نوع مقاله: مقاله پژوهشی

نویسندگان

1 دانشجوی کارشناسی ارشد دانشگاه گنبد کاووس

2 دانشگاه گنبدکاووس

3 استادیار دانشگاه گنبد کاووس

4 استادیار پژوهش بخش تحقیقات زراعی و باغی، مرکز تحقیقات و آموزش کشاورزی و منابع طبیعی مازندران

5 دانشجوی دکتری کشاورزی هسته‌ای دانشگاه علوم کشاورزی و منابع‌ طبیعی گرگان

چکیده

به منظور مکان‌یابی QTL‌های کنترل کننده صفات مربوط به سنبله جمعیتی شامل 103 خانواده جو حاصل از تلاقی ارقام بادیا × کویر به مدت دو سال (95-1393) در مزرعه تحقیقاتی دانشگاه گنبدکاووس در قالب طرح بلوک‌های کامل تصادفی با سه تکرار ارزیابی شدند. صفات مورد بررسی شامل تعداد دانه در سنبله، طول سنبله، تعداد سنبلچه در سنبله، وزن کل سنبله، تعداد کل سنبله و طول ریشک بودند. براساس مکان‌یابی فاصله‌ای مرکب برای صفات مورد مطالعه در مجموع 19 QTL بدست آمد. واریانس فنوتیپی توجیه شده به وسیله این QTL‌ها از 10 تا 34 درصد متغیر بود. بیشترین و کمترین واریانس فنوتیپی به ترتیب برای صفات تعداد دانه در سنبله و وزن و طول سنبله در سال دوم بدست آمد. بیشترین و کمترین LOD به ترتیب مربوط به QTL‌های تعداد دانه در سنبله و طول سنبله در سال دوم بدست آمد. اثر افزایشی مثبت و منفی برای QTL‌های شناسایی شده بیان‌گر انتقال آلل‌های مطلوب از هر دو والد به نتاج در جایگاه‌های مذکور بود. پنج QTL مشترک برای صفات تعداد دانه در سنبله، وزن کل سنبله، تعداد سنبلچه در سنبله، طول سنبله و طول ریشک مکان‌یابی گردید نشانگرهای دارای پیوستگی شدید با QTL‌های بزرگ اثر، می‌توانند در برنامه‌های گزینش به کمک نشانگر برای گزینش خانواده‌های برتر و نیز انتقال آلل‌های مطلوب به ارقام اصلاحی مورد استفاده قرار گیرند.

کلیدواژه‌ها

موضوعات

عنوان مقاله [English]

Importance of chromosome 4 in genetic controlling Spike Related Traits in Barley

نویسندگان [English]

  • Hosein Saboori 2
  • Mahnaz Katoozi 5

2 University of Gonbade Kavoos

5 Dept. of Plant Breeding and Biotechnology, Gorgan Agriculture Science and Natural Resources, Gorgan, I.R. of Iran

چکیده [English]

In order to identify QTLs controlling traits related to spike population of 103 family of barely derived from the cross of Badia and Kavir were assessed based on randomized complete block design with three replications at the Agriculture and Natural Resource of Gonbad Kavous University in 2014 and 2016. The studied traits were grains number in spike, spike length, spiklets in spike, total spike weight, total spike and awn length. Based on composite interval mapping, nineteen QTLs were identified for the traits under study. Phenotypic variation that were explained by these QTLs, varied from 10-34%. The highest and lowest phenotypic variations were related to grains in spike and spike weight, spike length in the second year respectively. The Highest and loest LOD scores were obtained for the QTLs of grains in spike and spike length in the second year respectively. Negative and positive additive effects for identified QTLs showed the inheritance of favorable alleles from both parental lines to progenies in the detected loci. For the studied traits, five QTLs were common for grain number per spike, spike weight, number of spikelets per spike, spike length and awn length was locating. The markers showed tight linkage with major QTLs, could be used in marker assisted selection breeding programs for selection of superior family and incorporating of favorable alleles in to commercial barley varieties.

کلیدواژه‌ها [English]

  • Barley
  • QTL analysis
  • Microsatellite Markers
  • Linkage Map

اهمیت کروموزوم 4 در کنترل ژنتیکی صفات مرتبط با سنبله در جو

زینب تقی­زاده1، حسین صبوری1*، حسین حسینی­مقدم1، حسین‌علی فلاحی2 و مهناز کاتوزی3

1 ایران، گنبدکاووس، دانشگاه گنبدکاووس، دانشکده کشاورزی، گروه تولیدات گیاهی

2 ایران، ساری، سازمان تحقیقات آموزش و ترویج کشاورزی، بخش تحقیقات زراعی و باغی

3ایران، گرگان، دانشگاه علوم کشاورزی و منابع طبیعی گرگان، گروه اصلاح نباتات و بیوتکنولوژی

تاریخ دریافت: 26/9/95                تاریخ پذیرش: 25/4/96

چکیده

به منظور مکان­یابی QTL­های کنترل­کننده صفات مربوط به سنبله جمعیتی شامل 103 خانواده F3 و F4 جو حاصل از تلاقی ارقام بادیا × کویر به­مدت دو سال (95-1393) در مزرعه تحقیقاتی دانشگاه گنبدکاووس در قالب طرح بلوکهای کامل تصادفی با سه تکرار ارزیابی شدند. صفات موردبررسی شامل: تعداد دانه در سنبله، طول سنبله، تعداد سنبلچه در سنبله، وزن کل سنبله، تعداد کل سنبله و طول ریشک بودند. بر اساس مکان­یابی فاصله­ای مرکب برای صفات مورد مطالعه در­مجموع 19 QTL به دست آمد. واریانس فنوتیپی توجیه شده به وسیله این QTL­ها از 10 تا 34 درصد متغیر بود. بیشترین واریانس فنوتیپی در سالهای اول و دوم به ترتیب برای صفات طول ریشک و تعداد دانه در سنبله به دست آمد. بیشترین و کمترین LOD به ترتیب مربوط به QTL­های تعداد دانه در سنبله و طول سنبله در سال دوم به­دست آمد. اثر افزایشی مثبت و منفی برای QTL­های شناسایی­شده بیان­گر انتقال آللهای مطلوب از هر دو والد به نتاج در جایگاههای مذکور بود. پنج QTL مشترک برای صفات تعداد دانه در سنبله، وزن کل سنبله، تعداد سنبلچه در سنبله، طول سنبله و طول ریشک مکان­یابی گردید نشانگرهای دارای پیوستگی شدید با QTL­های بزرگ اثر، می­توانند در برنامه­های گزینش به­کمک نشانگر برای گزینش خانواده­های برتر و نیز انتقال آللهای مطلوب به ارقام اصلاحی مورد استفاده قرار گیرند.

