نوع مقاله: مقاله پژوهشی

نویسندگان

1 دانشگاه شهرکرد

2 هیات علمی دانشگاه شهرکرد

3 دانشیار دانشگاه شهرکرد، دانشکده علوم، گروه ژنتیک

4 استاد دانشگاه شهرکرد ,گروه علوم دام ,تغذیه طیور

چکیده

بتاگلوکان هموپلیمر خطی از واحد های دی گلوکز است که با پیوندهای بتاگلیکوزیدی به یکدیگر متصل شده اند. این ترکیب یکی از اجزاء اصلی تشکیل دهنده غلاتی مانند جو، یولاف و گندم است. آنزیم‌های بتاگلوکاناز این پلیمر را با شکستن اتصالات بتاگلیکوزیدی، به اجزاء سازنده آن تجزیه می کنند. هدف از این مطالعه بیان ژن لیکیناز در باکتری و تولید آنزیم نو ترکیب به عنوان مکمل غذایی برای طیور است. این امر امکان جایگزینی جو بجای ذرت در جیره غذایی طیور را فراهم می‌سازد. در این تحقیق ژن کدکننده آنزیم بتا1و3 – 1و4گلوکاناز باکتری گرمادوست Clostridium thermocellum در وکتور بیانی pET22b(+) و باکتری E.Coli سویه BL21 کلون گردید. بیان ژن آنزیم بتاگلوکاناز در باکتری بیانیBL21 پس از القای بیان توسط (IPTG 0.1 mM) بااستفاده از تکنیک SDS-PAGE مورد تایید گرفت. همچنین به منظور سنجش میزان فعالیت آنزیمی پروتئین نوترکیب از تست کاهش قند و بررسی میزان هضم گلوکان جو استفاده گردید. جهت تایید شرایط بهینه به منظور تولید پروتئین نوترکیب، تیمار‌های مختلف دما، زمان و pH بر محیط رشد باکتری مورد بررسی قرار گرفت. نتایج نشان داد که دمای بهینه فعالیت آنزیم 55 درجه سانتی‌گراد است و حداکثر فعالیت آنزیمی در مدت زمان4 ساعت پس از القا و pH=8 بدست آمد. استفاده از جو درجیره غذایی طیور معمولا مقرون به صرفه است. اما وجود مقادیر قابل توجهی از بتاگلوکان‌ها درجو به کارگیری این دانه را با مشکل مواجه ساخته است. تولید و تایید اثر این آنزیم بر هضم گلوکان جو استفاده آن را در تهیه‌ی غذای طیور ممکن می‌سازد.

کلیدواژه‌ها

موضوعات

عنوان مقاله [English]

cloning and Expression of β (1-3)(1-4) glucanase gene in E.coli for production as animal feed supplement

نویسندگان [English]

  • Kakimeh Afshin 1
  • neda mirakhorli 2
  • Behnaz Saffar 3
  • Fariborz Khajeali 4

1 Shahrekord University

2 Shahrekord University

3 Dept. of Genetics, Faculty of Science, Shahrekord University, Shahrekord, I.R. of Iran

4 Shahrekord University

چکیده [English]

β-Glucans (beta-glucans) form a natural component of the cell walls of bacteria, fungi, yeast, and cereals such as oat and barley. Glucanases are enzymes that break down a glucan. β-glucans are chains of D-glucose polysaccharides linked by β-type glycosidic bonds. The purpose of this study is to express the lechinase enzyme in bacteria to produce recombinant enzyme as a feed supplement in poultry diets. In this study, LicBM2 gene, isolated from Clostridium thermocellum, encodes thermostable lichenase enzyme was cloned in expression vector pET22b (+) and E.Coli bacteria strain BL21. Bacterial β-1,3–1,4-glucanases (EC 3.2.1.73; lichenase) specifically cleave the β-1,4-glycosidic linkage adjacent to 3-O-substituted glucopyranose residues.
Gene expression was confirmed using SDS-PAGE techniques. Enzyme activity of recombinant protein and reducing glucan in barly were measured by DNS method. The optimum temperature for recombinant protein production was 55 ° C and the maximum enzyme activity was obtain within 4 hours after inducing in pH = 8. Using barlay in poultry diet is more economical. But the significant amounts of beta-glucans in barlay cause more problems. The recombinant enzyme produced in this study can be used as a feed supplement for hydrolyzation of barley β-glucan to replace of corn by barley in poultry diets.

کلیدواژه‌ها [English]

  • Recombinant enzyme
  • lichenase
  • Poultry diets supplement

کلون سازی و بیان ژن بتا(1-3 )(1-4)گلوکاناز در باکتری اشیرشیاکلی جهت تولید مکمل خوراک دام

حکیمه افشین1، ندا میرآخورلی1*، بهناز صفار2 و فریبرز خواجعلی3

1 ایران، شهرکرد، دانشگاه شهرکرد، دانشکده کشاورزی، گروه اصلاح نباتات و بیوتکنولوژی

