نوع مقاله : مقاله پژوهشی

نویسندگان

1 هیات علمی دانشگاه ارومیه

2 گروه علوم باغبانی، دانشکده کشاورزی، دانشگاه ارومیه، ایران

3 مرکز تحقیقات بیوتکنولوژی دارویی زنجان، دانشکده داروسازی، دانشگاه علوم پزشکی زنجان، ایران

چکیده

گیاه بذرالبنج مشبک Hyoscyamus reticulatus L.)) منبع غنی از آلکالوئیدهای تروپانی هیوسیامین و اسکوپولامین می باشد. در پژوهش حاضر، ریشه‌های موئین از ریزنمونه‌های کوتیلدون دو هفته‌ای، گیاه بذرالنج مشبک با استفاده از سویه A7 آگروباکتریوم رایزوژنز تهیه شدند. اثر غلظت‌های مختلف (صفر، 5، 10 و20 میلی‌گرم بر لیتر) عصاره قارچ فوزاریوم گرامینه‌روم در زمان‌های مختلف (24، 48 و 72 ساعت) بر میزان رشد، فعالیت آنزیم‌های آنتی اکسیدانی، میزان فنل کل، میزان آلکالوئیدهای تروپانی و میزان بیان ژن هیوسیامین-6- بتا هیدروکسیلاز(h6h) در ریشه‌های موئین بذرالبنج مشبک بررسی گردید. نتایج آنالیز داده‌ها نشان داد که میزان وزن تر و خشک تحت تاثیر غلظتهای بالای محرک عصاره قارچ فوزاریوم کاهش یافت. فعالیت آنزیم‌های آنتی‌اکسیدانی شامل کاتالاز، گایاکول پراکسیداز و آسکوربات پراکسیداز و همچنین میزان فنل کل در ریشه‌های موئین تیمار شده، در مقایسه با شاهد افزایش یافت. نتایج آنالیز GC نشان داد که در تیمار قارچ فوزاریوم بیشترین میزان هیوسیامین و آسکوپولامین (5/27 و 41/40 درصد به ترتیب) در غلظت‌های 5 و 10 میلی‌گرم برلیتر و زمان 48 ساعت بدست آمدند. نتایج آنالیز بیان RT-PCR نشان داد که بیشترین میزان بیان این ژن در تیمار عصاره قارچ فوزاریوم در غلظت 10 میلی‌گرم برلیتر در 48 ساعت مشاهده شد. براساس این نتایج چنین استنباط می‌شود که محرک‌ عصاره قارچ فوزاریوم گرامینه‌روم می‌تواند به عنوان محرک موثر جهت تولید متابولیت‌های ثانویه گیاهی از جمله آلکالوئیدهای تروپانی مورد استفاده قرار گیرد.

کلیدواژه‌ها

موضوعات

عنوان مقاله [English]

h6h gene transcript enhancement and production of tropane alkaloids in Hyoscyamus reticulatus L. hairy root cultures elicited by Fusarium graminearum extract

نویسندگان [English]

  • Kamal Rashidi Asl 2
  • ali sharafi 3

2 Department of Horticulture, Faculty of Agriculture, Urmia University, Iran.

3 Zanjan Pharmaceutical Biotechnology Research Center, Zanjan University of Medical Sciences, Zanjan, Iran

چکیده [English]

Hyoscyamus reticulatus L. is a main source of tropane alkaloids, hyoscyamine and scopolamine. In the present study, hairy roots were prepared from two-weekly cultures of cotyledon transformed by A7 strain of Agrobacterium rhizogenes. The effect of different concentrations of Fusarium graminearum extract (0, 5, 10 and 20 mg/L) at different exposure times (24, 48 and 72 hours) on growth rate, antioxidant enzymes activity, total phenol, tropane alkaloids contents and expression level of Hyoscyanamine-6-beta-hydroxylase (h6h) gene were investigated. Data analysis results showed that fresh and dry weight under influence of high concentrations of Fusarium fungus extract was reduced. The activity of antioxidant enzymes including catalase, guaiacol peroxidase and ascorbate peroxidase as well as total phenol content in treated hairy roots was enhanced compared to control. GC analysis showed that the highest levels of hyoscyamine and scopolamine (27.5 and 40.41% respectively) were found in 5 and 10 mg of elicitor at 48 h exposure time. RT-PCR expression analysis results revealed that the highest expression of this gene was obtained in Fusarium fungus extract (10 mg/l) at 48 h exposure time. Based on these results, it is concluded that the Fusarium graminearum elicitor can be used as an effective stimulant for the production of secondary metabolites, including tropane alkaloids.

کلیدواژه‌ها [English]

  • Antioxidant enzymes
  • Fusarium graminearum
  • Gene expression
  • Hyoscyanamine-6-beta-hydroxylase
  • Scopolamine

افزایش بیان ژن h6h و تولید تروپان آلکالوئیدها در کشت ریشه­های مویین گیاه دارویی بذرالبنج مشبک تهییج شده با عصاره قارچ فوزاریوم گرامینه­روم

کمال رشیدی­اصل1، بهمن حسینی1، علی شرفی2 و حامد محمد پور2

1 ایران، ارومیه، دانشگاه ارومیه، دانشکده کشاورزی، گروه علوم باغبانی

2 ایران، زنجان، دانشگاه علوم پزشکی زنجان، دانشکده داروسازی، مرکز تحقیقات بیوتکنولوژی دارویی

تاریخ دریافت:21/9/96                 تاریخ پذیرش: 10/4/97

چکیده

گیاه بذرالبنج مشبک Hyoscyamus reticulatus L.)) منبع غنی از آلکالوئیدهای تروپانی هیوسیامین و اسکوپولامین می باشد. در پژوهش حاضر، ریشه­های مویین از ریزنمونه­های کوتیلدون دو هفته­ای، گیاه بذرالنج مشبک با استفاده از سویه A7 آگروباکتریوم رایزوژنز تهیه شد. اثر غلظتهای مختلف (صفر، 5، 10 و20 میلی­گرم بر لیتر) عصاره قارچ فوزاریوم گرامینه‌روم در زمانهای مختلف (24، 48 و 72 ساعت) بر میزان رشد، فعالیت آنزیمهای آنتی اکسیدانی، میزان فنول کل، میزان آلکالوئیدهای تروپانی و میزان بیان ژن هیوسیامین-6- بتا هیدروکسیلاز(h6h)  در ریشه­های مویین بذرالبنج مشبک بررسی گردید. نتایج آنالیز داده­ها نشان داد که میزان وزن تر و خشک تحت تأثیر غلظتهای بالای محرک عصاره قارچ فوزاریوم کاهش یافت. فعالیت آنزیمهای آنتی­اکسیدانی شامل کاتالاز، گایاکول پراکسیداز و آسکوربات پراکسیداز و همچنین میزان فنول کل در ریشه­های مویین تیمار شده، در مقایسه با شاهد افزایش یافت. نتایج آنالیز GC نشان داد که در تیمار قارچ فوزاریوم بیشترین میزان هیوسیامین و آسکوپولامین (5/27 و 41/40 درصد به ترتیب) در غلظتهای 5 و 10 میلی­گرم برلیتر و زمان 48 ساعت به دست آمد. نتایج آنالیز بیان RT-PCR نشان داد که بیشترین میزان بیان این ژن در تیمار عصاره قارچ فوزاریوم در غلظت 10 میلی‌گرم برلیتر در 48 ساعت مشاهده شد. براساس این نتایج چنین استنباط می­شود که محرک‌ عصاره قارچ فوزاریوم گرامینه­روم می­تواند به عنوان محرک مؤثر جهت تولید متابولیتهای ثانویه گیاهی از جمله آلکالوئیدهای تروپانی مورد استفاده قرار گیرد.