واژه­های کلیدی: تجزیه QTL، جو، نقشه پیوستگی، نشانگر ریز ماهواره.

* نویسنده مسئول، تلفن: 09111438917 ، پست الکترونیکی: hos.sabouri@gmail.com

مقدمه

 

جو پس از گندم، ذرت و برنج چهارمین غله مهم در جهان، با تولیدی در حدود 160-150 میلیون تن است و جزء ده محصول برتر جهان به­ شمار می‌آید. ایران با تولید 6/3 میلیون تن جو در سال، سیزدهمین کشور تولید کننده جو در جهان است (28). این محصول، در بسیاری از نواحی جهان به دلایل فرهنگی و اقتصادی به علت استفاده در تولید مالت، کشت می‌شود (12). صفات مربوط به مورفولوژی سنبله ازجمله تراکم دانه، طول سنبله و طول ریشک از اهمیت مهمی در بهبود غلات محسوب می­شوند. طول سنبله و تراکم دانه از مهم­ترین صفات مورفولوژی سنبله در جو هستند. این دو صفت نه­تنها در عملکرد تأثیر می­گذارند بلکه عصاره مالت جو را هم تحت تأثیر قرار می­دهند (10). یکی از کاربردهای مهم نشانگرهای مولکولی، بهبود و افزایش کارآیی روشهای مرسوم اصلاح نباتات از طریق انتخاب غیرمستقیم توسط نشانگرهای مولکولی پیوسته با صفات است. نشانگرهای مولکولی در مورد صفات تک ژنی و هم در مورد مکانهای کنترل­کننده صفات کمی مورد استفاده قرار می­گیرد. امروزه از نشانگرهای مولکولی در مطالعات تنوع ژنتیکی، تهیه نقشه ژنتیکی و مکان­یابی ژنها استفاده می­شود (2و5). نشانگرهای مولکولی چون تحت تأثیر محیط قرار نمی­گیرند، در تمام مراحل رشدی گیاه می­توان آنها را به کار برد (22). QTL قسمتی از ژنوم است که تأثیر زیادی روی تظاهر صفت کمی می­گذارد و معمولاً شامل تعداد بسیار زیادی ژن است که همه یا بعضی و یا گاهی حتی فقط یکی از آنها به صفت کمی مربوط می­باشد و معمولاً بیش از یک QTL برای صفت کمی شناسایی می‌شود (11).

شاهین­نیا و همکاران (4) به­منظور مکان­یابی QTL های کنترل­کننده عملکرد و اجزای عملکرد در 99 لاین اینبرد نوترکیب نسل F13 جو حاصل از تلاقی دو والد Kanto Nakate Gold و Azumamugi با استفاده از 62 نشانگر AFLP، 34 نشانگر STS، 2 نشانگر ایزوزایم و 2 نشانگر مورفولوژیک برای تعداد دانه در سنبله یک QTL در فاصله نشانگرهای e13m 23.6 و e13m31.7.1 روی بازوی کوتاه کروموزوم H2 با توجیه 4 درصد از کل واریانس فنوتیپی مرتبط با این صفت شناسایی کردند.

پیغمبری و همکاران (21) به منظور مکان­یابی صفات زراعی در جمعیت دابلد هاپلویید جو دو QTL برای روز تا رسیدگی، دو QTL برای طول سنبله، یک QTL برای تعداد دانه در سنبله، سه QTL برای وزن هزار دانه و یک QTL برای عملکرد دانه ردیابی کردند. در تحقیق دیگری در یک جمعیت F2:3جو جهت شناسایی نواحی ژنومی (QTL) کنترل­کننده عملکرد و اجزای آن از طریق نشانگر­های ریز ماهواره دو QTL qTW-6a) و (qTW-6b برای کنترل وزن هزار دانه شناسایی شد هر دو ناحیه ژنومی بر روی کروموزوم 6H قرار داشت. همچنین برای صفت تعداد دانه در سنبله چهار ناحیه ژنومی بر روی کروموزومهای 1H، 3H، 6H و 7H توانستند بیش از 62 درصد از تغییرات ژنتیکی این صفت را توجیه نمایند. مهم­ترین QTL بر روی کروموزوم 1H قرار داشت که به­تنهایی 28 درصد از تنوع این صفت را توجیه نمود (3). بنت و همکاران (9) جهت مکان­یابی QTL­های کنترل­کننده عملکرد و اجزای عملکرد جو بهاره به­وسیله نشانگر رگرسیون، هفت QTL برای وزن هزار دانه و پنج QTL برای تعداد دانه در سنبله شناسایی کردند. لی و همکاران (15) مکان­یابی QTL­های کنترل کننده عملکرد و اجزای عملکرد را در جمعیت جو بهاره با استفاده از 60 نشانگر ریز ماهواره انجام دادند آنها برای عملکرد دانه سه QTL دو QTL برای تاریخ سنبله­دهی و چهار QTL برای طول سنبله شناسایی کردند که همه QTL­های شناسایی شده تقریباً 10 درصد از واریانس فنوتیپی صفت مربوطه را کنترل کردند. سه QTL برای تعداد سنبلچه در سنبله شناسایی شد که این QTL­ها 5/7 تا 8/36 درصد از واریانس فنوتیپی صفت مربوطه را با LOD 24/1 تا 08/8 توجیه کردند. احمدی و همکاران (1) به منظور مکان­یابی QTL­های کنترل­کننده اجزای عملکرد در 59 لاین، تلاقی برگشتی پیشرفته برای طول سنبله در هریک از کروموزومهای 2، 4، 11 و 12 تعداد دو QTL را مکان­یابی کردند و برای تعداد سنبلچه سه QTL (دو QTL با اثر افزایشی منفی و یک QTL با اثر افزایشی مثبت) که در کروموزومهای 1 و12 واقع بودند را شناسایی کردند. اهداف اصلی این تحقیق، مکان­یابی QTL­ها، برآورد میزان تأثیر هر یک از QTL­ها و تعیین نشانگرهای مولکولی پیوسته با QTL­ها و پیشنهاد آنها برای گزینش به کمک نشانگر می­باشد.