2 ایران، شهرکرد، دانشگاه شهرکرد، دانشکده علوم، گروه ژنتیک

3 ایران، شهرکرد، دانشگاه شهرکرد، گروه علوم دام تغذیه طیور

تاریخ دریافت: 22/7/95                تاریخ پذیرش: 25/10/97

چکیده

بتاگلوکان هموپلیمر خطی از واحد های دی گلوکز است که با پیوندهای بتاگلیکوزیدی به یکدیگر متصل شده اند. این ترکیب یکی از اجزای اصلی تشکیل دهنده غلاتی مانند جو، یولاف و گندم است. آنزیمهای بتاگلوکاناز این پلیمر را با شکستن اتصالات بتاگلیکوزیدی، به اجزای سازنده آن تجزیه می کنند. هدف از این مطالعه بیان ژن لیکیناز در باکتری و تولید آنزیم نو ترکیب به عنوان مکمل غذایی برای طیور است. این امر امکان جایگزینی جو به جای ذرت در جیره غذایی طیور را فراهم می‌سازد. در این تحقیق ژن کدکننده آنزیم  بتا1و3 – 1و4گلوکاناز باکتری گرمادوست Clostridium thermocellumدر وکتور بیانی pET22b(+) و باکتری E.Coliسویه BL21 کلون گردید. بیان ژن آنزیم بتاگلوکاناز در باکتری بیانیBL21 پس از القای بیان توسط (IPTG 0.1 mM) با استفاده از تکنیک SDS-PAGE مورد تأیید قرار گرفت. همچنین به منظور سنجش میزان فعالیت آنزیمی پروتئین نوترکیب از تست کاهش قند و بررسی میزان هضم گلوکان جو استفاده گردید. جهت تأیید شرایط بهینه به منظور تولید پروتئین نوترکیب، تیمار‌های مختلف دما، زمان و  pH بر محیط رشد باکتری مورد بررسی قرار گرفت. نتایج نشان داد که دمای بهینه فعالیت آنزیم 55 درجه سانتی‌گراد است و  حداکثر فعالیت آنزیمی در مدت زمان4 ساعت پس از القاء و pH=8 به دست آمد. استفاده ازدانه‌هایی مانند جو در جیره غذایی طیور معمولاً مقرون به صرفه است. اما وجود مقادیر قابل توجهی از بتاگلوکانها در جو به کارگیری این دانه را با مشکل مواجه ساخته است. تولید و تأیید اثر این آنزیم بر هضم گلوکان جو امکان استفاده آن را در تهیه غذای طیور ممکن می‌سازد.

واژه های کلیدی: آنزیم نو ترکیب, لیکیناز، مکمل تغذیه طیور.

* نویسنده مسئول، تلفن: 03832324401  ،  پست الکترونیکی: @yahoo.com‌‌‌‌Nedamirakhorli

مقدمه

 

در صنعت پرورش طیور، خ‍وراک‌ ب‍ی‍ش‍ت‍ری‍ن‌ ه‍زی‍ن‍ه‌ تولید را به ‍خ‍ود اخ‍ت‍ص‍اص‌ م‍ی‌ده‍د، از این رو ب‍ه‌ ح‍داق‍ل‌ رس‍ان‍دن‌ ه‍زی‍ن‍ه‌ه‍ای‌ خ‍وراک‌، امری ضروری در این صنعت به حساب می‌آید. ع‍م‍ده‌ت‍ری‍ن‌ جزء‌ خ‍وراک‌ طی‍ور را غ‍لات‌ ت‍ش‍ک‍ی‍ل‌ م‍ی‌ده‍ن‍د. در این م‍ی‍ان‌ ذرت‌ م‍ه‍م‍ت‍ری‍ن‌ م‍اده‌ اول‍ی‍ه‌ ج‍ی‍ره‌ طی‍ور اس‍ت‌ ک‍ه‌ ح‍دود ۶۵ درص‍د آن را ت‍ش‍ک‍ی‍ل‌ م‍ی‌ده‍د. این در حالی است که ۸۰ درص‍د ذرت‌ مصرفی کشور وارداتی است. اما از آنجا که ت‍ول‍ی‍د ج‍و در داخ‍ل‌ ک‍ش‍ور ح‍دود ۱۶ ب‍راب‍ر ت‍ول‍ی‍د ذرت‌ اس‍ت‌، م‍ی‌ت‍وان‌ ب‍ه‌ م‍ی‍زان‌ زی‍ادی‌ از ای‍ن‌ غ‍ل‍ه‌ به جای ذرت‌ در جیره غذایی طیور استفاده کرد و واردات‌ ذرت‌ را ک‍اه‍ش‌ داد (7) .

جو از لحاظ مقدار پروتئین خام، اسیدهای آمینه، ویتامینها، مواد معدنی مختلف و آلودگی به قارچ و کپکها نسبت به ذرت برتری دارد، اما به علت داشتن پلی ساکاریدهای بتاگلوکان مصرف آن در جیره طیور به خصوص جوجه‌های گوشتی دارای محدودیت می‌باشد. کاهش قابلیت هضم مواد مغذی و انرژی قابل سوخت و ساز ناشی از مصرف جو در جیره طیور، به دلیل کاهش زمان عبور غذا از دستگاه گوارش به علت بالا رفتن ویسکوزیته مواد در اثر وجود بتاگلوکان است. امروزه برای بالا بردن ارزش غذایی جو در تغذیه طیور از فرآیندهای مختلفی نظیر پوست‌گیری، خیسانیدن، استفاده از چربی و افزودن آنزیمهای مصنوعی حاصل از کشت قارچها و باکتریهای مخصوص استفاده می شود. در بین این روشها استفاده از آنزیمهای تجارتی راه حلی آسان، اساسی و کاربردی‌تر است.  افزودن آنزیم بتاگلوکاناز به جیره غذایی حیوانات تک معده‌ای ازقبیل خوک، پرندگان و دامها باعث تجزیه گلوکان موجود در جیره غذایی و همچنین کاهش آلودگی و هدر رفتن انرژی موجود در جیره می‌شود (16).