واژه های کلیدی: آنزیمهای آنتی اکسیدانی، بیان ژن، آسکوپولامین، فوزاریوم گرامینه­روم، هیوسیامین-6- بتا هیدروکسیلاز

* نویسنده مسئول، تلفن: 044132779558 ، پست الکترونیکی:‌ b.hosseini@urmia.ac.ir

مقدمه

 

بذرالبنج، گیاهی یک ساله، دوساله و یا چندساله می‌باشد. رشد اولیه گونه‌‌های مختلف بذرالبنج بسیار کند است. ﻫﻴﻮﺳﻴﺎﻣﻴﻦ و اﺳﻜﻮﭘﻮﻻﻣﻴﻦ، از آﻟﻜﺎﻟﻮﺋﻴﺪﻫﺎی ﺗﺮوﭘﺎﻧﻲ ﺑﻮده ﻛـﻪ در ﺑﺬراﻟﺒﻨﺞ ﺗﻮﻟﻴﺪ ﻣﻲ‌ﺷﻮﻧﺪ. هیوسیامین و اسکوپولامین به عنوان داروهای مهارکننده اعصاب پاراسمپاتیک می‌باشند (39) بیوسنتز تروپان آلکالوئیدها مانند هیوسیامین و آسکوپولامین با تشکیل یون  -Nمتیل پیرولینیوم از آمینواسیدهای اورنیتینو آرژنین آغاز می­شود (28). در مسیر بیوسنتز تروپان آلکالوئیدهای یاد شده، آنزیم­های بسیاری نقش دارند (21 و 29)، در آخرین مرحلة مسیر بیوسنتزی تروپان آلکالوئیدها، هیوسیامین توسط آنزیم هیوسیامین 6-β هیدروکسیلاز (H6H)، هیوسیامین به آسکوپولامین (هیوسین)، کاتالیز می­شود. ﺳﻨﺘﺰ ﺷﻴﻤﻴﺎﻳﻲ و ﻣﺼﻨﻮﻋﻲ اﻳﻦ ﺗﺮﻛﻴﺒﺎت، ﭘﻴﭽﻴﺪه و ﻣﻴﺰان ﺗﻮﻟﻴﺪ آﻧﻬﺎ ﺑه طﻮر ﻃﺒﻴﻌﻲ ﻛﻢ ﻣﻲﺑﺎﺷﺪ. ﺑﻨﺎﺑﺮاﻳﻦ اﺻﻼح ﻛﻨﻨﺪﮔﺎن ﮔﻴﺎﻫﻲ ﺳﻌﻲ در اﺳﺘﻔﺎده از روﺷﻬﺎی ﻧﻮﻳﻦ فنآوری زیستی ﺟﻬﺖ اﻓﺰاﻳﺶ ﻣﻴﺰان ﺗﻮﻟﻴﺪ آﻟﻜﺎﻟﻮﺋﻴﺪﻫﺎ و ﻫﻤﭽﻨﻴﻦ ﻛﺎﻫﺶ ﻫﺰﻳﻨﻪﻫﺎی ﺗﻮﻟﻴﺪ اﻳﻦ ﻣﺘﺎﺑﻮلیتها دارﻧﺪ. در طی سالهای اخیر، کشت ریشه­های مویین توسعه یافته است و منبع بالقوه و با ارزشی برای تولید متابولیتهای ثانویه می‌باشند (8 و 33). محرکهای قارچی برای ارتقای سنتز ترکیبات مهم تجاری از محیط کشت سلولهای گیاهی به صورت وسیع‌تری مورد مطالعه قرار گرفته اند .قارچهایی که معمولاً باعث پاسخهای فوق حساسیتی در سلولهای گیاهی می‌شوند، باعث فعال شدن مسیرهای دفاعی گیاهی شده و منجر به افزایش تولید فیتوآلکسین می‌شود (9). در مطالعه‌ای دیگر، افزایش بیوسنتز لیگنین در کشت سوسپانسیون سلولی Linum album توسط عصاره‌های قارچی نشان داد که عصاره قارچ Fusarium graminearum موجب بالاترین تولید میزان پودوفیلوتوکسین در کشت سلولی کتان سفید (Linum album) شد (5). با توجه به اینکه تولید سریع و انبوه متابولیتهای ثانویه از طریق روشهای شیمیایی عمدتاً پرهزینه، مشکل و یا غیرممکن می­باشد و نیز به­دلیل اهمیت اقتصادی این متابولیتها و تولید اندک آنها در گیاهان دارویی، راهکارهایی مثل کشت ریشه­های مویین (32)، استفاده از محرکهای زیستی و غیرزیستی می­تواند تولید این متابولیتها را بهبود ببخشد. به همین منظور این مطالعه به منظور بررسی اثر عصاره قارچ فوزاریوم گرامینه­روم بر روی خصوصیات رشدی، فیتوشیمیایی و بیان ژن h6h انجام گردید.

مواد و روشها

آزمایشهای مربوط به کشت گیاه بذرالبنج مشبک، آنالیز خصوصیات رشدی و بیوشیمیایی در آزمایشگاه گروه علوم باغبانی دانشگاه ارومیه و آنالیز فیتوشیمیایی آلکالوئیدهای تروپانی و همچنین تحقیقات مولکولی این پژوهش نیز در آزمایشگاه مرکز علوم تحقیقات زیست فناوری پردیس دانشگاه ارومیه در سال­های 1395 و 1396 انجام شد.

کشت گیاه بذرالبنج مشبک: بذرهای گیاه بذرالبنج مشبک از شرکت پاکان بذر اصفهان تهیه گردید. بعد از ضدعفونی با اتانول 70 درصد و هیپوکلریت سدیم، بذرها در داخل محیط کشت MS (25)، کشت شدند. به­منظور تلقیح ریزنمونه­های گیاهی، کوتیلدونها از گیاهچه­های مادری استریل جدا و به­مدت 3 دقیقه درون سوسپانسیون باکتریاییAgrobacterium rihzogenes  سویه A7 غوطه­ور شدند. ریزنمونه­های تلقیح شده به محیط کشت MS جامد (محیط همکشتی) منتقل و به­مدت 48 ساعت، داخل انکوباتور با دمای 25 درجه سانتی گراد و در شرایط تاریکی نگهداری شدند.

کشت ریشه­های مویین با محرک عصاره قارچ فوزاریوم گرامینه­روم: میسیلیومهای رشد کرده قارچ فوزاریوم­گرامینه­روم در محیط مایع آماده و عصاره سلولی قارچ، از گروه بیماری­شناسی گیاهی دانشگاه ارومیه تهیه گردید. ابتدا میسیلیومها در ازت مایع و با هاون خرد شده و به شکل پودر تهیه گردید .پودر حاصل در آب مقطر استریل حل و به غلظت نهایی200  میلی­گرم در لیتر رسانده شد .سوسپانسیون قارچ با 14000 دور در دقیقه به مدت 12 دقیقه در 4 درجه سانتی گراد سانتریفیوژ گردید .در انتها مایع رویی برداشته و برای استریل کردن از  فیلتر 22 میکرونی استفاده گردید. از غلظتهای (صفر، 5، 10 و20 میلی­گرم بر لیتر) عصاره قارچ در زمانهای مختلف (24، 48 و 72 ساعت) استفاده گردید.

استخراج و آنالیز آلکالوئیدها: استخراج آلکالوئیدها به روش Kamada و همکاران (17) انجام شد. به منظورجداسازی و شناسایی آلکالوئیدهای تروپانی هیوسیامین و آسکوپولامین از دستگاه کروماتوگرافی گازی Helwentt-Packard ، مدلHP 7890A GC  و کروماتوگراف گازی متصل شده به طیف سنج جرمی Helwentt-Packard  ، مدل 5975C ، مجهز به ستون موئینه 5-HP به طول 30 متر و قطر 25/0 میلی­متر، با ضخامت لایه فاز ساکن 25/0 استفاده گردید. دمای محفظه تزریق 270 درجه سانتی­گراد، میزان تزریق 1 میکرو لیتر و انرژی یونیزاسیون 70 الکترون ولت بود. برنامه حرارتی در دامنه 280-60 درجه با سرعت 5 درجه بر دقیقه و دمای محفظه تزریق 270 درجه بود.