مواد و روشها

به منظور مکان­یابی QTL­های مرتبط با صفات سنبله در جو، آزمایشی با 103 خانواده حاصل از تلاقی دو رقم بادیا و کویر در نسلهای F3 (سال اول) و F4 (سال دوم) در مزرعه تحقیقاتی دانشکده کشاورزی دانشگاه گنبدکاووس در قالب طرح بلوکهای کامل تصادفی با سه تکرار به مدت دو سال (93-1394 و 94-1395) انجام شد. هر خانواده در خطوط یک متری بافاصله بین ردیف 20 سانتیمتر کشت شد. تهیه زمین و عملیات کاشت بر اساس عرف اجرای آزمایشهای غلات انجام شد. برای ارزیابی فنوتیپی، صفات تعداد کل سنبله (مترمربع)، وزن کل سنبله (گرم)، تعداد دانه در سنبله، تعداد سنبلچه در سنبله، طول سنبله (سانتیمتر) و طول ریشک (سانتیمتر) در 103 خانواده  F3 و F4 و 20 بوته از هر خانواده در سه تکرار اندازه­گیری شد و میانگین هر خانواده برای تجزیه QTL مورد استفاده قرار گرفت. جهت ارزیابی ژنوتیپهای والدینی برای شناسایی نشانگرهای چند شکل و همچنین غربال مولکولی جمعیت، استخراج DNA از نمونه­های برگ والدینی و گیاهچه­های F3 که از قبل در دمای 80- درجه سانتی­گراد نگهداری شده بودند، با استفاده از روش CTAB سقای معروف و همکاران (26) انجام شد. کمیت و کیفیت DNA نمونه‌ها با استفاده از روش الکتروفورز DNA روی ژل  آگارز 8/0 درصد بررسی شد. کلیه ارزیابیهای ژنوتیپی مربوطه در آزمایشگاه ژنتیک دانشکده کشاورزی دانشگاه گنبدکاووس انجام شد. به­منظور تهیه نقشه ژنتیکی و شناسایی QTL­های کنترل کننده صفات مورد مطالعه،  ISSR و 29 نشانگر SSR بر روی والدین مورد ارزیابی قرار گرفتند و نشانگرهای چند شکل بین والدین برای ثبت داده­های ژنوتیپی افراد جمعیت مورد استفاده قرار گرفتند. از بین 29 نشانگر SSR، از 7 نشانگر چند شکل (به ازای هر کروموزوم یک نشانگر) و از 60 آلل چند شکل ISSR برای تهیه نقشه استفاده شد. توالی آغازگرهای چند شکل SSR و ISSR در جدول 1 ارائه شده است. واکنش زنجیره­ای پلیمراز (PCR) در دستگاه ترموسایکلر (Applied Biosystems- 2720, USA) انجام شد. برنامه حرارتی و دوره­های زمانی واکنش زنجیره­ای پلی­مراز به منظور کاهش تکثیر نوارهای الکتروفورز اضافی و تکثیر اختصاصی، با توجه به دمای اتصال آغازگرها، طی برنامه کاهش دمایی (Touch down PCR) انجام شد. جهت تهیه نقشه ژنتیکی از اسکورهای 1 (برای وجود باند) و 2 (برای عدم وجود باند) در نشانگرهای ریزماهواره استفاده شد. در مورد نشانگرهای ISSR از اسکورهای 1 (برای وجود باند) و 3 (برای عدم وجود باند) در مواقعی که باند در والد اول تکثیر یافته بود، استفاده شد. همچنین در مورد نشانگرهای ISSR از اسکورهای 2 (برای وجود باند) و 4 (برای عدم وجود باند) در مواقعی که باند در والد دوم تکثیر یافته بود استفاده شد. خاطر نشان می شود که برچسب زدن نشانگرهای تصادفی به نشانگرهای ریزماهواره برای هر کروموزوم جداگانه انجام شد. بنابراین با استفاده از نرم‍افزارMap manager QTX17  (16) تجزیه های دو نقطه­ای، سه نقطه­ای و نهایتا چند نقطه­ای برای هر کروموزوم و با حد بحرانی برای LOD=2، فاصله و ترتیب بین نشانگرها براساس تابع کوزامبی (14) در هر کروموزوم مشخص شد. به­منظور شناسایی ­QTL­های کنترل­کننده صفات مورد مطالعه از روش مکان­یابی فاصله­ای مرکب و نرم­افزار Win QTL Cartographer 2.5 (8) استفاده گردید. برای ترسیم نقشه و محل QTLها از نرم افزار map Chart (30) استفاده شد. محاسبه همبستگی صفات با استفاده از نرم­افزار SPSS 23 (13) انجام شد.

نتایج و بحث

همبستگیهای ساده فنوتیپی 103 خانواده F3 و F4 به همراه والدین­ برای صفات مورد مطالعه در جدول 2 نشان داده شده است. در سال اول بیشترین همبستگی به صفات تعداد سنبله و وزن کل سنبله (**74/0) و پس از آن به صفات تعداد سنبلچه در سنبله و طول سنبله (**69/0) تعلق داشت. تعداد سنبلچه در هر دو سال با طول سنبله همبستگی مثبت و معنی­دار داشت. همبستگیهای بالای تعداد سنبلچه با طول سنبله ممکن است ناشی از هممکانی QTL­های کنترل­کننده آنها باشد.

 

 

 

جدول 1- نشانگرهای SSR و ISSR چندشکل مورد استفاده در تهیه نقشه پیوستگی جمعیت­هایF3  و F4 جو حاصل از تلاقی ارقام بادیا و کویر.

چند شکلی

توالی معکوس / توالی مستقیم

کروموزوم

نشانگر

(پلی­مورف)

CTCCACGAATCTCTGCACAA/CACCGCCTCCTCTTTCAC

1

HVM20

(پلی­مورف)

TCCAGCCGAACAATTTCTTG/AGTACTCCCACACCACGTCC

2

HVM36

(پلی­مورف)

GGTCGGTTCCCGGTAGTG/TCCTGATCCAGAGCCACC

3

HVM27

(پلی­مورف)

GTCGGGCTCCATTGCTCT/CCGGTACCCAGTGACGAC

4

HVM67

(پلی­مورف)

AGTGGGGAATGAGAGAATGG/TGCTTGTGGGGCATCACAC

5

HVM30

(پلی­مورف)

AGACATCCAAAAAATGAACCA/TGGTAACTTGTCCCCCAAAG

6

HVM65

(پلی­مورف)

AGAGCAACTACCAGTCCAATGGCA/GTCGAAGGAGAAGCGGCCCTGGTA

7

HVM4

(منومورف)