بتاگلوکانازها گروه ویژه‌ای از آنزیمها هستند که هیدرولیز بتاگلوکانها را انجام می‌دهند، این دسته از آنزیمها در بین ریزسازواره‌ها و حیوانات، پراکندگی و گستردگی دارند،  ولی از این میان گلوکانازهای میکروبی بیش از بقیه مورد توجه می‌باشند (6).

در دو دهه گذشته بتاگلوکاناز‌ها درحیطه تغذیه، حفاظت ازمحیط زیست و بیوتکنولوژی مورد توجه دانشمندان قرارگرفته‌اند. این دسته از آنزیمهای هیدرولیزکننده قادر به رها سازی انرژی گلوکان‌ها می‌باشد. زیرا حیوانات تک معده‌ای از قیبل خوکها و پرندگان فاقد آنزیم بتاگلوکاناز درسیستم گوارشی خود بوده و یا فعالیت گلوکانازی آنها پایین می‌باشد، ازاینرو قادر به استفاده از انرژی موجود در ساختار بتاگلوکانها نمی‌باشند.  بتاگلوکان موجود در جو  مشکلاتی در تغذیه طیور ایجاد می‌کند برای کاهش این مشکلات و به منظور افزایش ضریب تبدیل غذایی، آنزیم بتاگلوکاناز به عنوان مکمل غذایی لازم می‌باشد. آنزیم بتاگلوکاناز، بتاگلوکان موجود در جو را به گلوکز و پلی ساکاریدهای ساده تجزیه کرده و مشکل استفاده از جو در جیره غذایی طیور را برطرف می‌سازد( 2).

در روشهای تغذیه ای مدرن  طیور، مواد افزودنی غذا در جایگاه اول اهمیت قرار دارند. مواد افزودنی محرک رشد، بالابرنده بازدهی غذا و سلامت طیور می‌باشند. پروبیوتیکها، آنزیمها، مکملهای آمینواسید و مواد معدنی انواع افزودنیهای جدید در جیره‌های غذایی طیور می‌باشند که اثرات مثبتی در بهره گیری از مواد غذایی دارند.

با توجه به اهمیت آنزیم بتاگلوکاناز‌ تلاشهای بسیاری برای تولید این آنزیم در جهان صورت گرفته است. تهیه این آنزیم از طریق بیو شیمیایی بسیارمشکل می­باشد و تولید آن در موجودات بسیار کم است. بنابراین راه آسان تر برای نیل به این هدف استفاده از میکروارگانیسم‌ها و روشهای مهندسی ژنتیک است.

خالص سازی و شبیه سازی ژن بتا (1-3) (1-4)گلوکاناز از منابع میکروبی مانند قارچ .Phialophora SP قارچTrichoderma virens  و باکتری Bacillus altitudinis و تولید و بررسی اثر آنزیم بتاگلوکاناز در جیره غذایی طیور نشان می‌دهد که استفاده از آنزیم بتاگلوکاناز باعث  افزایش وزن و ضریب تبدیل غذایی جوجه های تغذیه شده با جیره های حاوی جو می‌شود (11).

در این تحقیق با هدف تولید آنزیم نوترکیب بتاگلوکاناز جهت استفاده در جیره غذایی طیور که بر اساس جو  تهیه شده است،  ژن LicBM2 که یک ژن دستکاری شده از باکتری Clostridium thermocellum است، در باکتری اشرشیاکلای کلون گردید. این ژن کد کننده آنزیم مقاوم به حرارت بتا (3 -1) (4-1)گلوکاناز (لیکیناز )است (7). لیکیناز یک کمپکس چند آنزیمی خارج سلولی با وزن مولکولی بالاست و به طور خاص پیوندهای بتا (1-4) مجاور پیوندهای (1-3) را در بتاگلوکانها هیدرولیز می‌کند. از این رو به طور کاملاً اختصاصی باعث هضم بتاگلوکان جو (لیکینان) می شود.

مواد و روشها

باکتری و پلاسمید‌های مورد استفاده  جهت کلون سازی و بیان ژن: در این تحقیق از باکتریهای اشرشیاکلای سویه DH5α جهت تکثیر و کلون سازی ژن LicBM2و سویهBL21 پلاسمید(+) pET 22 b به منظور بیان پروتئین نوترکیب استفاده شد.

جهت تکثیر ژن (EC 3.2.1.73; lichenase) LicBM2کلون شده در پلاسمید pBISN1-IN (EU886197)   طراحی پرایمر صورت گرفت و سایتهای برشی جهت کلون‌سازی ژن در پلاسمید بیانی در نظر گرفته شد( جدول 1).

 

جدول1- توالی پرایمر جهت تکثیر ژن licBM2. و سایتهای برشی در نظر گرفته شده.