تأیید مولکولی تراریختی ریشه­های موئین: بدین­منظور، DNA ژنومی ریشه­های مویین و ریشه غیر تراریخت حاصل از جوانه­زنی بذرهای کشت شده به روش CTAB،استخراج شد (19). به منظور تأیید حضور ژن rolB آگروباکتریوم رایزوژنز در ریشه­های مویین بذرالبنج مشبک، واکنش زنجیره ای پلیمراز (PCR)انجام گردید و توالی آغازگرهای:

Forward Primer: 5' – ATGGATCCCAAATTGCTATTCCCCCACGA-3'

Reverse Primer: 5' – TTAGGCTTCTTTCATTCGGTTTACTGCAGC-3'

به منظور تکثیر قطعات bp 780 ژن rolB مورد استفاده قرار گرفتند.

اندازه گیری فعالیت آنزیمهای آنتی اکسیدانی: استخراج عصاره گیاهی جهت سنجش فعالیت آنزیمها: 5/0 گرم بافت گیاهی تازه توزین و به میزان پنج برابر وزن آن بافر استخراج شامل Tris-HCL 50 میلی مولار با 5.7pH: ، MgCl2 3 میلی­مولار و EDTA 1 میلی­مولار اضافه و بر روی یخ به مدت 20 دقیقه ساییده شد تا یک عصاره کاملاً همگن به دست آمد. هموژنات حاصل به مدت 20 دقیقه در دمای 4 درجه سانتی گراد با سرعت 5000 دور در دقیقه سانتریفیوژ گردید و محلول رویی حاصل به عنوان عصاره خام جهت اندازه گیری فعالیت آنزیمهای آنتی اکسیدانی شامل آنزیمهای کاتالاز، گایاکول پراکسیداز و آسکوربات پراکسیداز مورد استفاده قرار گرفت (31) .

اندازه گیری فعالیت آنزیم کاتالاز(CAT; EC 1.11.1.6) : محلولهای حاصل برای سنجش فعالیت آنزیم کاتالاز به شرح ذیل است: ابتدا بافر فسفات سدیم (NaH2PO4) 50 میلی­مولار با اسیدیته 7 تهیه و سپس به میزان 5/2 میلی­لیتر از آن بافر و 20 میکرولیتر آب اکسیژنه(H2O2) 3 درصد برای هر نمونه برداشته و این مواد با هم مخلوط و سپس 20 میکرولیتر عصاره آنزیمی به آن افزوده و تغییرات جذب در طول موج 240 نانومتر با استفاده از دستگاه اسپکتروفتومتر به مدت 1 دقیقه بررسی شد. محتوای فعالیت آنزیم بر حسب تغییرات واحد جذب در دقیقه به ازای هر میلی­گرم پروتئین محاسبه گردید (3).

اندازه گیری فعالیت آنزیم گایاکول پراکسیداز(GPX;EC 1.11.1.7) : فعالیت آنزیم گایاکول پراکسیداز با استفاده از گایاکول به عنوان سوبسترا و بر اساس روش Zhang و همکاران (40) اندازه گیری شد. مخلوط واکنش حاوی 25 میکرولیتر عصاره آنزیمی، 77/2 میکرولیتر بافر فسفات پتاسیم 50 میلی­مولار با اسیدیته 7، 100میکرولیتر آب اکسیژنه 1 درصد و 100 میکرولیتر گایاکول 4 درصد بود. افزایش جذب به دلیل اکسیداسیون گایاکول در طول موج 470 نانومتردر مدت 1 دقیقه اندازه گیری شد. سپس میزان فعالیت آنزیم بر حسب  تغییرات واحد جذب در دقیقه به ازای هر میلی­گرم پروتئین محاسبه گردید.

اندازه گیری فعالیت آنزیم آسکوربات پراکسیداز(APX;EC 1.11.1.11) : پس از آماده سازی عصاره­های پروتئینی، برای سنجش فعالیت سینتیکی آنزیم آسکوربات پراکسیداز معرفهای زیر مورد استفاده قرار گرفت: بافر فسفات سدیم 50 میلی­مولار با 7=pH  به میزان 2 میلی­لیتر، آب اکسیژنه (H2O2) 3 درصد به میزان 200 میکرولیتر و آسکوربات 50 میکرومولار 200 میکرولیتر. کلیه مواد و محلولها در حمام یخ با یکدیگر مخلوط شده و بلافاصله 100 میکرولیتر عصاره آنزیمی به آن اضافه شد. منحنی تغییرات جذب طی 1 دقیقه در طول موج 290 نانومتر خوانده شد. محتوای فعالیت آنزیم بر حسب تغییرات واحد جذب در دقیقه به ازای هر میلی­گرم پروتئین محاسبه گردید (40).

استخراج عصاره گیاهی جهت سنجش میزان فنول کل: این آزمایش براساس روش Hajimahdipour  و همکاران (13)، با کمی تغییر انجام گرفت. ابتدا 5/0 گرم از ریشه مویین تر داخل هاون سرد قرار داده شد. سپس 10 میلی لیتر متانول 80 درصد به آن اضافه و به طور کامل ساییده شد. سپس به مدت 15 دقیقه سانتریفیوژ در سرعت  10000 دور در دقیقه در دمای 4 درجه انجام گردید. بعد 50 میکرولیتر از عصاره با 1200میکرولیتر معرف فولین 10 درصد داخل لوله­های شیشه­ای تمیز ریخته و پس از 5 دقیقه انتظار، به آن 960 میکرولیتر کربنات سدیم 5/7 درصد اضافه و در آخر 180 میکرولیتر آب مقطر اضافه گردید. سپس لوله­های شیشه­ای به مدت 40-30 دقیقه در تاریکی قرار گرفت. در آخر در طول موج 760 نانومتر با اسپکتوفتومتر خوانده شد. از اسید گالیک برای رسم منحنی استاندارد استفاده شد و نهایتاً نتایج نیز بر اساس میلی­گرم اسید گالیک بر گرم وزن تر گزارش گردید.

آنالیز بیان ژنh6h  : ذخیره کردن توالی ژنها از پایگاههای اطلاعاتی و طراحی آغازگر: ژن h6h از مهم­ترین ژنهای درگیر در مسیر تولید تروپان آلکالوئیدها در گیاه بذرالبنج مشبک می­باشد. به منظور طراحی آغازگر برای این ژن ابتدا توالی، نواحی کدکننده ژن مذکور از بانک اطلاعاتی NCBI ذخیره شد. در این تحقیق از نرم افزارهای Fast PCR برای طراحی استفاده شد. توالی آغازگرهای ژن h6h و 18s rRNA مطابق جدول 1 می­باشد.

 

جدول1- مشخصات آغازگرهای مورد استفاده در تکنیک RT- PCR

ژن

14(5'→3')"> توالی

دمای اتصال

طول قطعه تکثیری(bp)

h6h

F: TGGCTACTTTTGTGTCGAACTGG

66

625

 

R: CTTGGGTCTGGGCATGGTG

 

 

18s rRNA

F: ATGATAACTCGACGGATCGC

60

165

 

R: CTTGGATGTGGTAGCCGTTT

 

 

 


استخراج RNA و سنتز cDNA: استخراج RNA از نمونه­های ریشه مویین خشک با استفاده از محلول استخراج RNAX-plus (سیناکلون، ایران) مطابق دستورالعمل پیشنهادی شرکت سازنده با کمی تغییرات انجام شد. برای سنتز cDNAاز RNAی استخراجی با استفاده از کیت First Strand cDNA Synthesis (سیناکلون، ایران) مطابق دستورالعمل پیشنهادی شرکت سازنده با کمی تغییرات انجام شد. قبل از شروع کار تمام وسایل استریل شده و به مدت 15 دقیقه زیر نور UV در داخل هود قرار گرفتند و تمام مراحل استخراج بر روی یخ انجام شد.