CTCTATAGGCACGAAAAATTCC/TTGCACATATCTCTCTGTCACA

7

HVM49

(منومورف)

ATATTAAAAAAGGTGGAAAGCC/CACGCCCTCTCCCTAGAT

3

HVM33

(منومورف)

ATTGGCGTGACCGATATTTATGTTCA/CAAAACTGCAGCTAAGCAGGGGAACA

2

HVBKASI

(منومورف)

AGGACCGGATGTTCATAACG/CAAATCTTCCAGCGAGGCT

4

HVM68

(منومورف)

TTAGGGCTACGGTTCAGATGTT/ACGTTGTTCTTCGCTGCTG

5

HVDHN7

(منومورف)

AACGACGTCGCCACACAC/AGGAACGAAGGGAGTATTAAGCAG

7

HVM5

(منومورف)

CAATGATGCGGTGAACTTTG/CCTCGGATCTATGGGTCCTT

3

HVM60

(منومورف)

CCGCCGATGACCTTCTC/ACCCACGACCTATGGCAC

1

HVM70

(منومورف)

AGGAAGTCATTGCGTGAG/TGATCAAGAATGATAACATGG

6

HVM74

(منومورف)

TTGGAAGTGTACAGCAATGGAG/TGAAAGGCCCCACAAGATAG

5

HVLEU

(منومورف)

TCTAAATTACCTTCCCAGCCA/AAAGCAGACATGTAGGAGGTCA

7

HVM51

(منومورف)

GGATTTTCTCAAGAACACTT/GCGTGAGTGCATAACATT

1

HVM43

(منومورف)

CGGTTTCTGGTTGCTTGG/CGAAGGTCTCAGGCTTCATG

6

HVM31

(منومورف)

CTTCGACACCATCACCCAG/ACCAAAATCGCATCGAACAT

3

HVM9

(منومورف)

CATGGACAAGATCAAGGAGAAG/CCCATTATTTATCTGTAGGAACGC

5

HVDHN9

(منومورف)

CATGAATGAATGATTGGTTTTG/CGCATCCGTATGTATGAGTAA

5

HVM6

(منومورف)

AGTAGCTATGTGTTTGGATCGC/CATCAAGGGCATCCTCATG

6

HVM13

(منومورف)

ATGTAGCGGAAAAAATACCATCAT/CCTAGCTAGTTCGTGAGCTACCTC

7

HVM7

(منومورف)

CGCGCAAGCATGAATACTC/ACTCACAAGTGGCGCGTAC

1

HVM63

(منومورف)

GATGTGAAGGCTGCCCTG/ACACGCCCTATTACCCAGTG

1

HVM64

(منومورف)

CGATCAAGGACATTTGGGTAAT/AACTCTTCGGGTTCAACCAATA

6

HVM14

(منومورف)

AACCCAGTAACACCGTCCTG/AGTTCCCTGACCCGATGTC

2

HVM54

 (6 باند پلی­مورف)

GAGAGAGAGAGAGAGAA

-

ISSR131

 (8 باند پلی­مورف)

CTCTCTCTCTCTCTCTG

-

ISSR16

 (4 باند پلی­مورف)

CTCTCTCTCTCTCTCT

-

ISSR20

 (7 باند پلی­مورف)

CTCTCTCTCTCTCTCTT

-

ISSR22

 (7 باند پلی­مورف)

TCTCTCTCTCTCTCTCA

-

ISSR29

 (7 باند پلی­مورف)

GAGGAGAGAGAGAGAG

-

ISSR30

 (5 باند پلی­مورف)

GAGAGAGAGAGAGAGA

-

ISSR31

 (7 باند پلی­مورف)

GGAAGGAAGGAAGGAAGGAAT

-

ISSR38

 (8 باند پلی­مورف)

CTCCTCCTCCTCCTCCTCG

-

ISSR47

 (6 باند پلی­مورف)

ACACACACACACACACACACTA

-

ISSR48


وجود همبستگیهای بین صفات به وسیله اثرات پلیوتروپی یا پیوستگی شدید بین ژنهای کنترل‌کننده آنها توجیه می‌شود. صفات همبسته اغلب به­وسیله QTL­های کنترل می­شوند که در نواحی مشابهی بر روی کروموزومها قرار دارند (20 و 33) چنین نتایجی برای، وزن کل سنبله و تعداد سنبلچه، تعداد دانه در سنبله و تعداد سنبلچه در سنبله، وزن کل سنبله و طول سنبله در هر دو سال مشاهده شد. در این بررسی اثرات پلیوتروپی یا پیوستگی بین ژنهای کنترل­کننده صفات مورد بررسی را مورد تأیید قرار داد. ولدبوم و همکاران (29) و آستویت (7) همبستگی مثبت و بالایی را بین تعداد دانه در سنبله با عملکرد دانه گزارش نمودند.

شناسایی QTL­های صفات موردبررسی در سال اول: QTL­های کنترل­کننده صفات مورد مطالعه در 103 خانواده جو حاصل از تلاقی ارقام بادیا و کویر در دو سال، جمعیت F3 سال اول و جمعیت F4 سال دوم در جدول 3 و شکل 1 نشان داده شده است. به­طوری که ملاحظه می­شود کروموزوم 4 در برگیرنده QTL­های کنترل­کننده کلیه صفات مورد مطالعه بود. نتایج حاصل از مکان­یابی فاصله­ای مرکب برای تعداد دانه در سنبله حاکی از تظاهر یک QTL واقع بر کروموزوم 4 پیوسته به نشانگر ISSR36-1 با توجیه 9/12 درصد از کل واریانس فنوتیپی و نقش افزاینده آللهای والد بادیا در کنترل این صفت شناسایی شد. میزان LOD برای این QTL برابر 49/2 بود (جدول2). میکولوچک و همکاران (18) به منظور مکان­یابی جایگاه صفات کمی برای عملکرد دانه و صفات مرتبط با آن در جمعیت جو بهاره حاصل از تلاقی ارقام اروپایی و سوریه­ای در طول سه سال زراعی 89 QTL شناسایی کردند. 12 QTL برای تعداد دانه در سنبله اصلی مکان­یابی شد همه QTL­های شناسایی شده برای تعداد دانه در سنبله در کروموزوم H2 و H6 و 2H.7 دارای اثرات منفی بر تعداد دانه در سنبله داشتند.

