و ملکولی سویه SL-7: سویه SL-7 که براساس آنالیز کمی اسپکتروفتومتری دارای بیشترین میزان ال- دوپای تشکیل شده در واکنش زی­تبدیلی بود را انتخاب و براساس ویژگی­های ریخت شناسی، بیوشیمیایی و فیزیولوژیک مورد شناسایی قرار گرفت. سویه SL7 یک باکتری میله ای شکل گرم مثبت، تولید کننده اسپور، کاتالاز و اکسیداز مثبت، متحرک، شدیدا هوازی و دارای قابلیت تحمل پذیری نمک کلرید سدیم بین20 تا 120 گرم در لیتر می باشد. این سویه از یک نمونه آب شور جمع آوری شده از دریاچه حوض سلطان قم جداسازی شده بود. جهت شناسایی ملکولی سویه SL-7، ابتدا DNA ژنومی استخراج و سپس ژن کد کننده نواحی S rDNA16از طریق پرایمرهای یونیورسال fd1 و rp2 مورد واکنش PCR قرار گرفت (شکل 2). همانگونه که در شکل قابل مشاهده می‍باشد محصول PCR مناسب در ناحیه pb 1500 نمایان شده که بیانگر خلوص DNA مورد استفاده جهت تعیین توالی می باشد.

 

 

شکل 2- تصویر ژل الکتروفورز محصول PCR سویه SL-7

 

پس از مشخص شدن توالی ژن S rDNA16سویه SL-7، آنرا در برنامه کامپیوتری بلاست قرار داده و سپس با استفاده از سایت NCBI باکتری مورد نظر شناسایی شد. براساس نتایج حاصل از بلاست این سویه دارای بیش از 99 درصد مشابهت با سویه های متعلق بهHalobacillus halophilus  می باشد. بعد از تعیین توالی ژن S rDNA16، این ژن در بانک ژنی با شماره دسترسی KX507262 ثبت شد. تجزیه و تحلیل­های فیلوژنیک تائید کرد که سویه­ی مورد نظر به جنسHalobacillus  تعلق دارد و علاوه بر این احتمالا می تواند به عنوان سویه­ی از Halobacillus halophilus طبقه بندی شود.


 Halobacillus litoralis DSM 10405 (X94558)

 Halobacillus profundi DSM 18394 (AB189298)

 Halobacillus Karajensis DSM 14948 (AJ486874)

 Halobacillus mangrovi MS10 (DQ888316)

 Halobacillus faecis NBRC 103569 (AB682133)

 Halobacillus trueperi DSM 10404 (AJ310149)

 Halobacillus locisalis DSM 16468 (AY190534)

 Halobacillus salinus DSM 18897 (AB307753)

 Halobacillus naozhouensis DSM 21183 (EU925615)

 Halobacillus campisalis DSM 17110 (AY881246)

 Halobacillus alkaliphilus DSM 18525 (AM295006)

 Halobacillus halophilus DSM 2266 (HG781839)

 Strain SL-7 (KX507262)

 Salimicrobium album DSM 20748 (AB681752)

 Thalassobacillus pellis DSM 22784 (FN690978)

 Virgibacillus marismortui DSM 12325 (AJ009793)

 Gracilibacillus boraciitolerans DSM 17256 (AB197126)

 Oceanobacillus picturae DSM 14867 (AJ315060)

94

98

100

95

91

98

84

87

77

69

79

68

66

87

74

0.02

شکل 3- درخت فیلوژنی سویه­ی SL-7 و دیگر اعضای جنس Halobacillusبر اساس ژن تکتیریافته­ی S rDNA16. شماره دسترسی سویه های ثبت شده در پرانتز آورده شده است.

 


در درخت فیلوژنی که بر اساس آنالیزهای توالی ژن
S rDNA16 به روش neighbor-joining بدست آمده است، موقعیت سویه­ی SL-7 در بین گونه­های جنس Halobacillus  آمده است (شکل 3).