بررسی صحت ساختcDNA  و بهینه سازی دمای اتصال ژنهای مربوطه:  cDNAبا استفاده از آغازگرهای ژن 18s-rRNA در فرآیند PCR با حجم نهایی 20 میکرولیتر تکثیر شد. برای انجام واکنش PCR از 5/12 میکرولیترPCR Master Mix  (پیشگامان)، 5/0 میکرولیتر از هر کدام از آغازگرهای رفت و برگشت، 2 میکرولیتر cDNA استفاده شد. شرایط دمایی مورد استفاده برای ژن 18s-rRNA شامل واسرشت­سازی اولیه در دمای 94 درجه به مدت 5 دقیقه، 35 چرخه شامل دمای 94 درجه به مدت 30 ثانیه، 60 درجه به مدت 30 ثانیه، 72 درجه به مدت 40 ثانیه و بسط نهایی در 72 درجه به مدت 5 دقیقه می­باشد. محصولات PCR پس از افزودن 7 میکرولیتر لودینگ بافر بر روی ژل آگارز 1 درصد قرار گرفت و بعد از الکتروفورز 90 ولت برای 1 ساعت، عکس­برداری انجام گرفت. برای انجام واکنش PCR ژنh6h از 5/12 میکرولیترPCR Master Mix  (پیشگامان)، 5/0 میکرولیتر از هر کدام از آغازگرهای رفت و برگشت، 2 میکرولیتر cDNA رقیق شده (50 :1) و 5/4 میکرولیتر آب عاری از DNA استفاده شد. شرایط دمایی مورد استفاده برای ژن h6hشامل واسرشت سازی اولیه در دمای 94 درجه به مدت 5 دقیقه، 35 چرخه شامل دمای 94 درجه به مدت 1 دقیقه، 66 درجه به مدت 55/1 دقیقه، 72 درجه به مدت 40/1 دقیقه و بسط نهایی در 72 درجه به مدت 10 دقیقه می­باشد.

برای بررسی صحت تکثیر ژن h6h از واکنش کنترل منفی –RT و NTC استفاده شد.

واکنش کنترل منفی RT: این واکنش جهت تشخیص وجود آلودگی DNA در نمونه­های RNA استخراج شده ضروری است. در این واکنش تمام اجزای واکنش برای سنتز cDNA به جز آنزیم Reverse transcriptase مورد استفاده قرار می­گیرد. با توجه به عدم استفاده از آنزیم نباید در این نمونهcDNA  سنتز شود بنابراین در مرحله تکثیر ژن مورد مطالعه با استفاده از این cDNA نباید باندی مشاهده شود. وجود باند بیانگر وجود آلودگی DNA است.

واکنش کنترل منفی  (NTC): این واکنش برای تشخیص آلودگی در اجزای واکنش ضروری است. در این واکنش تمام اجزای واکنش به جز cDNA استفاده می­شود. فقط به جای استفاده از cDNA از آب عاری از نوکلئاز استفاده شد. بنابراین در مرحله تکثیر ژن مورد مطالعه هیچ باندی نباید مشاهده شود چون وجود باند نشانگر وجود آلودگی اجزای واکنش خواهد بود.

آنالیز داده ها و محاسبات آماری: آزمایشات مربوط به هر محرک به صورت فاکتوریل در قالب طرح پایه کاملاً تصادفی و با سه تکرار انجام گردید و داده­های حاصل از آزمایش با استفاده از نرم افزار SAS 9.1 مورد تجزیه تحلیل قرار گرفت. مقایسات میانگین توسط آزمون چند دامنه­ای دانکن انجام گردید و برای رسم نمودارها از نرم افزار Excel استفاده شد. همچنین برای آنالیز کردن نتایج RT-PCR از نرم افزار Pixcavator 6.0 استفاده شد.

نتایج

تعیین منحنی رشد ریشه­های مویین گیاه بذرالبنج مشبک: قبل از اعمال تیمار مورد نظر، وضعیت رشد 5/0 گرم ریشه مویین به مدت 5 هفته در محیط کشت MS پایه مورد بررسی قرار گرفت. نتایج نشان داد که بعد از کشت، وزن تر سلولها شروع به افزایش کرده که این روند افزایش تا هفته سوم به صورت لگاریتمی بود. بعد از این زمان سرعت افزایش وزن کاهش یافت و در هفته پنجم روند رشدی نامحسوس شد (شکل 1). در اواخر دوره لگاریتمی و در آستانه دوره ایستایی (روز 22-19ام) که در این زمان زیست توده ریشه مویین به حد مناسبی رسیده بود، به عنوان زمان القای محرکها انتخاب گردید.

 

شکل 1-  نرخ رشد ریشه های مویین گیاه بذرالبنج مشبک در محیط کشت MS مایع در دمای 25 درجه و سرعت شیکر  120  دور در دقیقه

تأثیر محرک عصاره قارچ فوزاریوم­گرامینه­روم بر رشد ریشه­های مویین بذرالبنج مشبک: نتایج تجزیه واریانس تأثیر غلظت و مدت زمان تیمار با عصاره قارچ فوزاریوم­گرامینه­روم بر رشد ریشه­های مویین بذرالبنج مشبک در جدول 2 نشان داده شده است. نتایج مقایسه میانگین داده­ها نشان داد که اثرات متقابل غلظت و مدت زمان تیمار با عصاره قارچ فوزاریوم­گرامینه­روم بر رشد ریشه­های مویین بذرالبنج مشبک در سطح احتمال 1و 5 درصد به ترتیب در وزن تر و خشک ریشه­های مویین تیمار شده معنی­دار گردید. بیشترین میزان وزن تر (16/14 گرم) در تیمار 5 میلی­گرم بر لیتر در مدت 72 ساعت تیمار و کمترین میزان وزن تر (57/5) در تیمار 20 میلی­گرم برلیتر به مدت 72 ساعت مشاهده گردید (شکل 2). بیشترین میزان وزن خشک (91/0 گرم) در تیمار شاهد و در مدت زمان تیمار 72 ساعت نگهداری در محیط مایع و کمترین میزان وزن خشک (48/0 گرم) در تیمار 20 میلی­گرم برلیتر در مدت زمان تیمار 72 ساعت به دست آمد (شکل 2).

 

جدول 2-  تجزیه واریانس تأثیر غلظت و مدت زمان تیمار با محرک عصاره قارچ فوزاریوم گرامینه روم  بر رشد ریشه های مویین بذرالبنج مشبک

میانگین مربعات

وزن خشک ( گرم )

وزن تر ( گرم(

درجه آزادی

منابع تغییرات

**132/0

**92/68

3

غلظت تیمار (a)

ns01/0

**03/18

2

زمان تیمار (b)

*018/

**41/8

6

اثر متقابل (a*b)

006/0

35/2

24

اشتباه آزمایشی

/11

40/14

 

ضریب تغییرات (درصد)

**  * و ns به ترتیب نشان دهنده اختلاف معنی­دار در سطح احتمال 1و 5 درصد و عدم وجود اختلاف معنی­دار می­باشد.

 

الف

ب

شکل 2- مقایسه میانگین اثرات متقابل غلظت و زمان تیمار با محرک عصاره قارچ فوزاریوم گرامینه­روم بر وزن تر (الف) و خشک (ب) ریشه­های مویین بذرالبنج مشبک. حروف مشابه نشان­دهنده عدم وجود اختلاف معنی­دار در سطح احتمال 5 آزمون دانکن می­باشد


تأثیر محرک عصاره قارچ فوزاریوم­گرامینه­روم بر میزان فعالیت آنزیمهای آنتی­اکسیدانی ریشه­های مویین بذرالبنج مشبک: نتایج تجزیه واریانس تأثیر غلظت و مدت زمان تیمار با عصاره قارچ فوزاریوم­گرامینه­روم بر میزان فعالیت­ آنزیمهای آنتی­اکسیدانی ریشه­های مویین بذرالبنج مشبک در جدول 3 نشان داده شده است. نتایج مقایسه میانگین نشان داد که اثرات متقابل غلظت و زمان تیمار عصاره قارچ فوزاریوم­گرامینه­روم فقط در آنزیمهای گایاکول­پراکسیداز در سطح احتمال 5 درصد معنی­دار بود. حداکثر میزان فعالیت آنزیم کاتالاز در غلظت 10 میلی­گرم عصاره قارچ، گایاکول­پراکسیداز در غلظت 10 میلی­گرم و آسکوربات­پراکسیداز در غلظت 5 میلی­گرم محرک و به ترتیب در مدت زمانهای 24، 72 و 24 ساعت زمان تیمار ثبت گردید. حداقل میزان فعالیت آنزیمهای کاتالاز، گایاکول­پراکسیداز و آسکوربات­پراکسیداز در تیمار شاهد مشاهده گردید (شکل 3).