برای تعداد کل سنبله (جدول 2) نیز یک QTL با توجیه 5/10 درصد از واریانس فنوتیپی این صفت در فاصلهنشانگرهایISSR38-1 و ISSR20-1 در کروموزوم 4 شناسایی شد این مکان با نقش کاهنده آلل والد بادیا در کنترل تعداد کل سنبله سهیم بود. رن و همکاران (24) به منظور مکان­یابی QTL­های کنترل­کننده صفات زراعی و کیفیت صفات در 122 جمعیت دابلد هاپلویید جو حاصل از تلاقی Huaai 11 × Huadamai 6 با استفاده از 166 نشانگر ریز  ماهواره در طول سه سال زراعی با استفاده از مکان­یابی فاصله­ای مرکب 17 QTL شناسایی نمودند. در سال دوم یک QTL برای تعداد سنبله شناسایی کردند که این QTL در کروموزوم 7 با QTL تعداد سنبلچه هممکان بود و 36/15 درصد از واریانس فنوتیپی این صفت را توجیه کرد و اثر افزایشی 70/0- باعث کاهش تعداد سنبله شد. در سال اول و سوم هیچ QTL­ای برای این صفت شناسایی نکردند.

 

جدول 2- ضرایب همبستگی بین صفات مورد مطالعه در جمعیت F3 و F4 حاصل از تلاقی ارقام بادیا و کویر.

طول ریشک

طول سنبله

تعداد سنبلچه در سنبله

تعداد دانه در سنبله

وزن کل سنبله

تعداد کل سنبله

صفت

06/0-

18/0

06/0

۰4/۰-

**74/۰

 

تعداد کل سنبله

08/0

*19/0

*20/0

10/0

 

**64/0

وزن کل سنبله

**30/0

**46/0

**49/0

 

**39/0

03/0-

تعداد دانه در سنبله

**27/0

**69/0

 

**96/0

**39/0

03/0-

تعداد سنبلچه در سنبله

09/0

 

**89/0

**89/0

**34/0

07/0-

طول سنبله

 

02/0

005/0-

005/0-

03/0-

17/0-

طول ریشک

*،**: به ترتیب نشان‌دهنده معنی‌دار بودن در سطح احتمال یک و پنج درصد می‌باشد.

اعداد بالای قطر جدول ضریب همبستگی برای جمعیت F3 و پایین قطر جدول ضریب همبستگی برای جمعیت F4 است.

جدول 3- QTL­های صفات مورد مطالعه در جمعیتهایF3وF4حاصل از تلاقی ارقام بادیا و کویر.

جهت آلل

ضریب تبیین

اثرافزایشی

موقعیت (سانتی‌مورگان)

LOD

کروموزوم

نشانگرهای مجاور*

QTL

صفت

 

 

 

 

 

سال 1393

 

 

 

بادیا

5/10

74/179-

70

49/2

4

ISSR20-1-ISSR38-1

qNS-4

تعداد کل سنبله

بادیا

9/12

31/175

0

08/3

4

ISSR36-1

qNGS-4a

تعداد دانه در سنبله

کویر

9/19

50/9

42

97/4

3

ISSR131-3-ISSR47-8

qAL-3a

طول ریشک

بادیا

15

01/1

68

62/3

3

ISSR29-7-ISSR31-5

qAL-3b

 

 

 

 

 

 

سال 1394

 

 

 

بادیا

31

38/6

0

40/8

4

ISSR31-6

qSW-4a

وزن کل سنبله

کویر

12

51/3-

68

07/3

4

ISSR20-1

qSW-4b

 

کویر

10

19/6-

100

47/2

4

ISSR38-3-ISSR131-1

qSW-4c

 

بادیا

1/21

37/6

136

30/5

4

ISSR131-1-ISSR16-4

qSW-4d

 

کویر

34

22/21-

2

59/9

1

ISSR16-5-ISSR29-3

qNGS-1

تعداد دانه در سنبله

بادیا

13

57/10

68

24/3

4

ISSR20-1

qNGS-4b

 

کویر

25

42/20-

136

50/6

4

ISSR131-1-ISSR16-4

qNGS-4c

 

کویر

3/31

90/35-

2

38/8

4

ISSR36-1-ISSR16-8

qNSS-4a

تعداد سنبلچه در سنبله

کویر

5/11

80/15-

34

73/2

4

ISSR22-5-ISSR47-5

qNSS-4b

 

بادیا

13

54/18

68

11/3

4

ISSR20-1

qNSS-4c

 

کویر

6/20

94/32-

136

14/5

4

ISSR131-1-ISSR16-4

qNSS-4d

 

بادیا

31

50/25-

2

32/8

4

ISSR36-1-ISSR16-8

qSL-4a

طول سنبله

بادیا

10

58/10-

34

4/2

4

ISSR22-5-ISSR47-5

qSL-4b

 

بادیا

20

59/23-

136

21/5

4

ISSR131-1-ISSR16-4

qSL-4c

 

بادیا

12

8/6-

2

95/2

4

ISSR36-1-ISSR16-8

qAL-4

طول ریشک

*: نشانگرهایی که زیرشان خط کشیده شده به QTL مربوطه نزدیکتر هستند.

 

برای صفت طول ریشک دو QTL (qAL-3a و qAL-3b) بر روی کروموزوم ۳ شناسایی شد. مکانهای ژنی افزاینده طول ریشک در هر دو والد وجود دارد. مجموع QTL­های موجود در سال اول به ترتیب ۹/19 و 15 درصد از تغییرات فنوتیپی صفت طول ریشک را توجیه نمودند.