تاثیر پارامترهای مختلف بر روی زی­تبدیلی ال- تیروزین به ال- دوپا تحت استراتژی سلول در حال استراحت: به منظور بهینه سازی پارامترهای موثر برروی زی­تبدیلی ال- تیروزین به ال-دوپا در باکتریsp. SL-7 Halobacillus، اثرات چندین پارامتر شامل غلظت اولیه ال- تیروزین، غلظت توده سلولی (بر حسب وزن خشک سلول)، غلظت یون مس و اثرات منابع کربن و ازت مختلف در محیط بافر نمکی فسفات تحت شرایط سلول در حال استراحت، بوسیله روش تک فاکتوری مورد بررسی قرار گرفت (رجوع شود به بخش مواد و روشها). در تمامی موارد ال-دوپای تشکیل شده در مخلوط واکنش زی­تبدیلی پس از گذشت 24 ساعت گرماگذاری مورد سنجش قرار گرفته است (شکل 4 قسمت های الف تا د). همانگونه که در شکل مشاهده می شود، بیشترین میزان تولید ال-دوپا در غلظت 5/1 گرم در لیتر ال- تیروزین، غلظت 5/7 گرم در لیتر توده سلولی، غلظت 03/0 گرم در لیتر یون مس مشاهده شد. از بین منابع کربنی و ازتی استفاده شده بیشترین میزان تولید ال- دوپا در حضور پپتون مشاهده شد.

 

 

شکل 4- اثرات پارامترهای مختلف بر روی تولید ال-دوپا از ال-تیروزین در باکتریsp. SL-7 Halobacillus در محیط بافر نمکی فسفات تحت شرایط سلول­های در حال استراحت. نتایج ارائه شده میانگین سه بار آزمایش بوده و بار1± معرف انحراف معیار است.

 

در ادامه و با هدف بهبود واکنش زی­تبدیلی ال- تیروزین به ال- دوپا، اثرات دوره ی گرماگذاری تحت شرایط بهینه شده تک عاملی بدست آمده در مخلوط واکنش زی­تبدیلی مورد ارزیابی قرار گرفت (شکل 5). براساس نتایج بدست آمده، تحت شرایط بهینه شده بالا، 75/0گرم در لیتر ال- دوپا از 5/1 گرم در لیتر ال- تیروزین پس از 36 ساعت واکنش زی­تبدیلی تولید شده است. راندمان مولی تولید ال- دوپا از ال- تیروزین در فرآیند فوق 2/46 درصد بوده است.

 

 

شکل 5- زی تبدیلی ال-تیروزین به ال-دوپا بوسیله سلولهای  در حال استراحت sp. SL-7 Halobacillus تحت شرایط بهینه شده توسط روش تک فاکتوری. نتایج ارائه شده میانگین سه بار آزمایش و بار1± معرف انحراف معیار است.

 

 

در نهایت ال- دوپای تولید شده در مخلوط واکنش های زی­تبدیلی، پس از استخراج  و تخلیص از طریق کروماتوگرافی لایه نازک، مورد آنالیز طیف سنجی تبدیل فوریه مادون قرمز (FTIR) قرار گرفت. همانگونه که در شکل (6) مشاهده می شود، با بررسی نواحی جذبی گروه­های عاملی ال- دوپای سنتزی در واکنش زی­تبدیلی و مقایسه آن با طیف­های استاندارد می توان پی برد که این اعداد به خوبی با جذب گروه­های عاملی متشابه در ال- دوپا استاندارد مطابقت دارد.