CGCGGATCCATGGTAATACGCCT

LicBM2 forward primer

CGCGTCGACAGACCGTTAGGAT

LicBM2 Revers primer

 


ساخت پلاسمید نوترکیب مورد نیاز: ژن LicBM2 کلون شده در پلاسمید pBISN1-IN با استفاده از آغازگرهای اختصاصی طراحی شده توسط تکنیک PCR تکثیر و برروی ژل الکتروفورز یک درصد آگارز بارگذاری شد. پس از تأیید اندازه ژن، قطعه مورد نظر به وسیله‌ کیت تخلیص شرکت Vivantis از ژل خالص سازی شد. هضم آنزیمی قطعه تکثیر شده توسط PCR و پلاسمید بیانی pET 22 b(+) با استفاده از آنزیمهای برشی Sal1 و BamH1 انجام شد. عمل اتصال قطعه مورد نظر در ناقل به وسیله آنزیم T4 DNA Ligase انجام شد و کانسترکت تولید شده با روش شوک حرارتی به باکتریهای مستعدE.coliسویهBL21  منتقل گردید، کلونیهای نوترکیب پس از غربالگری بر روی محیط کشت حاوی آنتی‌بیوتیک آمپی‌سیلین، با استفاده از PCR colony و هضم آنزیمی تأیید شدند.

القای بیان پروتئین: 5 میلی‌لیتر از کشت شبانه باکتریE.coli سویه BL21 نوترکیب به 50 میلی‌لیتر محیط کشت BL مایع حاوی آنتی بیوتیک آمپی سیلین اضافه شد و تا رسیدن ODباکتری به 5/0 در طول موج nm550 ، در دمای 37 درجه و با سرعت 150 دور در دقیقه کشت داده شد. جهت القای بیان ژن لیکینازکلون شده در ناقل بیانی pET احتیاج به القاگر بود. از آنجا که در این پلاسمید از  اپراتور اپران lac استفاده شده است آنالوگ لاکتوز، IPTG (ایزوپروپیل –β-D-تیوگالاکتوزید) به عنوان القاگر استفاده می‌شود. از این رو به محیط کشت باکتری رشد داده شده  IPTG با غلظت 05/0 میلی مولار اضافه گردید و به مدت 2 ، 4 ،6 ساعت در دمای 37 درجه سانتی گراد انکوبه گردید. پس از القاء، باکتریها در سانتریفیوژ با سرعت 4000 دور در دقیقه رسوب داده شدند و فاز بالائی دور ریخته شد. به رسوب باکتری 5 میلی لیتر بافر لیز با اسیدیته 4/7 به همراه 4/10میکرو لیتر آنزیم لیزوزیم جهت شکستن دیواره باکتری و آزاد شدن محتوای سلول اضافه گردید و سپس در دمای 37 درجه  و دور 120 دور در دقیقه به مدت 15 دقیقه کشت داده شد. با سانتریفیوژ مجدد محلول به دست آمده رویی حاوی پروتئین نوترکیب جدا گردیده و در دمای 20- نگهداری شد.

بررسی شرایط بهینه جهت تولید پروتئین نوترکیب:

text here

جهت تعیین بهترین زمان القای بیان ژن در باکتری به منظور دستیابی به بیشترین میزان  تولید آنزیم بتاگلوکاناز در سیستم بیانی(+) pET22b، پس از اضافه کردن القاگر IPTG به محیط کشت، باکتری در سه زمان 2، 4 و6 ساعت در دمای 37 درجه سانتی گراد انکوبه گردید.

دمای بهینه برای فعالیت آنزیم بتاگلوکاناز: در بررسی منابع رنج فعالیت آنزیم بتاگلوکاناز مقاوم به حرارت بسیار گسترده معرفی شده است. به منظور تعیین بهترین شرایط دمایی جهت فعالیت این آنزیم 4 تیمار دما شامل 40, 45،  50 و 55 درجه سانتی گراد مورد بررسی قرار گرفت.

آزمونهای آماری: جهت تأیید تولید پروتیین نوترکیب در باکتری از آزمون t استفاده شد. و جهت بررسی و تعیین شرایط بهینه از طرح کاملاً تصادفی با سه تکرار استفاده گردید. تجزیه تحلیل داده‌ها با نرم افزار SAS  و رسم نمودار با نرم افزار Exel  انجام شد.

ارزیابی کمی فعالیت آنزیم نوترکیب بتاگلوکاناز: به منظور سنجش فعالیت آنزیم بتاگلوکاناز از روش احیای گلوکز (12) استفاده شد. جهت تهیه سوبسترا یک گرم آرد جو در 6 میلی لیتر اتانول مرطوب شد و 90 میلی‌لیتر بافر سیترات سدیم فسفات 75میلی‌مولار با 6/4 =  pHبه آن اضافه شد و مخلوط به دست آمده تا نقطه جوش حرارت داده شد. در یک لوله آزمایش به 2/0 میلی‌لیتر از محلول به دست آمده از باکتری القاء شده حاوی آنزیم بتاگلوکاناز نوترکیب، 1 میلی‌لیتر سوبسترا اضافه گردید و به مدت 5 دقیقه در دمای 50 درجه سانتی گراد قرار داده شد. با اضافه کردن 3 میلی‌لیتر معرف DNS واکنش آنزیمی متوقف شد، و لوله‌ها به مدت 15 دقیقه در حمام آب جوش قرار گرفتند، و رنگ آشکار گردید. پس از سرد شدن 10 میلی‌لیترآب مقطر استریل به هر لوله اضافه شد. تراکم نوری در طول موج nm 550 قرائت شد. مقدار قندهای احیا کننده به صورت گلوکزبا استفاده از نمودار استاندارد  مشخص شد که بیانگر میزان فعالیت آنزیم نوترکیب است .

ارزیابی کیفی آنزیم نوترکیب بتاگلوکاناز: پروتئینهای طبیعی بار الکتریکی، وزن مولکولی و شکل فضایی متفاوتی دارند و این عوامل در حرکت الکتروفوتیکی پروتئینها مؤثرند. الکتروفورز ژل پلی اکریل آمید در حضور دترجنت یونی سدیم دودوسیل سولفات یا لوریل سولفات، کار آمد ترین روشها برای تعیین وزن مولکولی پروتئینها می‌باشد.