شناسایی QTL­های صفات مورد بررسی در سال دوم: برای صفات بررسی شده در مجموع 19 جایگاه واجد QTL (4 جایگاه در سال اول و 15 جایگاه در سال دوم) به دست آمد. واریانس فنوتیپی توجیه شده به وسیله این QTL­ها از 34-10 درصد متغیر بود. بیشترین و کمترین واریانس فنوتیپی به ترتیب برای تعداد دانه در سنبله و وزن و طول سنبله در سال دوم به­دست آمد. LOD در دامنه 40/2 – 59/9 قرار داشت. بیشترین و کمترین LOD به ترتیب مربوط به QTL­های تعداد دانه در سنبله و طول سنبله در سال دوم بود. در سال دوم سه QTL برای طول سنبله (qSL-4a، qSL-4bو qSL-4c) بر روی کروموزوم 4 به ترتیب در جایگاههای 2، 34 و 136 سانتی­مورگان شناسایی شد که در مجموع 60 درصد از واریانس فنوتیپی این صفت را توجیه کردند. نزدیک‌ترین نشانگرها به این QTL­ها به ترتیب ISSR36-1، ISSR22-5 و ISSR131-1 بود و دارای اثر افزایشی 50/25-، 58/10- و 59/23- بودند. وانگ و همکاران (32) به منظور شناسایی و نقشه­یابی ژن کوتولگی در 92 لاین دابلد هاپلویید جو و همبستگی آن با صفات زراعی دو QTL برای طول سنبله، یک QTL برای تعداد دانه و یک QTL برای طول ریشک در کروموزوم H3 شناسایی کردند که 70 تا 81 درصد از واریانس فنوتیپی صفت مربوطه را کنترل می­کرد. وانگ و همکاران (31) به منظور مکان­یابی صفات زراعی در جو توسط نشانگرهای  SNP و SSR سه  QTL برای طول سنبله در کروموزومهای 2، 7 و 7 مکان­یابی کردند که به ترتیب 70/18، 07/3 و 72/52 درصد از واریانس فنوتیپی صفت مربوطه را کنترل کرد و یک  QTL برای تعداد سنبله در کروموزوم 5 و شش QTL برای تعداد سنبلچه در سنبله شناسایی کردند.

 

 

شکل 1- نقشه ژنتیکی استفاده شده جهت مکان­یابی QTL­های مرتبط با صفات سنبله در جمعیت­هایF3 وF4حاصل از تلاقی ارقام بادیا × کویر.

 

تعداد کل سنبله (سال اول)

 

وزن کل سنبله (سال دوم)

 

تعداد دانه در سنبله (سال اول و دوم)

 

تعداد سنبلچه در سنبله (سال دوم)

 

طول سنبله (سال دوم)

 

طول ریشک (سال اول و دوم)

 

تنها QTL شناسایی شده روی کروموزوم 1، صفت تعداد دانه در سنبله را کنترل می­کند برای تعداد دانه در سنبله سهQTLشناسایی شد. بیشترین اثر مربوطه در سال دوم QTL واقع بر روی کروموزوم 1 (در فاصله نشانگرهای ISSR16-5 و ISSR29-3) با LOD معادل 59/9 مکان­یابی شد که 34 درصد از واریانس فنوتیپی صفت را توصیف کرد، آلل والد کویر باعث افزایش تعداد دانه در سنبله شده است. در حالی که دو QTL دیگر روی کروموزوم­ 4 (qNGS-4b پیوسته به نشانگر ISSR20-1) و (qNGS-4C در فاصله نشانگرهای ISSR131-1 و ISSR16-4) شناسایی شد که  به ترتیب 13و 25 درصد از واریانس فنوتیپی صفت را کنترل کردند. مهدی­نژاد و همکاران (6) به منظور نقشه­یابی QTL­های کنترل کننده صفات فنولوژیک و مورفولوژیک 167 لاین اینبرد نوترکیب حاصل از تلاقی Seri M82 و Babax برای تعداد دانه در سنبله یک QTL بر روی کروموزوم 6B شناسایی کردند که 7 درصد از واریانس فنوتیپی صفت مربوطه را کنترل می­کرد و با QTL عملکرد بیولوژیک هممکان بود. مرضا و همکاران (17) به منظور مکان­یابی عملکرد و صفات مرتبط با آن در جمعیت اینبرد لاین حاصل از تلاقی Ning7840 × Clark با استفاده از 363 نشانگر AFLP و 47 نشانگر SSR تعداد هشت QTL برای تعداد دانه در سنبله بر روی کروموزومهای 1A، 1B، 3B، 2D، 6A و 4B شناسایی کردند.

با استفاده از روش مکان­یابی فاصله­ای مرکب چهار QTL (qNSS-4a، qNSS-4b، qNSS-4cو qNSS-4d) برای تعداد سنبلچه در سنبله در سال دوم در کروموزوم 4 مکان­یابی شدند و نزدیک‌ترین نشانگرها به این QTL­ها به ترتیب نشانگرهای ISSR36-1، ISSR22-5، ISSR20-1 و ISSR131-1 بودند که چهار QTL در مجموع 75 درصد از تغییرات فنوتیپی صفت را تبیین کردند. لی و همکاران (15) مکان­یابی QTL­های کنترل کننده عملکرد و اجزای عملکرد را در جمعیت جو بهاره با استفاده از 60 نشانگر ریز ماهواره انجام دادند آنها سه QTL برای تعداد سنبلچه در سنبله شناسایی کردند که این QTL­ها 5/7 تا 8/36 درصد از واریانس فنوتیپی صفت مربوطه را با LOD 24/1 تا 08/8 توجیه کردند.

برای وزن کل سنبله در سال دوم چهار QTL (qSW-4a، qSW-4b، qSW-4cو qSW-4d) روی کروموزوم 4 در جایگاههای صفر، 68، 100 و 136 سانتی­مورگان شناسایی شد. میزان واریانس فنوتیپی توجیه شده با این QTL­ها به ترتیب 31، 12، 10 و 1/21 درصد بود و به ترتیب دارای اثر افزایشی 38/6، 51/3-، 19/6- و 37/6 داشتند. دو QTL­ (qSW-4aوqSW-4b) به ترتیب با نشانگرهای ISSR31-6 و ISSR20-1 پیوستگی داشتند و دو QTL (qSW-4cو qSW-4d) در مجاورت نشانگرهای ISSR38-3 و ISSR131-1 قرار داشتند. نرجسی و همکاران (19) به منظور شناسایی QTL­های کنترل­کننده صفات زراعی، عملکرد و اجزای عملکرد 179 جمعیت اینبرد لاین نوترکیب (RIL) گندم حاصل از تلاقی Attila/Kauz × Karchia در 10 محیط (5 محیط شور و 5 محیط نرمال) با استفاده از 10 نشانگر ریز ماهواره (SSR) و 108نشانگر (DArT) دو QTL برای وزن سنبله در کروموزومهای A2 و B6 شناسایی کردند که به ترتیب 4/12 و 5/6 درصد از واریانس فنوتیپی صفت مربوط را توجیه نمود.