بحث

ال‌- دوپا یکی از مشتقات آمینواسیدهاست که بیشترین پتانسیل دارویی در مقابله با بیماری پارکینسون را دارا می باشد. یکی از دلایل بیماری پارکینسون پایین آمدن سطح دوپامین می‌باشد. بااین‌حال استفاده مستقیم از دوپامین مفید نبوده چراکه دوپامین قادر به عبور از سد خونی- مغزی نمی‌باشد اما ال‌دوپا به‌عنوان پیش ساز دوپامین می‌تواند از این سد عبور کند و به دوپامین تبدیل شود و به‌این‌ترتیب به بهبود بیماری پارکینسون کمک کند (16). چندین روش برای تولید ال‌دوپا وجود دارد، یکی از این روش­ها سنتز شیمیایی ست. سنتز شیمیایی ال‌دوپا شامل استفاده از مواد شیمیایی سمی و کاتالیزگرهای گران قیمت و تولید تحت شرایط سخت از نظر دما و pH می‌باشد که حاصل آن تولید مخلوط راسمیک L و D است که غیرفعال می‌باشند و جداسازی انانتیومرهای تولیدی به‌صورت ال- دوپای خالص بسیار سخت و زمان بر بوده که همین امر هزینه‌های پیش‌بینی‌شده را دو برابر می‌کند (13). این در حال است که در تولید میکروبی آن، فقط یکی از ایزومرهای موردنظر به‌صورت خالص تولید می‌شود. این امر می­تواند از به وجود آمدن مواد سمی یا مخلوط راسمیک جلوگیری کند و نتیجه بهتری را از دیدگاه خلوص ماده در برداشته باشد. روش دیگری که برای تولید ال- دوپا استفاده می شود شامل استخراج مستقیم از منابع گیاهی از جمله بذرها و غلاف باقلای سبز (Vicia faba) و لوبیای مخملی( Mucuna pruriens) است که علیرغم اینکه فرآورده حاصل در گروه محصولات طبیعی طبقه بندی می شود اما با توجه به کاربردهای گسترده ال- دوپا و افزایش روزافزون مصرف فرآورده های طبیعی و از آنجایی که منابع گیاهی محدود بوده و به تنهایی قادر به تامین بازارهای جهانی نیستند، بنابراین  در دهه های اخیر تلاش های گسترده ای جهت دستیابی به انانتیومرهای خالص ال- دوپا از ال- تیروزین از طریق های فرآیندهای زی تبدیلی صورت گرفته است (14 و 18).

 

 

شکل 6- طیف­های FTIR  گرفته شده از ال- دوپای سنتزی و ال- دوپای استاندارد

 