 

جدول 3- تجزیه واریانس تأثیر غلظت و مدت زمان تیمار با محرک عصاره قارچ فوزاریوم گرامینه روم بر میزان فعالیت آنزیمهای آنتی اکسیدانی و میزان فنول کل ریشه های مویین بذرالبنج مشبک

 

میانگین مربعات

فنل کل

(mg GA/g FW)

APX

(mg pro/min)

GPX

(mg pro/min)

CAT

(mg pro/min)

درجه آزادی

منابع تغییرات

**88/9

**47/72

**84/259

**88/389

3

غلظت تیمار (a)

**98/16

ns64/9

**34/404

**87/762

2

زمان تیمار (b)

*18/1

ns93/1

*47/25

ns19/10

6

اثر متقابل (a*b)

41/0

04/3

57/9

54/8

24

اشتباه آزمایشی

35/10

60/13

82/7

31/7

 

ضریب تغییرات (درصد)

**  * و ns به ترتیب نشان دهنده اختلاف معنی دار در سطح احتمال 1و 5 درصد عدم وجود اختلاف معنی­دار می­باشد

 

ب

د

ج

الف

شکل 3- مقایسه میانگین اثر ساده غلظت (الف) و زمان(ب)  تیمار با محرک عصاره قارچ فوزاریوم گرامینه­روم بر میزان فعالیت آنزیم کاتالاز و مقایسه میانگین اثرات ساده و  متقابل غلظت و زمان تیمار با محرک عصاره قارچ فوزاریوم گرامینه­روم بر میزان فعالیت آنزیم گایاکول پراکسیداز (ج) و آسکوربات پراکسیداز (د) ریشه­های مویین بذرالبنج مشبک. حروف مشابه نشان­دهنده عدم وجود اختلاف معنی­دار در سطح احتمال 1 درصد آزمون دانکن می­باشد


تأثیر محرک عصاره قارچ فوزاریوم­گرامینه­روم بر میزان فنول کل ریشه­های مویین بذرالبنج مشبک: نتایج تجزیه واریانس تأثیر غلظت و مدت زمان تیمار با عصاره قارچ فوزاریوم­گرامینه­روم بر میزان فنول کل ریشه­های مویین بذرالبنج مشبک در جدول 3 نشان داده شده است. نتایج مقایسه میانگین نشان داد اثرات متقابل غلظت و زمان تیمار در سطح احتمال 5 درصد تأثیر معنی­داری بر میزان فنول کل ریشه­های مویین بذرالبنج نشان داد. طوری­که بیشترین میزان فنول کل در تیمار 10 میلی­گرم بر لیتر در مدت زمان 72 ساعت تیمار (82/8 میلی­گرم معادل اسید گالیک بر گرم وزن تر) و کمترین میزان فنول کل در تیمار شاهد در مدت زمان 24 ساعت (88/3  میلی­گرم معادل اسید گالیک بر گرم وزن تر) مشاهده شد (شکل4).

 

شکل4- مقایسه میانگین اثرات متقابل غلظت و زمان تیمار با محرک عصاره قارچ فوزاریوم گرامینه­روم بر میزان فنول کل ریشه­های مویین بذرالبنج مشبک. حروف مشابه نشان­دهنده عدم وجود اختلاف معنی­دار در سطح احتمال 5 درصد آزمون دانکن می­باشد

تأثیر محرک عصاره قارچ فوزاریوم‌گرامینه­روم بر تولید آلکالوئیدهای تروپانی در کشت ریشه­های مویین بذرالبنج مشبک: نتایج تجزیه واریانس تأثیر غلظت و مدت زمان تیمار با عصاره قارچ فوزاریوم‌گرامینه­روم بر تولید آلکالوئیدهای تروپانی هیوسیامین و آسکوپولامین در ریشه­های بذرالبنج مشبک در جدول 4 نشان داده شده است. نتایج مقایسه میانگین اثرات متقابل غلظت و زمان تیمار با محرک عصاره قارچ فوزاریوم‌گرامینه­روم نشان داد که سطوح مختلف غلظت و زمان در سطح احتمال 5 درصد به­طور معنی­داری تولید هیوسیامین و آسکوپولامین را تحت تأثیر قرار داد. بیشترین میزان هیوسیامین (5/27 درصد) در اثر تیمار ریشه­های مویین با غلظت 5 میلی­گرم برلیتر عصاره قارچ فوزاریوم‌گرامینه­روم در مدت زمان 48 ساعت مشاهده گردید که میزان تولید آن نسبت به ریشه­های مویین شاهد (44/9 درصد) در مدت زمان 48 ساعت، حدود 91/2 برابر افزایش نشان داد و حداقل میزان هیوسیامین (7/6 درصد) در شاهد در مدت زمان 24 ساعت مشاهده شد (جدول 4) و (شکل 5 الف). همچنین بیشترین میزان آسکوپولامین (41/40 درصد) در اثر تیمار ریشه­های مویین با غلظت 10 میلی­گرم برلیتر عصاره قارچ فوزاریوم‌گرامینه­روم در مدت زمان 48 ساعت مشاهده گردید که تولید آن 95/3 برابر نسبت به ریشه­های مویین شاهد (22/10 درصد) در زمان 48 ساعت تیمار افزایش یافت و کمترین میزان آسکوپولامین (10 درصد) در تیمار شاهد در مدت زمان 24 ساعت مشاهده گردید (جدول4) و (شکل 5 ب).

 

جدول 4- تجزیه واریانس تأثیر غلظت و مدت زمان تیمار با محرک عصاره قارچ فوزاریوم­گرامینه­روم بر تولید آلکالوئیدهای  تروپانی در ریشه­های مویین بذرالبنج مشبک

 

میانگین مربعات

منابع تغییرات

درجه آزادی

میزان هیوسیامین (درصد)

میزان آسکوپولامین (درصد)

غلظت تیمار(a)

3

**73/748

**41/570

زمان تیمار(b)

2

**09/ 180

**12/174

اثرمتقابل(a*b)

6

**76/22

*50/35

اشتباه آزمایشی

24

10/8

13/13

ضریب تغییرات (درصد)

 

34/16

48/16

**  * و ns به ترتیب نشان دهنده اختلاف معنی­دار در سطح احتمال 1 و 5 درصد، عدم وجود اختلاف معنی­دار می­باشد

 

شکل5- مقایسه میانگین اثر متقابل غلظت و زمان تیمار درصد هیوسیامین (الف) و درصد آسکوپولامین (ب) در سطوح مختلف عصاره قارچ فوزاریوم­گرامینه­روم بر ریشه­های مویین بذرالبنج مشبک. حروف مشابه نشان­دهنده عدم وجود اختلاف معنی­دار در سطح احتمال 5 درصد آزمون دانکن می­باشد


تأثیر محرک عصاره قارچ فوزاریوم‌گرامینه­روم بر سطح رونوشت ژن h6h: نتایج تجزیه واریانس تأثیر عصاره قارچ فوزاریوم‌گرامینه­روم بر میزان بیان ژن h6hدر ریشه­های بذرالبنج مشبک در جدول 5 نشان داده شده است. نتایج مقایسه میانگین اثرات متقابل غلظت و زمان تیمار با محرک عصاره قارچ فوزاریوم‌گرامینه­روم نشان داد که سطوح مختلف غلظت و زمان در سطح احتمال 5 درصد به­طور معنی­داری میزان بیان ژن h6h را تحت تأثیر قرار داد. بیشترین میزان بیان ژن h6hدر تیمار با غلظت 10 میلی­گرم برلیتر عصاره قارچ فوزاریوم‌گرامینه­روم در مدت زمان 48 ساعت مشاهده گردید که میزان تولید آن نسبت به ریشه­های مویین شاهد 72/4 برابر افزایش یافت. کمترین میزان بیان ژن h6hدر شاهد در مدت زمان 48 ساعت مشاهده گردید (شکل 7).