جهت تهیه نمونه به منظور الکتروفورز با ژل اکریل‌آمید، جم یکسانی (30 میکرو لیتر) از نمونه های پروتئینی و بافر مخلوط( 15 میلی‌لیتر Tris HCL 0.5 M PH=6.8، 2 میلی لیتر گلیسرول، 4/0 گرم SDS، 2 میلی لیتر 2 – مرکاپتواتانول، 300 میلی‌لیتر برموفنول بلو) باهم مخلوط گردید. به مدت 4 دقیقه در حمام آب جوش قرارداده و بلافاصله بعد از جوشاندن به توده یخ منتقل گردید. سپس به مدت 20 دقیقه در 6000 دور در دقیقه سانتریفیوژ گردید. و در هر چاهک ژل اکریل‌امید 12 درصد، 20 میکرولیتر از نمونه بارگذاری شد.

نتایج و بحث

به منظور تکثیر ژن LicBM2و اضافه کردن جایگاههای برش آنزیمهای برشی  Sal1 و BamH1،پرایمر طراحی و PCR انجام شد حضور باند به سایز bp  700در محصول PCR صحت واکنش را تأیید می‌کند (شکل1).

 

شکل1 - الکتروفورز محصول PCR. چاهک1، 2 و 3 : باند bp700 ژن تکثیر شده LicBM2 از  پلاسمید pBISN1-IN. چاهک M: مارکرbp  100

پس از کلون سازی ژن در پلاسمید (+) pET22b و باکتری بیانی BL21 E.coli  ، جهت تأیید انتقال پلاسمید نوترکیب به باکتری بیانی از تکنیک PCR کلونی از تک کلونیهای رشد کرده بر روی محیط کشت انتخابی (شکل 2) و آزمون برشی (شکل3) استفاده شد.

 

شکل2- ستون d,e: باند 5/5  kbp پلاسمید استخراج شده از تک کلونی رشد کرده بر روی محیط انتخابی. ستون a,b باند 700 bp، محصول واکنش PCR کلونی از تک کلونیهای نوترکیب. تأیید حضور ژن LicBM2  در باکتری. ستون c: مارکر HighRanger plus 100 bp

تأیید پروتئین نوترکیب فعال: جهت تأیید فعالیت آنزیم نوترکیب تولید شده در باکتری از آزمون احیا گلوکز (12) استفاده شد. به این ترتیب که بتاگلوکان جو توسط بتاگلوکاناز نو ترکیب هضم شده و قندهای ساده از جمله گلوکز آزاد می‌کند که می‌توان  با اندازه گیری آن میزان فعالیت پروتیین نوترکیب را اندازه گیری کرد(جدول2). مقایسه اختلاف  میزان فعالیت آنزیم در باکتری دارای پلاسمید و باکتری بدون پلاسمید با استفاده ازآزمون t در سطح1 درصد معنی‌دار شد. که نشانگر بیان ژن بتاگلوکاناز نوترکیب در باکتری دارای پلاسمید است.

 

شکل3- آزمون برشی توسط آنزیمهای برشی Sal1 و BamH1و تأیید حضور ژن بتاگلوکاناز در وکتوربیانی pET22b(+) . ستون a: باندkbp 5/5  پلاسمید(+)  pET22b ، باند bp 700   ژن LicBM2. ستون b: مارکر HighRanger plus 100 bp

 

 

جدول 2- آزمون t میزان فعالیت آنزیم نوترکیب در باکتری

 

** اختلاف در سطح یک درصد معنی‌دار


شرایط بهینه تولید و فعالیت آنزیم لیکیناز نوترکیب جهت هضم بتاگلوکان جو: به منظور بررسی اثر زمان بر میزان بیان آنزیم بتاگلوکاناز , سه زمان مختلف پس از القاء مورد بررسی قرارگرفت. بدین منظور 4 تیمار شاهد (بدون القاء)، 2 ساعت پس از القاء، 4ساعت پس از القاء و 6 ساعت پس از القاء مورد مطالعه قرار گرفتند. همان‌طور که در جدول تجزیه واریانس شماره 3 (جدول 3) مشاهده می‌شود، اثر تیمار که افزایش زمان القاست در سطح 1 درصد معنی دار شده است. نتایج حاصل از مقایسه میانگینها نشان داد که میزان فعالیت آنزیم با IPTG 05/0 میلی مولار با افزایش زمان القاء افزایش می‌یابد و در 4 ساعت پس از القاء بالاترین عدد را نشان می‌دهد( شکل 4). میزان فعالیت آنزیم بر اساس میزان تولید گلوکز بر حسب میکروگرم بر میکرولیتر محاسبه شده است.


جدول3- جدول تجزیه واریانس میزان فعالیت آنزیمی پروتئین نوترکیب

منابع تغییر

درجه‌آزادی

میانگین مربعاتMS

F

تیمار

3

27/45

**

52/62

خطا

8

38/1

 

** اختلاف در سطح یک درصد معنی‌دار


 

شکل 4- نمودار مقایسه میانگین میزان فعالیت آنزیمی لیکیناز نوترکیب2، 4و 6 ساعت پس از القا. بر حسب میزان تولید گلوکز( میکروگرم بر میلی‌لیتر)

کاهش میزان فعالیت آنزیمی در 6 ساعت پس از القاء را می‌توان به دلیل مصرف انرژی بالا برای ترجمه پروتئین نوترکیب توسط سلول توجیه کرد، سلول در چهار ساعت بعد از القاء با کاهش انرژی مواجه شده و از آن طرف سمیت پروتیئن هترولوگ برای سلول باعث می‌شود سلول زودتر وارد فاز سکون گردد و مرحله به مرحله تولید پروتئین نوترکیب را کمتر کند.