Rani و همکاران (13) از گیاه Portulaca grandiflora در تبدیل زیستی ال- تیروزین به ال- ‌دوپا استفاده کردند و نتایج نشان داد که ماکزیمم تولید ال- دوپا (8/48 میلی گرم در لیتر) بعد از یک ساعت واکنش زی­تبدیلی در محیط کشت عاری از ویتامین، اسیدآمینه و عناصر کم‌مصرف حاصل شد. استفاده از دو ماده 2 و 4 دی کلروفنوکسی استیک اسید (در غلظت 1/0 میلی گرم در لیتر) و بنزیل آمینو پورین (در غلظت 5/1 میلی گرم در لیتر) و هنگامی‌که غلظت سولفات مس تا 95/0 میلی‌گرم در لیتر افزایش یافت، نرخ زی­تبدیلی دو برابر شد. Surwase وJadhav  با بررسی تولید ال‌- دوپا از ال- تیروزین در سویهJPJ  Bacillus sp.  گزارش دادند که با استفاده از 5/0 گرم در لیتر ال- تیروزین موفق به تولید 497/0 گرم در لیتر ال- ‌دوپا با راندمان مولی بیش از 99 درصد تحت شرایط بهینه شده شدند (16).Raval  و همکاران (14) نیز بر روی تولید ال- ‌دوپا از ال- تیروزین به‌وسیله آنزیم تیروزیناز، استخراجی از سویه قارچی Penicillium jensenii، کارکردند و به نتایج مشابهی دست یافتند. در مطالعه صورت گرفته توسطSurwase و همکاران (17)، زی تبدیلی ال- تیروزین به ال- دوپا را توسط سویه باکتری Brevundimonas sp. SGJ مورد بررسی قرار دادند که براساس نتایج بدست آمده، تحت شرایط بهینه شده واکنش زی­تبدیلی (غلظت ال- تیروزین 4 گرم در لیتر، غلظت توده سلول 2 گرم در لیتر، غلظت یون مس 04/0 گرم در لیتر، غلظت اسید آسکوربیک 02/0 گرم در لیتر و pH برابر 8) بیش از 8/3 گرم در لیتر ال- دوپا با راندمان مولی بیش از 95 درصد پس از 18 ساعت واکنش بدست آمد. در مطالعات مشابه صورت گرفته، تولید زیستی ال- دوپا از ال- تیروزین در سویه های قارچی Aspergillus oryzae IAM2625 (9) و Aspergillus niger (4) گزارش شده که براساس نتایج بدست آمده بیشترین میزان ال- دوپای تولید شده به ترتیب 88/0 و 36/0 گرم در لیتر بدست آمده است. اگرچه گزارشات متعددی در ارتباط با زی­تبدیلی ال- تیروزین به ال- دوپا در سویه های متعدد قارچی و باکتریایی صورت گرفته اما با این حال، تا به امروز پتانسیل باکتری های نمک دوست نسبی در زی­تبدیلی ال- تیروزین به ال- دوپا بررسی نشده است. میکرواورگانیسم­های نمک دوست از نظر فیلوژنیک گروه متنوعی از باکتریها هستند که از لحاظ سازگاری با درصدهای پایین نمک ها می باشند، اما این توانایی را دارند که تغییرات سریع در جهت تطبیق با غلظت های بالای نمک داشته باشند (20). از آنجا که میکرواورگانیسم های نمک دوست بطور طبیعی به غلظت­های بالای آنیونی و کاتیونی برای رشد نیاز دارند و دارای تحمل پذیری بالا نسبت به فلزات سمی، اکسی آنیونهای سمی و همچنین قابلیت آنزیمی بالایی دارند بنابراین می توانند گزینه مناسبی برای مطالعات زی­تبدیلی باشند. هدف از مطالعه اخیر جداسازی و شناسایی باکتریهای نمک دوست با پتانسیل تبدیل کنندگی ال- تیروزین به ال- دوپا و بررسی امکان استفاده از این باکتری­ها به­عنوان زیست­کاتالیزگر برای تهیه متابولیت باارزش ال- دوپا بود. در این راستا، در طی یک برنامه غربالگری وسیع با هدف جداسازی انواع سویه­های باکتری نمک دوست نسبی با قایلیت تبدیل کنندگی ال- تیروزین، 40 سویه باکتری از نمونه­های آب­های شور جمع آوری شده از مناطق مختلف ایران جدا شد. پتانسیل سویه­های مذکور برای مصرف ال- تیروزین به­عنوان تنها منبع کربن و ازت مورد بررسی قرار گرفت. براساس نتایج بدست آمده سلول­های رویشی سویه باکتری SL-7 (جدا شده از یک نمونه آب جمع آوری شده از دریاچه حوض سلطان قم)، به­عنوان سویه برتر در تولید ال-دوپا مورد شناسایی فنوتیپی و فیلوژنتیکی قرار گرفت. سویه SL-7 دارای مشابهت بیش از 99 درصدی با گونه