ارتباط تجمع آسکوپولامین با میزان بیان نسبی ژن h6h تحت تیمار عصاره قارچ فوزاریوم­گرامینه­روم: نمودار همبستگی تجمع آسکوپولامین با میزان بیان ژن h6h تحت تأثیر عصاره قارچ فوزاریوم گرامینه روم نشان داد که بین تجمع آسکوپولامین و میزان بیان ژن h6h ارتباط معنی­داری در سطح احتمال 5 درصد وجود دارد. الگوی تجمع آسکوپولامین تحت تأثیر عصاره قارچ فوزاریوم گرامینه روم روند تقریباً مشابهی با روند بیان ژن نشان داد (شکل8).

 

جدول6- تجزیه واریانس تأثیر غلظت و مدت زمان تیمار با عصاره قارچ فوزاریوم بر میزان بیان نسبی ژن h6h در ریشه­های مویین بذرالبنج مشبک

میانگین مربعات

 

میزان بیان نسبی ژن

درجه آزادی

منابع تغییرات

**۱۴/۱۱۵

3

غلظت تیمار(a)

*۳۶/۱۶

2

زمان تیمار(b)

*۲۶/۱۳

6

اثرمتقابل(a*b)

۲۹/۴

24

اشتباه آزمایشی

۶/۲۵

 

ضریب تغییرات (درصد)

     **  * و ns به ترتیب نشان دهنده اختلاف معنی­دار در سطح احتمال 1 و 5 درصد، عدم وجود اختلاف معنی­دار می­باشد

الف

ب

شکل7-  مقایسه میانگین اثرات غلظت و مدت زمان تیمار عصاره قارچ فوزاریوم گرامینه روم بر میزان بیان ژن h6h در ریشه­های مویین بذرالنج مشبک (الف). حروف مشابه نشان دهنده عدم وجود اختلاف معنی­دار در سطح احتمال 5 درصد بر اساس آزمون دانکن می­باشد. آنالیز RT-PCR بر میزان بیان ژن h6h تحت تأثیر محرک عصاره قارچ فوزاریوم گرامینه روم در غلظتهای 0، 5، 10 و 20 میلی گرم بر لیتر و آنالیز RT-PCR بر میزان بیان ژن 18s کنترل داخلی (ب) شاهد : C1، غلظت 5 میلی گرم برلیترC2: ، غلظت 10 میلی گرم برلیترC3:، غلظت 20 میلی گرم برلیترC4:، 24 ساعت T1:، 48 ساعتT2:، 72 ساعتT3: ، واکنش کنترل منفی NTC:، واکنش کنترل منفیRT:

 

شکل8-  ارتباط میزان تجمع آسکوپولامین با میزان بیان نسبی ژن h6h تحت تیمار عصاره قارچ فوزاریوم گرامینه روم در غلظتهای (0، 5، 10 و 20 میلی­گرم برلیتر) و در زمانهای (24، 48 و 72 ساعت).  ضریب همبستگی پیرسون بین دو متغیر معنی­دار می­باشد.


تأیید مولکولی ماهیت تراریختی ریشه‌های موئین: بررسی ماهیت تراریختی ریشه­های مویین را می­توان با ردیابی ژنهای موجود روی T-DNA باکتری آگروباکتریوم رایزوژنز که مهم­ترین آنها ژنهای rolrolB و rolC هستند انجام داد. در واکنش زنجیره­ای پلیمراز با کمک آغازگر اختصاصی ژن rolB، قطعاتی به طول  bp780 تولید کردند که حضور آنها روی ژل نشان­دهنده وجود این توالی و در نتیجه انتقال توالی T-DNA به ژنوم سلول گیاهی می­باشد. (شکل 9).

 

شکل9- نمایه الکتروفوزی حاصل از واکنش PCR (قطعه 780 جفت بازی) از ژن rolB روی ژل آگارز 8/0 درصد. L)  DNA Marker 1 kb ، C+) باند تکثیر شده از DNA آگروباکتریوم سویه A7 به عنوان کنترل مثبت، C1-) ریشه­های شاهد غیر تراریخت به عنوان کنترل منفی اول، C2-) واکنش PCR بدون الگوی DNA به عنوان کنترل منفی دوم، لاین 1 تا 3) ریشه­های مویین القاء شده در ریزنمونه­های برگ دو هفته‌ای توسط سویه A7 آگروباکتریوم رایزوژنز

بحث

مطالعات نشان می­دهد محرکهای قارچی می­توانند باعث مهار رشد سلولهای گیاهی شود (24).  به طور مثال رشد سلولهایMorinda elliptica  تحت تأثیر عصاره قارچ Aspergillus niger بیش از 35 درصد نسبت به نمونه­های شاهد کاهش یافت (11). کاهش رشد سلولی تحت تأثیر محرکهای قارچی در کشت سلول Rhodiola sachalinesis ,Catharanthus roseus و Taxus spp گزارش شده است (11). این کاهش رشد سلولها، تحت تأثیر محرکهای قارچی می­تواند به دلیل کاهش متابولیسم اولیه و آغاز متابولیسم ثانویه باشد (10 و 35).  در کشت سوسپانسیون درمنه خزری هم افزودن محرکهای زیستی و غیر زیستی باعث کاهش رشد سلولها در مقایسه با شاهد گردید (2). گزارشاتی نیز مبنی بر افزایش رشد تحت تأثیر محرکهای قارچی وجود دارد، بنابراین به نظر می­رسد محرکهای قارچی اثرات متنوعی بر رشد دارند.

محرکهای قارچی باعث افزایش میزان تولید متابولیتهای ثانویه، به­ویژه متابولیتهایی که در سازوکارهای دفاعی گیاه نقش دارند، می­شود ( 18 و 30). قارچها همانند گیاهان دارای دیواره سلولی می­باشند ولی ترکیب دیواره سلولی آنها با گیاهان متفاوت است. محرکها به ترکیبات دیواره سلولی حمله می­کنند و در پی پاسخ به پیام محرک، سیستم دفاعی گیاه فعال می­شود. محرکها به­وسیله گیرنده گیاهی یا R پروتئین شناسایی می­شوند. شناسایی در دیواره پلاسما، آغاز سیگنال پاسخ­دهی می­باشد. بعد از سیگنال تحریک، گیرنده­های گیاهی، سیگنال اجرایی­شان را مثل نشت یونی، انفجار اکسیداتیو و اکسیژن فعال، فسفریلاسیون و دفسفریلاسیون پروتئینها را به­کار می­گیرند و به­وسیله مولکولهای پیام­رسان ثانویه مثلH2O2 ، اسید جاسمونیک، اسید سالسلیک، آزادکننده­های کلسیم داخلی و تلفیق چند ژن و سرانجام بیان ژن دفاعی که همان تولید بالای متابولیت ثانویه حاصل می­شود (26 و 27).