برای صفت طول ریشک در سال دوم یک QTL بر روی کروموزوم 4 شناسایی شد. والد بادیا باعث افزایش طول ریشک شد. QTL­ موجود در سال دوم ۱۲ درصد از تغییرات فنوتیپی صفت طول ریشک را توجیه نمود. سامری و همکاران (27) به منظور مکان­یابی QTL­های کنترل­کننده صفات زراعی در 99 اینبرد لاین خالص جو زراعی حاصل از تلاقی Azumamugi و Kanto Nakate Gold در طول دو سال زراعی شش QTL برای طول ریشک شناسایی کردند که یکی از این QTL­ها بر روی کروموزوم H3 قرار داشت که 76 درصد از واریانس فنوتیپی صفت مربوطه را توجیه کرد.

چنانچه مبنای توصیف یک QTL به عنوان یک QTL بزرگ اثر را توجیه بیش از 10 درصد واریانس فنوتیپی صفت مربوطه در نظر گرفته شود (23)، از بین 19 QTL که در سال اول و دوم شناسایی شدند 17 QTL مربوط به صفات موردبررسی از نوع بزرگ اثر بودند. میزان ضریب تبیین یا واریانس فنوتیپی توجیه شده به وسیله ­QTLها از 5/10 تا 15 متغیر بود. پایین بودن میزان ضریب تبیین برای بعضی از QTL­ها نشان می­دهد که احتمالاً QTL­های انفرادی دیگری برای این صفات وجود دارند که با توجه به اثر کم هر یک از این QTL­ها شناسایی نشده­اند (25). 

QTL­های مشترک برای صفات مورد مطالعه در سال اول و دوم: جایگاه کروموزومی QTL­های مکان­یابی شده برای صفات مورد مطالعه در شکل 1 ارائه شده است. برخی از QTL­های مذکور دارای اثرات پلیوتروپیک بوده و در چندین صفت تکرار شدند. یک QTL در سال اول و دوم برای صفات وزن کل سنبله و تعداد دانه در سنبله مشترک بود. QTL مشترک پیوسته با نشانگر ISSR31-6 کروموزوم چهارم، به ترتیب 9/12 و 31/0 درصد از تغییرات فنوتیپی صفات تعداد دانه در سنبله و وزن کل سنبله را توجیه کرد اثر افزایشی آللها نشان داد که آللهای افزاینده هر دو صفت در والد بادیا قرار داشت.

جایگاه کروموزومی QTL­ها نشان داد از 19 QTL شناسایی شده در سال اول و دوم، برخی دارای مکان کروموزومی مشترک بودند. این موضوع احتمالاً به دلیل پیوستگی ژنتیکی و یا اثر پلیوتروپیک ژنی است. ناحیه بین نشانگرهای ISSR131-1 و ISSR16-4 در کروموزوم 4 حامل QTL­های وزن کل سنبله، تعداد دانه در سنبله، تعداد سنبلچه در سنبله و طول سنبله بود. و بین نشانگرهای ISSR36-1 و ISSR16-8، QTL­هایی برای طول ریشک، طول سنبله و تعداد سنبلچه در سنبله قرار داشتند. در ناحیه بین نشانگرهای ISSR22-5 و ISSR47-5، QTL­های تعداد سنبلچه در سنبله و طول سنبله شناسایی شدند. QTL­های وزن کل سنبله و تعداد دانه در سنبله پیوسته به نشانگر ISSR36-1 در کروموزوم 4 و QTL­های تعداد دانه در سنبله، وزن کل سنبله و تعداد سنبلچه در سنبله پیوسته به نشانگر ISSR20-1 در کروموزوم 4 مکان­یابی شدند.

نتیجه ­گیری

شناسایی QTL­هایی با اثرهای افزایشی مثبت و منفی، بیانگر انتقال آللهای مطلوب در این جایگاهها از هر دو والد به نتاج بود که والدین حاضر می­توانند در برنامه­های اصلاح جو استفاده شوند. برخی از QTL­های شناسایی با تبیین درصد بالاتری از تغییرات فنوتیپی صفات مورد مطالعه به عنوان QTL بزرگ اثر شناخته شدند که نشانگرهای پیوسته با این QTL­ها می­توانند در برنامه­های اصلاح به کمک نشانگر جهت گزینش خانواده­های برتر و انتقال آللهای مطلوب استفاده گردند.

1- احمدی، ج.، فتوکیان، م.ح.، و فابریکی، ص. (1387). مطالعه پیوستگی بین نشانگرهای ریز ماهواره (SSR) و QTL­های اجزای عملکرد در برنج (Oriza sativa). مجله ژنتیک نوین. شماره 4، دوره 3، ص 45-55.

2- بیگی، ا.، عباسپور، ن.، و مظفری، ج. (1392). بررسی تنوع وراثتی ارقام زراعی و گونه های خودروی جنس Crocus با استفاده از نشانگر ISSR در ایران. مجله پژوهش­های سلولی و مولکولی (مجله زیست شناسی ایران): جلد 26(2): 173-164.

3- رحیمی، م.،  پور فرشاد، الف.، و عشقی، ر. (1391). تعیین نحوه توارث و مکان­یابی ژنهای کنترل کننده صفات زراعی در جو، مجله زیست فناوری گیاهان زراعی. شماره 3، دوره 2، ص 35-48.

4- شاهین­نیا، ف.، رضایی، ع.م.، و سید طباطبایی، ب.الف. (1393). مکان یابی ژنی کنترل کننده صفات کمی (QTL) عملکرد و اجزاء عملکرد در لاین های جو، مجله به­نژادی نهال و بذر. جلد 1-30 شماره 1، ص 85-101.

5- قربانزاده نقاب، م.، و افضل، ر. (1394). ارزیابی تنوع ژنتیکی توده­های ایرانی و ژنوتیپ­های خارجی گلرنگ (Carthamus tinctorius) با استفاده از صفات مورفولوژیکی و نشانگر مولکولی RAPD. مجله پژوهش­های سلولی و مولکولی (مجله زیست شناسی ایران): جلد 28 (1): 106-94.

6- مهدی نژاد، ن.، امیدی، م.، کمالی، ج.، نقوی، م.ر.، و ف،ب، م.ر. (1393). تجزیه QTL برخی صفات فنولوژیک جمعیت لاین ها ی اینبرد نوترکیب گندم حاصل از تلاقی seri M82 و Babax تحت تنش شوری. مجله ژنتیک نوین. شماره 2، دوره 9، ص 207-218.

 

7- Aastveit, A.H., Aastveit, K., (1993). Effects of genotype - environment interactions on genetic correlation. Journal of Theoretical and Applied Genetics, 86(8):1007-1013.

8- Basten, C.J., Weir, B.S., Zeng, Z.B., (1997). QTL Cartographer: A reference manual and tutorial for QTL mapping: North Carolina state university, USA. P. 163.