های ثبت شده Halobacillus halophilus بود. در ادامه این تحقیق با هدف افزایش راندمان واکنش زی­تبدیلی و جلوگیری از تجزیه بیشتر متابولیت­های تولیدی (ال-دوپا) میزان ال- دوپای تولید شده تحت شرایط سلول­های در حال استراحت در سویه مذکور سنجش شد. محققان زیادی از این استراتژی برای بهبود فرآیند­های زی­تبدیلی استفاده نموده اند (2 و 6). مزایای استفاده از استراتژی سلول­های در حال استراحت عبارت است از: جلوگیری از تکثیر بیومس سلولی، جداسازی آسانتر محصول تولیدی، انجام فرآیند زی­تبدیلی تحت شرایط غیراستریل، کاهش زمان زی­تبدیلی و در نتیجه افزایش راندمان و تنطیم بیومس سلولی ورودی. با توجه به مزایای استفاده از سلول­های در حال استراحت، مطالعات زی­تبدیلی ال- تیروزین به ال- دوپا تحت سلول­های در حال استراحت Halobacillus sp. SL-7 بوسیله روش بهینه سازی تک عاملی بررسی شد (شکل 4). آنالیز نتایج حاصل از تاثیر فاکتورهای مختلف بر روی تولید ال- دوپا از طریق بهینه سازی تک فاکتوری بصورت زیر خلاصه شده است: یک افزایش تدریجی در تولید ال‌دوپا در غلظت  5/2 تا 5/7 ‌گرم در ‌لیتر بیومس سلول، بعد از 24 ساعت انکوباسیون در غلظت 5/1 گرم در لیتر ال-تیروزین تحت شرایط دمایی 30 درجه سانتی گراد، pH برابر 7 و دور شیکر rpm 150وجود دارد. حداکثر تولید ال‌دوپا 31/0 گرم در ‌لیتر بود که در غلظت 5/7 ‌گرم در ‌لیتر بیومس سلول به دست آمد. ازاین‌رو در مطالعات اخیر برای تولید به‌صرفه و اقتصادی ال‌دوپا از غلظت 5/7 ‌گرم در ‌لیتر بیومس سلول استفاده شد. بااین‌حال در غلظت­های بالاتر از 5/7 گرم در لیتر به دلیل احتمالا کاهش در انتقال اکسیژن و یا تجزیه سریع تر سوبسترای اولیه، راندمان تولید ال- دوپا کاهش یافته است (7). تأثیر غلظت­های متفاوت یون مس در تولید ال‌دوپا در محیط بافرنمکی فسفات حاوی 5/1 گرم در لیتر ال-تیروزین، غلظت بهینه 5/7 گرم در لیتر بیومس سلول، دمای 30 درجه سانتی گراد، pH برابر 7 و دور شیکر rpm 150 به مدت 24 ساعت موردمطالعه قرار گرفت. در غلظت‌های پایین میزان تولید ال‌دوپا کم است و در غلظت‌های بالا مقدار ال- دوپا افزایش پیدا می‌کند و بهترین غلظت یون مس برای تولید بهینه ال- ‌دوپا در غلظت 03/0گرم در لیتر بود که نرخ تولید ال- دوپا برابر  51/0 گرم در لیتر است. در ارتباط با تاثیر بالای یون مس می توان این فرضیه را مطرح نمود که یون مس به­عنوان کوفاکتور باعث افزایش در فعالیت آنزیم­های مسئول زی­تبدیلی ال- تیروزین (آنزیم تیروزیناز)  شده است (4 و 14). با توجه به اینکه انتخاب منابع کربن و ازت مناسب به­عنوان سوبستراهای کمکی می تواند در زی­تبدیلی ال- تیروزین به ال- دوپا مهم باشد، اثر منابع کربن و ازت مختلف بر روی نرخ تولید ال- دوپا تحت شرایط بهینه شده بررسی شد. براساس نتایج بدست آمده حداکثر مقدار ال‌دوپا (65/0 ‌گرم در ‌لیتر) در حضور پپتون بدست آمد. در ادامه و با هدف بهبود زی تبدیلی ال- تیروزین به ال- دوپا، اثرات دوره­ی گرماگذاری تحت شرایط بهینه شده در مخلوط واکنش زی تبدیلی مورد ارزیابی قرار گرفت (شکل 5). یک افزایش تدریجی در روند تولید ال‌دوپا از شروع واکنش زی تبدیلی تا ساعت 36 ام وجود دارد که حداکثر تولید ال- ‌دوپا (75/0 گرم در لیتر) در ساعت 36 ام مشاهده شد اما بعد از ساعت 36 ام نرخ تبدیل کاهش می‌یابد که این کاهش در تولید ال- ‌دوپا همراه با افزایش زمان گرماگذاری ممکن است ناشی از رشد سریع باکتری و تجزیه بیشتر محصول ال- دوپای تشکیل شده در مخلوط واکنش زی­تبدیلی باشد. نتایج نشان داد که بهینه سازی تک عاملی ابزاری قدرتمند برای بهینه‌سازی و بهبود فرآیند تولید زیستی ال- ‌دوپا ادر سویه باکتریایی موردمطالعه است.