همچنین جهت دست یابی به شرایط بهینه فعالیت آنزیم نوترکیب باکتری 4 تیمار دمایی 40 , 45, 50  و 55 درجه سانتی گراد مورد مطالعه قرار گرفتند. تجزیه آماری نشان داد که اختلاف میزان فعالیت آنزیمی در دماهای مختلف در سطح 1 درصد معنی دار شده است (‌جدول 4).

همچنین مقایسه میانگین‌ میزان فعالیت آنزیمی در دماهای متفاوت بیانگر بیشترین فعالیت لیکیناز در دمای 50 درجه سانتی‌گراد می‌باشد( شکل 5).

 

جدول4-جدول تجزیه واریانس  میزان فعالیت آنزیمی لیکیناز در دماهای مختلف

منابع تغییر

درجه‌آزادی

میانگین مربعات MS

F

تیمار

3

92/41

    ** 25/58

خطا

8

682/0

 

** اختلاف در سطح یک درصد معنی‌دار

 

 

 

شکل 5- نمودار  فعالیت آنزیم لیکیناز نوترکیب در دماهای مختلف بر حسب میزان تولید گلوکز(میکروگرم بر میلی‌لیتر)

در منابع تحقیقاتی مختلف رنج دمایی وسیع برای فعالیت آنزیم بتاگلوکاناز معرفی شده‌است. فورتادو و همکاران در سال 2011 رنج دمای30 الی 60 درجه سانتی گراد را جهت فعالیت آنزیم اندو بتا1-3، 1-4 گلوکوناز باسیلوس سابتلیس 168مناسب گزارش کردند. این در حالی است که بیشنه فعالیت بتاگلوکانازی آنزیم یاد شده در دمای 50 درجه اتفاق افتاد (5). در پژوهش دیگری با بررسی ویژگیهای عملکردی آنزیم بتاگلوکاناز تولید شده توسط باسیلوس لچینی فورمیس دمای 40 درجه سانتی گراد به عنوان شرایط مطلوب دستیابی به بهینه فعالیت آنزیمی تعیین شد (15). دمای بهینه فعالیت کاتالیتیکی آنزیم بتا1-3، 1-4 گلوکاناز باسیلوس سابتلیس GN156، 45  درجه سانتی گراد گزارش شده است (1). در پژوهشی که بر روی تولید بتاگلوکاناز در مخمر صورت گرفت مشخص گردید که با کنترل دمایی می‌توان میزان فعالیت آنزیم را کنترل نمود. و دمای بهینه فعالیت آنزیم برخلاف دمای ایده آل رشد باکتری می‌باشد (3). براساس نتایج حاصل از بهینه سازی فعالیت کاتالیتیکی در شرایط مختلف محیطی، آنزیم بتاگلوکاناز قابلیت کاربرد در خوراک دام و طیور به عنوان افزودنی را دارد.

تأیید کیفی بیان ژن بتاگلوکاناز کلون شده در وکتور (+) pET22b: ژل آکریل‌آمید الکتروفورز SDS-PAGE  پروتئین استخراج شده از باکتری تراریخته پس از القای بیان در سه زمان و شاهد بدون القاء در شکل 6 نشان داده شده است.

 

شکل6- ژل آکریل‌آمید الکتروفورز پروتئین استخراج شده از باکتری تراریخته پس از القای بیان در سه زمان، C: کنترل، باکتری غیرتراریخته،M : مارکرپروتئینی170 کیلودالتون، 1: نمونه بدون القاء 2: نمونه پس از دو ساعت القاء 3:  نمونه پس از 4 ساعت القاء 4: نمونه پس از ۶ ساعت القاء

مقایسه الگوی پروتئینی شاهد با باکتریهای تراریخته القاء شده، نشان دهنده تولید پروتئین‌ نوترکیب بود. پس از لیز باکتری و سانتریفیوژ کردن و جداسازی فاز محلول و رسوب، باند مربوط به پروتئین نوترکیب بر روی ژل مشاهده گردید. بر اساس الگوی الکتروفورز روی ژل SDS- PAGE وزن مولکولی آنزیم نوترکیب معادل 25 کیلو دالتون به دست‌آمد. در مطالعات پیشین که جهت مطالعه و دستورزی ژن LicBM2 انجام گرفته نیز وزن آنزیم لیکیناز 25 کیلودالتون معرفی شده ‌است (3). پروتئینهای هترولوگ در سیستم بیانی پروکاریوتی به صورت نامحلول و اینکلوژن بادی در سیتوزول سلول میزبان تجمع می‌یابند. دراین مطالعه از وکتور (+) pET22b استفاده شد که دارای پروموتورقوی  T7می‌باشند و بیان بالایی از ژن پایین دست خود را حمایت می‌کنند. سرعت زیاد تولید پروتئین نوترکیب در باکتری بیانیBL21E.coliمنجر به تجمع پروتئین هترولوگ در سیتوپلاسم میزبان ، به فرم اینکلوژن بادی می‌شود (14).