ترکیبات فنولی، مهارکننده قوی برای تنش اکسایشی هستند و در این رابطه مشتقات سینامیک اسید مؤثرتر از مشتقات بنزوئات هستند. ترکیبات فنولی در همکاری با پراکسیدازها در جمع آوری یا حذف پراکسید هیدروژن شرکت می­کنند (22). آنزیم PAL که آغازکننده نخستین مرحله از مسیر بیوسنتزی فنیل پروپانوئیدها می­باشد، پل ارتباطی بین متابولیتهای اولیه و برخی از متابولیتهای ثانویه می­باشد (38). افزایش فعالیت PAL و دیگر آنزیمهای مسیر فنیل پروپانوئیدی که منجر به افزایش ترکیبات فنولی می­شود، از نخستین پاسخهای گیاهان در شرایط تنش می­باشد (36). مطالعات نشان می دهد فعالیت این آنزیم تحت تاثیر محرکهای قارچی نیز افزایش می­یابد (15). عصاره قارچ Fusarium oxysporum در کشت سلول تاکسوس باعث افزایش تاکسول و ترکیبات فنولی شد (20). افزایش ترکیبات فنولی تحت تأثیر محرکهای قارچی در کشت سلول کتان زراعی (Linum usitatissimum) مشاهده شده است (15). با توجه به بررسی مطالعات انجام شده، نتایج مشاهده شده در این مطالعه با گزارشات سایر محققین در مورد کاربرد عصاره قارچی در افزایش میزان فنول کل مطابقت دارد.

کاربرد قارچAspergillus nigerبه­عنوان محرک زیستی در کشت سوسپانسیون سلولی گیاه پریوش(Catharanthus roseus)، سبب افزایش تولید آلکالوئیدهای وینبلاستین و وینکریستین شد (34). Wiktorowaka و همکاران (37) گزارش کردند که تیمار کشت سلولی گل همیشه بهار (Calendula officinalis)با عصاره هموژن شده از قارچ Trichoderma viride  موجب افزایش تولید الئونیک اسید شد. در تیمار ریشه­های مویین گیاه داتوره با عصارهFusarium monoliforme ، Aspergillus niger و Alternarie sp، بیشترین مقدار هیوسیامین در محیطهای حاوی عصاره میسیلیومی قارچ A. niger مشاهده گردید (4). استفاده از محرک قارچی Aspergillus niger  در افزایش آرتمیزینین در گیاه Artemisia annua، (23)، اثر تحریکی محرک دیواره سلولی قارچ Phytophthora cinnamon  بر تجمع رزمارینیک اسید در ریشه­های مویین گیاه ریحان(Ocimum basilicum)  (6)، اثر کیتوسان بر تولید رزمارینیک اسید در زرین گیاه (1) کاربرد قارچ Phytophthora parasitica به عنوان محرک زیستی بر ریشه­های مویین گیاه کاسنی (Cichorium intybus L) گزارش شده است (7). با توجه به بررسی مطالعات انجام شده، نتایج مشاهده شده در این مطالعه با گزارشات سایر محققین در مورد کاربرد عصاره قارچی در افزایش تولید متابولیتهای ثانویه مطابقت دارد.

همان طور که ذکر شد هنگامی که گیاهان مورد تهاجم و حمله قارچها قرار می­گیرند آنزیمهای تولید کننده متابولیتهای ثانویه مانند PAL  بیان می­شوند این آنزیم به نوبه خود باعث تحریک تولید هورمونهای غیر کلاسیک از جمله جاسمونات­ها و سالیسیلات­ها می­شود (12) . این هورمونها نقش سیگنال را برعهده دارند و باعث افزایش فعالیت آنزیمهای نیترات ردوکتاز می­گردد در نتیجه بیان ژنهای h6h بیشتر می­شود. فعالیت بالای ژن h6h یک اثر مثبت در تولید آلکالوئیدهای تروپانی به­ویژه آسکوپولامین دارد. این اثر مثبت همچنین در بافتهای گیاه شابیزک مشاهده شده است (16). نتایج این مطالعه نشان داد که ارتباط مستقیمی بین میزان بیان ژن h6h و تولید آسکوپولامین وجود دارد (شکل 8). بنابراین می­توان احتمال داد که تنظیمها در سطح بیان، در فعالیت آنزیم H6H نقش بیشتری نسبت به سایر تنظیمات دارند. همچنین می­توان از این ژنها به عنوان عاملی کلیدی و تنظیم­­کننده مهم، در تولید تروپان آلکالوئید آسکوپولامین نام برد (14).

نتیجه­گیری کلی

نتایج آزمایش حاضر نشان داد که بهترین تیمار عصاره قارچ فوزاریوم گرامینه­روم به­منظور سنتز آلکالوئیدهای تروپانی هیوسیامین و آسکوپولامین به ترتیب غلظت 5 و 10 میلی­گرم بر لیتر به مدت 48 ساعت می­باشد. بنابراین به­نظر می­رسد که عصاره قارچ فوزاریوم گرامینه­روم به­عنوان یک محرک زیستی می­تواند راهکار مناسبی جهت افزایش تولید و بهره­وری گیاهان دارویی محسوب شود.

تقدیر و تشکر

این تحقیق با استفاده از اعتبارات پژوهشکده زیست فنآوری دانشگاه ارومیه انجام شده است. از ریاست پژوهشکده و کارشناسان محترم آن و همچنین معاونت پژوهشی دانشگاه ارومیه تشکر و قدردانی می­شود.

1- ایوبی، ن.، حسینی، ب. و فتاحی، م. 1396. اثر القایی کیتوزان و کلشی­سین بر تولید رزمارینیک اسید در ریشه مویین زرین گیاه (Dracocephalum kotschyi Boiss). پژوهش های سلولی و ملکولی، 30(1): 1-13.
2- صمیمی زاد، م.، جنوبی، پ.، نقوی، م.، آریاکیا، ا.، یزدانی، ب. و شاهزاده فاضلی، ا. 1396. بررسی اثر متیل جاسمونات، نیترات پتاسیم و موالونیک اسید بر محتوای آرتمیزین در کشت سوسپانسیون سلولی درمنه خزری. پژوهش های سلولی و ملکولی، 30(2): 167-181.
 