نتیجه­ گیری

اگرچه تا به امروز گزارش­هایی از کاربرد سویه­های متعدد باکتریایی و قارچی در زی­تبدیلی ال- تیروزین به ال- دوپا منتشر شده است، با این حال، مطالعه پیش رو، نخستین گزارش در مورد تبدیل زیستی ال- تیروزین به ال- دوپا بوسیله باکتری­های نمک دوست نسبی است. بنابراین باکتری بومی غربال گری شده Halobacillus sp. SL-7 را می توان به­عنوان یک زیست کاتالیزگر پاک در زی­تبدیلی ال- تیروزین به ال- دوپا معرفی کرد. استفاده عملی از باکتری یاد شده در مقیاس­های بالاتر (Scale up)، نیازمند انجام فرآیندهای بهینه سازی بیشتر و همچنین شناسایی، تعیین ویژگی­ آنزیمی و ساز و کار دخیل در زی­تبدیلی ال- تیروزین به ال- دوپا توسط سویه­ی باکتری مذکور است.

تشکر و قدردانی

این مقاله بخشی از پایان نامه کارشناسی ارشد بوده که با حمایت دانشگاه کردستان به انجام رسیده است. نویسندگان این مقاله از تمام کسانی که در اجرای این مطالعه همکاری نموده اند، کمال قدردانی و سپاسگزاری را دارد. 

1- آشنگرف، م و  نحوی، ا. 1393. تولید زیستی وانیلین طبیعی از سوبستراهای فنیل پروپانوئیدی بوسیله زیست تبدیلی با استفاده از سلول های میکروبی. مجله پژوهش های سلولی و مولکولی (زیست شناسی ایران)، جلد 27، شماره 3، صفحات 316-334.

2- آشنگرف، م و نحوی، ا. 1393. استفاده از سلولهای در حال استراحت Halomonas salina HSL5 بعنوان زیست واکنشگر برای تولید بیولوژیک اسید وانیلیک. مجله پژوهش های سلولی و مولکولی (زیست شناسی ایران)، جلد 27، شماره 1، صفحات 1-13.

 

3. Ali, S. Shultz. J.L. and Qadeer, M.A. (2007) High performance microbiological transformation of L-tyrosine to L-dopa by Yarrowia lipolytica NRRL-143. BMC Biotechnology 7: 50.

4. Ali, S. and Haq, I. (2010) Production of 3, 4-dihydroxy L-phenylalanine by a newly isolated Aspergillus niger and parameter significance analysis by Plackett-Burman design. BMC Biotechnology 10: 86.

5. Ashengroph, M. Nahvi, I. Zarkesh-Esfahani, H. and Momenbeik, F. (2011) Candida galli strain PGO6: a novel isolated yeast strain capable of transformation of isoeugenol into vanillin and vanillic acid. Current Microbiology 62: 990–998.

6. Ashengroph, M. Nahvi, I. Zarkesh-Esfahani, H. and Momenbeik, F. (2012) Conversion of isoeugenol to vanillin by Psychrobacter sp. strain CSW4. Applied and Biochemistry and Biotechnology 166:1–12.