لییو و همکاران (2001) در پژوهشی ژن مولد آنزیم بتاگلوکاناز را از یک باکتری ترموفیل به نام
Bacillus stearothermophilusجداسازی و در وکتور PTB53 ,PTB90 کلون نمودند. یافته‌های آنها نشان داد که میزان بیان ژن در باکتری یاد شده در مقایسه با باکتری  ایشرشیاکلی کمتر می‌باشد، در این مطالعه تخلیص پروتئین نوترکیب با روش تیمار حرارتی با توجه به مقاومت دمایی صورت گرفت (9‌). همچنین ایشان با بیان آنزیم بتاگلوکاناز در باکتری ایشرشیاکلی توانستند یک آنزیم نوترکیب مقاوم به حرارت با فعالیت نسبی 506  میلی‌گرم بر میلی‌لیتر تولید کنند (12). فنسلو و همکاران( 2009) با شناسایی سویه CBBD302 از باسیلوس فورمیس موفق به بیان 26 برابری آنزیم بتاگلوکاناز به صورت نوترکیب شدند(4).

ساکورابا و همکاران (2014)  با جداسازی ژن بتاگلوکاناز از باکتری باسیلوس لیکینی فورمیس و بهینه سازی کدون و بیان آن در مخمرPichia  pastoris موفق به بیان این آنزیم با فعالیت 11000 واحد در میلی لیترشدند (13).

تا کنون تلاش و تحقیقات فراوانی در رابطه با چگونگی میزان استفاده از آنزیم در جیره‌های غذایی طیور گوشتی که با مواد غذایی ارزان‌تر طراحی شده‌اند به عمل آمده است. امروزه صنعت پرورش دام و سایر علوم وابسته به طور عمده‌ای به این باور رسیده است که آنزیمها و پروبیوتیکها، افزودنیهای غذایی با ارزشی هستند که به طور قابل توجه باعث افزایش عملکرد و کیفیت محصولات تولیدی می‌شوند. از این رو تقاضا جهت تولید انواع آنزیمهای افزودنی نوترکیب رو به افزایش است. بدین منظور سیستمهای بیانی باکتریایی، قارچی، حشره، پستانداران و گیاهان برای تولید این پروتیئنها مورد مطالعه قرار گرفته‌اند. از این میان سلولهای باکتریایی با بیان نسبی بالا از ژنهای هترولوگ مورد توجه قرار گرفته‌اند. همچنین در سیستم باکتریایی، پروتئینهای نوترکیب به شکل اجسام نامحلول در سیتوزول رسوب می‌کنند. نتایج این تحقیق نشان دهنده بیان مناسب ژن LicBM2‌ در سیستم بیانی باکتریایی می باشد. اهمیت این سیستم، به دلیل وجود پروموتر قوی T7 است. تولید با میزان مناسب، تاخوردن صحیح و حفظ فعالیت آنزیم، استفاده از این سیستم در مقیاس صنعتی را ممکن می‌سازد.

آنزیم لیکیناز کد شده توسط ژن دستکاری شده LicBM2‌ که از باکتری thermocellum Clostridium  به دست ‌آمده ‌است، یک‌ کمپلکس‌ چند آنزیمی ‌خارج‌ سلولی ‌است که پیوندهای ‌بتا(1-4) مجاور ‌پیوندهای‌ بتا(1-3) در بتاگلوکانها (لیکینان ) را هیدرولیز می‌کند اما بر پیوندهای(1-3) و یا (1-4) معمولی اثری ندارند. درحالی که انواع بتاگلوکان‌ و آنزیمهای خانواده گلوکاناز در بسیاری از موجودات یافت می‌شوند، لیکیناز و لیکینان در موجودات یوکاریوتی وجودندارند، این ‌موضوع مشخص ‌می‌کند که آنزیم لیکیناز مقاوم به حرارت را می‌توان به عنوان یک آنزیم در تغذیه بسیاری ازموجودات یوکاریوتی به کار برد بدون اینکه به لحاظ ایمنی زیستی مانعی در استفاده از این آنزیم وجود داشته باشد. از طرفی بتا (1-3) (1-4) گلوکان (لیکینان‌) ترکیب پلی‌ساکاریدی از دیواره سلولی گیاهان عالی خانواده پواسه است و در دیواره سلولی اندوسپرم غلات تجاری همچون جو، چاودار، سورگوم، برنج و گندم وجود دارد (12). بنابراین آنزیم تولید شده در این تحقیق کاملاً اختصاصی عمل کرده و پس از اضافه شدن به جیره طیوری که با جو تغذیه می‌شوند، لیکینان موجود در جو را تجزیه کرده و گلوکز موجود در آن را برای طیور قابل استفاده می‌کند. این آنزیم‌ غذایی می‌تواند باعث بهبودی در قابلیت دسترسی پلی ساکاریدهای غیر نشاسته‌ای شود و از این مهمتر باعث کاهش اثرات منفی این ترکیبات بر چسبندگی مواد غذایی گردد (9) آنزیم بتاگلوکاناز اثر معنی داری بر ویژگیهای عملکردی پرندگان تغذیه شده با این مکمل غذایی از جمله افزایش وزن،  میزان زرده تخم مرغ و ضخامت پوسته تخم مرغ دارند. همچنین استفاده از جو در جیره غذایی طیور به جای ذرت سبب کاهش هزینه تولید و پرورش طیور شده و نیاز به واردات ذرت را کاهش می‌دهد (8).