9- Bezant, J., Laurie, D., Pratchett, N., Chojecki, J., Kearsey, M.J., (1997). Mapping QTLs controlling yield and yield components in a spring barley (Hordeum valgare L.) cross using marker regression. Journal of Molecular Breeding 3(1): 29-38.

10- Chen, G.D., Li, H.B., Zheng, Z., Wei, Y.M., Zheng, Y.L., McIntyre,  Zhou, MX.,  Liu, CJ., (2012). Characterization of a QTL affecting spike morphology on the long arm of chromosome 3H in barley (Hordeum vulgare L.) based on near isogenic lines and a NIL-derived population. Journal of Theoretical and applied genetics, 125(7):1385-1392.

11- Doerge, R.W., (2002). Mappina and analysis of quantitave trait loci in experimental populations. Journal of Genetics 3(1):43-52.

12- Högy, P., Poll, C., Marhan, S., Kandeler, E., Fangmeier, A., (2013). Impacts of temperature increase and change in precipitation pattern on crop yield and yield quality of barley. Food Chemistry, 136(3): 1470-1477.

13- IBM Corp. Released (2013). IBM SPSS Statistics for Windows, Version 23.0 Armonk, NY: IBM Corp.

14- Kosambi, D.D., (1944). The estimation of map distances from recombination values. Annuals of Eugene, 12: 172-175.

15- Li, J.Z., Huang, X.Q., Heinrichs, F., Ganal, M.W., Röder, M.S., (2005). Analysis of QTLs for yield, yield components, and malting quality in a BC3-DH population of spring barley. Journal of Theoretical and Applied Genetics, 110(2): 356-363.

16- Manly, K.F., Olson, J.M., (1999). Overview of QTL mapping software and introduction to Map Manager QTL. Mammalian Genom 10(4): 327-334.

17- Marza, F., Bai, GH., Carver, BF., Zhou, WC., (2006). Quantitative trait loci for yield and related traits in the wheat population Ning7840 Clark. Journal of Theoretical Applied Genetics 112(4): 688-698.

18- Mikołajczak, K., Ogrodowicz, P., Gudyś, K., Krystkowiak, K., Sawikowska, A., Frohmberg, W Górny, A., Kędziora, A., Jankowiak, J., Józefczyk, D., Karg, G.,  (2016). Quantitative Trait Loci for Yield and Yield-Related Traits in Spring Barley Populations Derived from Crosses between European and Syrian Cultivars. PloS one, 11(5): 1-26.

19- Narjesi, v., Mardi, m., MajidiHervan, E., Azadi, A., Naghavi, M.R., Ebrahimi, M., Zali, A.A., (2015). Analysis of Quantitative Trait Loci (QTL) for GrainYield and Agronomic Traits in Wheat (Triticum aestivum L.) Under Normal and Salt-Stress Conditions. Journal of Plant Molecular Biology, 33(6): 2030-2040.

20- Paterson, A.H., Lander, E.S., Hewitt, J.D., Paterson, S., Lincoln, S.E., Tanksley, S.D., (1988). Resolution of quantitative traits into Mendelian factors by using a complete RFLP linkage map. Nature 335(6192): 721–726.

21- Peighambari, S.A., Yazdi Samadi, B., Nabipour, A., Charmet, G., Sarrafi, A., (2005). QTL analysis for agronomic traits in barley doubled haploids population grown in Iran. Journal of Plant Science, 169(6): 1008-1013.

22- Rafalski, J.A., Morgante, M., Powell, W., Vogel, J.M., Tingey, S.V., (1996). Generating and using DNA markers in plants. In: Analysis of Non-mammalian Genomes: a practical guide (Birren, B. and Lai, E., Eds) pp. 75-134, Academic Press, Boca Raton, Florida, USA.

23- Reif, J.C., Wenxin, L., Manje, G., Hans, P.M., Jens, M., Sandra, F., Axel S., Tobias, W., (2010). Genetic basis of agronomically important traits in sugar beet (Beta vulgaris L.) investigated with joint linkage association mapping. Journal of Theoretical and Applied Genetics, 121(8):1489–1499.

24- Ren, X., Sun, D., Sun, G., Li, C., Dong, W., (2013). Molecular detection of QTL for agronomic and quality traits in a doubled haploid barley population. Australian Journal of Crop Science, 7(6): 878.

25- Rezaiezad, A., Mohammadi, V., Zali, A., Zeinali, H., Mardi, M., (2011). Mapping QTLs controlling yield and yield components of oilseed rape under normal irrigation and drought stress conditions. Journal of Seed and Plant Improvment 27(2): 199-218.

26- Saghi Maroof, M.A., Biyashev, R.M., Yang, G.P., Zhang, Q and Allard, R.W. (1994). Extraordinarily polymorphic microsatellites DNA in barely species diversity, choromosomal location, and population dynamics. Proceedings of the National Academy of Sciences U.S.A, 91(12): 5466-5570.

27- Sameri, M., Takeda, K., Komatsuda, T., (2006). Quantitative trait loci controlling agronomic traits in recombinant inbred lines from a cross of oriental-and occidental-type barley cultivars. Breeding Science, 56(3): 243-252.

28- United States Department of Agriculture (USDA). Circular Series WAP 11-11 November 2011. World Agricultural Production. Foreign Agricultural Service.

29- Veldboom, L.R., Lee, M., and Woodman, W.L., (1994). Molecular marker-facilitated studies of       morphological traits in an elite maize population. 2. Determination of QTLs for grain yield and yield components. Journal of Theoretical and Applied Genetics, 89: 451-458.

30- Voorrips, R.E., (2002). MapChart: software for the graphical presentation of linkage maps and QTLs. The Journal of Heredity 93(1): 77-78.

31- Wang, J., Sun, GAS., Ren, X., Li, C., Liu, L., Wang, Q., Du, B., Sun, D., (2016). QTL underlying some agronomic traits in barley detected by SNP markers. BMC genetics, 17(1): 103.

32- Wang, J., Yang, J., McNeil, D. L., Zhou, M., (2010). Identification and molecular mapping of a dwarfing gene in barley (Hordeum vulgare L.) and its correlation with other agronomic traits. Euphytica, 175(3): 331-342.

33- Xiao, J.Li.J., Yuan, L., Tanksley, S.D., (1996). Identification of QTLs affecting traits of agronomic importance in a recombinant inbred population derived from a subspecific rice cross. Journal of Theoretical and Applied Genetics, 92(2): 230–244.