7. Ashengroph, M. (2017) A novel strain of Aureobasidium sp. TeO12 for theophylline production from caffeine. 3 Biotech 7: 176.

8. Fadl, A.A. Nguyen, A.V. and Khan, M.I. (1995) Analysis of Salmonella enteritidis isolates by arbitrarily primed PCR. Journal of Clinical Microbiology 33: 987-989.

9. Haneda, K. Watanabe, S. and Takeda, I. (1971) Synthesis of 3, 4-dihydroxyphenyl L-alanine from L-tyrosine by microorganisms. Applied Microbiology 22: 721-722.

10. Margesin, R. and Schinner, F. (2001) Potential of halotolerant and halophilic microorganisms for biotechnology. Extremophiles 5: 73–83.

11. Nieto, J.J. Fernandez-Castillo, R. Marquez, M.C. Ventosa, A. Quesada, E. and Ruiz-Berraquero, F. (1989) Survey of metal tolerance in moderately halophilic eubacteria. Applied and Environmental Microbiology 55: 2385–2390. 

12. Raddadi, N. Cherif, A. Daffonchio, D. Neifar, M. and Fava, F. (2015) Biotechnological applications of extremophiles, extremozymes and extremolytes. Applied Microbiology and Biotechnology 99: 7907–7913

13. Rani, N. Joy, B. and Abraham, T.E. (2007) Cell suspension cultures of Portulaca grandiflora. as potent catalysts for biotransformation of L-tyrosine into L-DOPA, an anti-Parkinson's drug. Pharmaceutical Biology 45 (1): 48–53.

14. Raval, K.M. Vaswani, P.S. and Majumder, D.R. (2012) Biotransformation of a single amino- acid L-tyrosine into a bioactive molecule L-DoPA. International Journal of Scientific and Research Publications 2 (5): 1-9.

15. Sukumaram, C.P. Singh, D.V. Khedkar, P.D. and Mahadevan, P.R. (1979) An Actinomycete producing L-3,4-dihydroxyphenylalanine from L-tyrosine. Journal of Bioscience 1: 236-239.

16. Surwase, S.N. and Jadhav, J.P. (2010) Bioconversion of L-tyrosine to L-DOPA by a novel bacterium Bacillus SP. JPJ. Amio acid 41: 495-506.

17. Surwase, S.N. Patil, S.A. Jadhav, S.B. and Jadhav, J.P. (2012) Optimization of L-DOPA production by Brevundimonas sp. SGJ using response surface methodology. Microbial Biotechnology 5: 731-737.

18. Sushama, A.P. Onkar, A.A. Shripad, N.S. and Jyoti, P.J. (2013) Biological sources of L-DOPA: An alternative approach. Advances in Parkinson’s Disease 81-87.

19. Tamura, K. Stecher, G. Peterson, D. Filipski, A. and Kumar, S. (2013) MEGA6: molecular evolutionary genetics analysis version 6.0. Molecular Biology and Evolution 30: 2725–2729.

20. Ventosa, A. Nieto, J.J. and Oren, A. (1998) Biology of moderately halophilic aerobic bacteria. Microbiology and Molecular Biology Review 62: 504-544.

21. Weisburg, W.G. Barns, S.M. Pelletier, D.A. and Lane, D.J. (1991) 16S ribosomal DNA amplification for phylogenetic study. Journal of Bacteriology 173(2): 697–703.

22. Yoshida, H. Tanaka,Y. and Nakayama, K. (1973) Production of 3,4-dihydroxyphenyl-L-alanine (L-DOPA) and its derivatives by Vibrio tyrosinaticus. Agricultural and Biological Chemistry 37: 2121-2126.

23. Yoshida, H. Tanaka, Y. and Nakayama, K. (1974) Production of 3,4-dihydroxyphenyl-L-alanine (L-DOPA) by Pseudomonas melanogenum. Agricultural and Biological Chemistry 37: 2121-21.