بررسی ویژگیهای بهینه فعالیت کاتالیتیکی آنزیمها در تعیین حوزه مناسب کاربرد صنعتی آنها اهمیت ویژه‌ای دارد. با توجه به دامنه دمایی بهینه، آنزیم مورد بررسی قابلیت استفاده در صنعت خوراک دام و طیور را دارد. از آنجا که دامنه دمایی فعالیت بهینه آنزیم با دمای مناسب رشد باکتری یکی نیست امکان تأمین بهداشت تغذیه‌ای طیور ممکن خواهد بود. اگر چه بهینه سازی محیط و شرایط کشت به منظور افزایش بهره وری و کاهش هزینه تولید ضروری به نظر می‌آید.

1- Apiraksakorn J. Nitisinprasert S. Levin R.E. 2008. Grass degrading beta-1,3-1,4-D-glucanases from Bacillus subtilis GN156: purification and characterization of glucanase J1 and pJ2 possessing extremely acidic pI. Appl Biochem Biotechnol. 149(1):53-66. doi: 10.1007/s12010-007-8058-2. Epub 2008 Oct 17.

2- Cantwell B.A. McConnel D.J. 1983. Molecular cloning and expression of a Bacillus subtilis β-glucanase gene in Escherchia coli. Gen. 23:211-219.

3- Duan F. Lu X. Duan Y.  Gao P. 2011. Effect of continuous temperature change on hydrolytic products of yeast beta-glucan by endo-beta-1,3-glucanase. Sheng Wu Gong Cheng Xue Bao. 27(7):1092-9.

4- Fenselau C. Havey C. Teerakulkittipong N. Swatkoski S. Laine O.  Edwards N. 2008. Identification of beta-Lactamase in Antibiotic-Resistant Bacillus cereus Spores. Applied and Environmental Microbiology. 74, 904-906

5- Furtado G.P. Ribeiro L.F. Santos C.R. Tonoli C.C. De Souza A.R. Oliveira R.R. Murakami M.T.  Ward R.J. 2011. Biochemical and structural characterization of a beta1,3-1,4-glucanase from Bacillus subtilis 168. Process Biochemistry. 46, 1202-1206.

6- Junqi Z. Pengjun S. Tiezheng Y. Huoqing H. Zhongyuan Li.  Kun Meng. Peilong Y. Bin Y. 2012. Purification, gene cloning and characterization of an acidic β-1,4-glucanase from Phialophora sp. G5 with potential applications in the brewing and feed industries. Journal of Bioscience and Bioengineering. 114:379–384.

7- Lamp A. E. Evans A. M. Moritz J. S. 2015. The effects of pelleting and glucanase supplementation in hulled barley based diets on feed manufacture, broiler performance, and digesta viscosity. The Journal of Applied Poultry Research. 24(3):296-303.

8- Liu J. H. Tsai C. F. Liu J. W. Cheng K.J. Cheng C. L. 2001. The catalytic domain of a Piromyces rhizinflata cellulase expressed in Escherichia coli was stabilized by the linker peptide of the enzyme. Enzyme Microbiol. Technol. 28:582-589.

9- Liu J. R. Yu B. Liu F. H. Cheng K. J. Zhao X. 2005. Expression of rumen microbial fibrolytic enzyme genes in probiotic Lactobacillus reuteri. Appl Environ Microbiol. 71 (11):6769-6775.

10- Miller GL. 1959. Use of dinitrosalicylic acid reagent for determination of rediucing sugar. Anal. Chem. 31:420-428.

11- Olubusola A.O. Oniludy A.A. Aleyode M.A. 2012. Carachtterstics of β- 1, 3- 1,4 glucanase form    trichoderma virenswholly applied in palm fruite for poultry layers. Breazilian journal of microbiology. University of Ibadan. Ibadan. Nigeria. 54: 1467-1475.

12- Perttila S. Valaja J. Partanen K. Jalava T. Kiiskinen T. Palander S. 2001. Effects of preservation method and beta-glucanase supplementation on ileal amino acid digestibility and feeding value of barley for poultry. Br Poult Sci. 42 (2):218-229.PNAS 1986 83 (3) 576-580

13- Sakuraba Y. Jeong J. Kang M.Y. Kim J. Paek N.C. Choi G. 2014. Phytochrome-interacting transcription factors PIF4 and PIF5 induce leaf senescence in Arabidopsis. Nature Communications.5: 4636.

14- Singh A. Upadhyay V. Upadhyay A.K. Singh S.M.  Panda A.K. 2015. Protein recovery from inclusion bodies of Escherichia coli using mild solubilization process. Microbial Cell Factories. 14, 41.

15- Teng D. Wang J.H. Fan Y. Yang Y.L. Tian Z.G. Luo J. Yang G.P.  Zhang F. 2006. Cloning of beta-1,3-1,4-glucanase gene from Bacillus licheniformis EGW039 (CGMCC 0635) and its expression in Escherichia coli BL21 (DE3). Appl Microbiol Biotechnol. 72(4):705-12. Epub 2006 Feb 10.

16- Zhao J. Shi P. Yuan T. Huang H. Meng Z. K  Li. Yang P. Yao B. 2012. Purification, gene cloning and characterization of an acidic β-1,4-glucanase from Phialophora sp. G5 with potential applications in the brewing and feed industries. J Biosci Bioeng. 114(4) 379-384. doi:10.1016/j.jbiosc.2012.04.021. PMID: 22621953.