3- Aebi, H.I. and Bergmeyer, H. (1974). Methods of enzymatic analysis. Academic Press, New York, 2: 674-684.
4- Ajungla, L., Patil, P., Barmukh, R. and Nikam, T. (2009). Influence of biotic and abiotic elicitors on accumulation of hyoscyamine and scopolamine in root cultures of Datura metel L. Indian Journal of Biotechnology, 8: 317-322.
5- Bahabadi, S.E., Sharifi, M., Safaie, N., Murata, J., Yamagaki, T. and Satake, H. (2011). Increased lignan biosynthesis in the suspension cultures of Linum album by fungal extracts. Plant Biotechnology Reports, 5(4): 367.
6- Bais, H.P., Walker, T.S., Schweizer, H.P. and Vivanco, J. M. (2002). Root specific elicitation and antimicrobial activity of rosmarinic acid in hairy root cultures of Ocimum basilicum. Plant Physiology and Biochemistry, 40(11): 983-995.
7- Bais, H. P., Dattatreya, B. and Ravishankar, G. (2003). Production of volatile compounds by hairy root cultures of Cichorium intybus L under the influence of fungal elicitors and their analysis using solid phase micro extraction gas chromatography–mass spectrometry. Journal of the Science of Food and Agriculture, 83(8): 769-774.
8- Baghalian, K. and Naghdi Badi, H. (2000). Volatile oil crops; their biology, biochemistry, and production. Andarz Publication, 248.
9- Baldi, A., Srivastava, A. K., and Bisaria, V. S. (2009). Fungal elicitors for enhanced production of secondary metabolites in plant cell suspension cultures. Symbiotic Fungi, 373-380
10- Chen, H. and Chen, F. (2000). Effect of yeast elicitor on the secondary metabolism of Ti-transformed Salvia miltiorrhiza cell suspension cultures. Plant Cell Reports, 19(7): 710-717
11- Chong, T.M., Abdullah, M.A., Lai, O.M., Nor’Aini, F.M. and Lajis, N.H. (2005). Effective elicitation factors in Morinda elliptica cell suspension culture. Process Biochemistry, 40(11): 3397-3405.
12- Dixon, R.A. and Lamb, C.J. (1990). Molecular communication in interaction between plants and microbial pathogens. Annual Review of Plant Physiology and Plant Molecular Biology, 41: 339-367.
13- Hajimahdipour, H., Khanavi, M., SHekarchi, M., Abedi, Z. and Pirali Hamedani, M., (2009). Study the best method of extraction of phenolic compounds in Echinacea purpurea. Journal of Medicinal Plants, 4(8): 145-152.
14- Häkkinen, S.T., Moyano, E., Cusidó, R.M., Palazón, J., Piñol, M.T. and Oksman-Caldentey, K.M. (2005). Enhanced secretion of tropane alkaloids in Nicotiana tabacum hairy roots expressing heterologous hyoscyamine-6β-hydroxylase. Journal of Experimental Botany, 56(420): 2611-2618.‏
15- Hano, C., Addi, M., Bensaddek, L., Crônier, D., Baltora-Rosset, S., Doussot, J. and Hawkins, S. (2006). Differential accumulation of monolignol-derived compounds in elicited flax (Linum usitatissimum) cell suspension cultures. Planta, 223(5): 975-989.
16- Hashimoto, T., Yun, D.J. and Yamada, Y. (1993). Production of tropane alkaloids in genetically engineered root cultures. Phytochemistry, 32(3): 713-718.‏
17- Kamada, H., Okamura, N., Satake, M., Harada, H. and Shimomura, K. (1986). Alkaloid production by hairy root cultures in Atropa belladonna. Plant Cell Reports, 5(4): 239-242.
18- Kang, S.M., Jung, H.Y., Kang, Y.M., Yun, D.J., Bahk, J.D., Yang, J.k. and Choi, M.S. (2004). Effects of methyl jasmonate and salicylic acid on the production of tropane alkaloids and the expression of PMT and H6H in adventitious root cultures of Scopolia parviflora. Plant Science, 166(3): 745-751.
19- Khan, S., Qureshi, M. I., Alam, T. and Abdin, M. (2007). Protocol for isolation of genomic DNA from dry and fresh roots of medicinal plants suitable for RAPD and restriction digestion. African Journal of Biotechnology, 6(3): 175.
20- Khosroushahi, A. Y., Valizadeh, M., Ghasempour, A., Khosrowshahli, M., Naghdibadi, H., Dadpour, M. and Omidi, Y. (2006). Improved Taxol production by combination of inducing factors in suspension cell culture of Taxus baccata. Cell Biology International, 30(3): 262-269.
21- Kim, Y.D., Kang, S.M., Min, J.Y., Choi, W.K., Jeong, M.J., Karigar, C.S. and Choi, M.S. (2010). Production of tropane alkaloids during de-differentiation of Scopolia parviflora calli. Journal of Natural Products, 73(2): 147-150.
22- Kováčik, J., Klejdus, B., Hedbavny, J., Štork, F. and Bačkor, M. (2009). Comparison of cadmium and copper effect on phenolic metabolism, mineral nutrients and stress-related parameters in Matricaria chamomilla plants. Plant and Soil, 320(1-2): 231.
23- Liu, C. H., Zou, W. X., Lu, H. and Tan, R. X. (2001). Antifungal activity of Artemisia annua endophyte cultures against phytopathogenic fungi. Journal of Biotechnology, 88(3): 277-282.
24- Misawa, M. (1994). Plant tissue culture: an alternative for production of useful metabolites: Food and Agriculture Organiziation, 279-315PP.
25- Murashige, T. and Skoog, F. (1962). A revised medium for rapid growth and bio assays with tobacco tissue cultures. Physiologia Plantarum, 15(3): 473-497.
26- Nakano, Y. and Asada, K. (1981). Hydrogen peroxide is scavenged by ascorbate-specific peroxidase in spinach chloroplasts. Plant and Cell Physiology, 22(5): 867-880.
27- Norbert, O., Imre, B. and Zolta, S. (2008). Influence of different elicitors on the synthesis of anthraquinone derivatives in Rubia tinctorum L. cell suspension cultures. Dyes and Pigments, 77: 249-257.
28- Patterson, S., and O'Hagan, D. (2002). Biosynthetic studies on the tropane alkaloid hyoscyamine in Datura stramonium; hyoscyamine is stable to in vivo oxidation and is not derived from littorine via a vicinal interchange process. Phytochemistry, 61(3), 323-329.
29- Pramod, K.K., Singh, S. and Jayabaskaran, C. (2010). Expression of hyoscyamine 6β-hydroxylase in the root pericycle cells and accumulation of its product scopolamine in leaf and stem tissues of Datura metel L. Plant Science, 178(2): 202-206.
30- Pu, G.B., Ma, D.M., Chen, J.L., Ma, L.Q., Wang, H., Li, G.F. and Liu, B.Y. (2009). Salicylic acid activates artemisinin biosynthesis in Artemisia annua L. Plant Cell Reports, 28(7): 1127-1135.
31- Sudhakar, C., Lakshmi, A. and Giridarakumar, S. (2001). Changes in the antioxidant enzyme efficacy in two high yielding genotypes of mulberry (Morus alba L.) under NaCl salinity. Plant Science, 161(3): 613-619.
32- Sharafi, A., Sohi, H.H., Mousavi, A., Azadi, P., Hosseini, B., Razavi, K. (2013). Metabolic engineering of morphinan alkaloids by over-expression of codeinone reductase in transgenic hairy roots of Papaver bracteatum, the Iranian poppy. Biotechnology Letters, 35 (3):445-453
33- Sharafi, A., Hashemi Sohi, H., Sharafi, A., Azadi, P., Mousavi A. (2014). Tissue culture and regeneration of an antimalarial plant, Artemisia sieberi Besser. Research Journal of Pharmacognosy, 1 (3): 15-20
34- Taha, H., El-Bahr, M. and Seif-El-Nasr, M. (2009). In vitro studies on Egyptian Catharanthus roseus L. G. Don. IV: manipulation of some amino acids as precursors for enhanced of indole alkaloids production in suspension cultures. Australian Journal of Basic and Applied Sciences, 3(4): 3137-3144.
35- Wang, C., Wu, J. and Mei, X. (2001). Enhancement of taxol production and excretion in Taxus chinensis cell culture by fungal elicitation and medium renewal. Applied Microbiology and Biotechnology, 55(4): 404-410.
36- Wen, P.F., Chen, J.Y., Wan, S.B., Kong, W.F., Zhang, P., Wang, W. and Huang, W.D. (2008). Salicylic acid activates phenylalanine ammonia-lyase in grape berry in response to high temperature stress. Plant Growth Regulation, 55(1): 1-10.
37- Wiktorowska, E., Długosz, M. and Janiszowska, W. (2010). Significant enhancement of oleanolic acid accumulation by biotic elicitors in cell suspension cultures of Calendula officinalis L. Enzyme and Microbial Technology, 46(1): 14-20.
38- Yu, Z.Z., Fu, C.X., Han, Y.S., Li, Y.X. and Zhao, D.X. (2006). Salicylic acid enhances jaceosidin and syringin production in cell cultures of Saussurea medusa. Biotechnology Letters, 28(13): 1027-1031.
39- Zayed, R. and Wink, M. (2004). Induction of tropane alkaloid formation in transformed root cultures of Brugmansia suaveolens (Solanaceae). Zeitschrift Für Naturforschung C, 59(11-12): 863-867.
40- Zhang, J., Liu, H., Sun, Y., Wang, X., Wu, J. and Xue, Y. (2005). Responses of the antioxidant defenses of the Goldfish Carassius auratus, exposed to 2, 4-dichlorophenol. Environmental Toxicology and Pharmacology, 19(1): 185-190.