نوع مقاله: مقاله پژوهشی

نویسندگان

1 دانشیار میکروبیولوژی صنعتی، دانشگاه کردستان، دانشکده علوم پایه، گروه علوم زیستی، سنندج، ایران

2 کارشناس ارشد بیوشیمی، دانشگاه کردستان، دانشکده علوم پایه، گروه علوم زیستی، سنندج، ایران

چکیده

نانوذرات سولفید کادمیوم به دلیل ویژگی های خاص فوتوالکتریکی کاربردهای فراوانی در ساخت سلول های خورشیدی حساس به رنگ، دیودهای انتشارگر نوری و ساخت نانوبیوسنسورها دارد. در این پژوهش، سنتز سبز و برون سلولی نانوذرات سولفید کادمیوم توسط سویه های باکتری آب زی مورد بررسی قرار گرفت. نانوذرات سنتز شده از طریق طیف های جذبی و نشری فلورسانس، طیف سنج پراش انرژی پرتو ایکس (EDX)، الکترومیکروگرافهای تهیه شده با میکروسکوپ الکترونی (SEM) و همچنین طیف‌سنجی تبدیل فوریه مادون‌قرمز (FTIR) مورد بررسی قرار گرفت. 32 سویه‌ی باکتریایی آب‌زی مقاوم به کادمیوم براساس تکنیک غنی سازی جداسازی شد که در این میانstrain Cd11 Pseudomonas pseudoalcaligenes قادر به سنتز برون سلولی نانوذرات سولفید کادمیوم بود. سنتز برون سلولی نانوذرات سولفید کادمیوم تولید شده توسط سویه باکتری مذکور تحت شرایط بهینه واکنش مورد بررسی قرار گرفت. بر اساس نتایج به‌دست‌ آمده، سوپرناتانت کشت سویه مذکور بعد از مواجهه با محلول سولفات کادمیوم (غلظت 3 میلی‌مولار از یون کادمیوم)، قادر به سنتز برون سلولی نانوذرات سولفید کادمیوم کروی در محدوه پراکنش ذرات بین 12 تا 19 نانومتر با میانگین اندازه 5/15 نانومتر در pH برابر 8 و دمای 35 درجه سانتی‌گراد پس از 10 ساعت گرما‌گذاری بود. نتایج اثرات ضدمیکروبی به روش انتشار از چاهک بر سطح آگار نشان داد که نانوذرات زیستی تولیدشده علیه همه میکروب‌های تست‌شده اثر مهارکنندگی رشد را دارد. نانوذرات سولفید کادمیوم سنتز شده در مطالعه اخیر دارای دامنه پراکنش اندازه ذرات مناسب و همگن بوده که همین امر کارآیی نانوذرات زیستی سنتز شده را مناسب می کند.

کلیدواژه‌ها

موضوعات

عنوان مقاله [English]

Rapid Extracellular Synthesis of Cadmium Sulfide Nanoparticles by Pseudomonas pseudoalcaligenes Cd11 and Study of its Antibacterial Activity

نویسندگان [English]

  • Morahem Ashengroph 1
  • Arsalan Khaledi 2

1 Associate Professor in Industrial Microbiology, University of Kurdistan, Faculty of Sciences, Department of Biological Sciences, Sanandaj, Iran.

2 M.Sc. in Biochemistry, University of Kurdistan, Faculty of Sciences, Department of Biological Sciences, Sanandaj, Iran.

چکیده [English]

Cadmium sulfide nanoparticles (CdS NPs) have many commercial applications in making dye-sensitized solar cells, light emitting diodes (LED) and nanobiosensors due to their unique properties. In this work, screening of aquatic bacterial strains for their ability in the green extracellular synthesis of CdS NPs was studied. The prepared nanoparticles were examined using Optical emission and absorption spectroscopy analyses, Energy Dispersive X-Ray Spectroscopy (EDS) Scanning electron micrograph analysis and Fourier-transform infrared spectroscopy (FTIR). 32 cadmium-resistant aquatic strains were isolated by using enrichment. Among isolated strains, Pseudomonas pseudoalcaligenes is capable to synthesize CdS NPs. The extracellular nanoparticles produced by the strain Cd11 were investigated under optimal culture conditions. The results showed that culture supernatant of strain Cd11 treated with CdSO4 (3 mM) was able to catalyze the extracellular synthesis of CdS NPs in the range of 12-19 nm with an average size of 15.5 nm after 10 h of incubation at pH 8.0 and temperature 35 °C. To evaluate the antibacterial activity of nanoparticles, agar well diffusion method was tested. Based on obtained results, CdS nanoparticles had an inhibitory effect against all tested microorganisms. Additionally, particles size distribution of CdS nanoparticles synthesized by culture supernatant of strain Cd11 had a good monodispersity and homogeneity for the specific applications.

کلیدواژه‌ها [English]

  • CdS nanoparticles
  • Extracellular synthesis
  • Resistance pattern
  • Antibacterial activity
  • P. pseudoalcaligenes strain Cd11

سنتز سریع و برون سلولی نانوذرات سولفید کادمیوم توسطCd11Pseudomonas pseudoalcaligenesو بررسی فعالیت ضد باکتریایی آن

مراحم آشنگرف* و ارسلا ن خالدی

سنندج، دانشگاه کردستان، دانشکده علوم پایه، گروه علوم زیستی

تاریخ دریافت: 10/1/97                تاریخ پذیرش: 10/4/97

چکیده

نانوذرات سولفید کادمیوم به دلیل ویژگیهای خاص فوتوالکتریکی کاربردهای فراوانی در ساخت سلولهای خورشیدی حساس به رنگ، دیودهای انتشارگر نوری و ساخت نانوبیوسنسورها دارد. در این پژوهش، سنتز سبز و برون سلولی نانوذرات سولفید کادمیوم توسط سویه های باکتری آبزی مورد بررسی قرار گرفت. نانوذرات سنتز شده از طریق طیفهای جذبی و نشری فلورسانس، طیف سنج پراش انرژی پرتو ایکس (EDX)، تصاویر تهیه شده با میکروسکوپ الکترونی (SEM) و همچنین طیف‌سنجی تبدیل فوریه مادون‌قرمز (FTIR) مورد بررسی قرار گرفت. 32 سویه باکتریایی آبزی مقاوم به کادمیوم براساس تکنیک غنی سازی جداسازی شد که در این میانstrain Cd11 Pseudomonas pseudoalcaligenes قادر به سنتز برون سلولی  نانوذرات سولفید کادمیوم بود. سنتز برون سلولی نانوذرات سولفید کادمیوم تولید شده توسط سویه باکتری مذکور تحت شرایط بهینه واکنش مورد بررسی قرار گرفت. بر اساس نتایج به‌دست‌ آمده، سوپرناتانت کشت سویه مذکور بعد از مواجهه با محلول سولفات کادمیوم (غلظت 3 میلی‌مولار از یون کادمیوم)، قادر به سنتز برون سلولی نانوذرات سولفید کادمیوم کروی در محدوه پراکنش ذرات بین 12 تا 19 نانومتر با میانگین اندازه 5/15 نانومتر در pH برابر 8 و دمای 35 درجه سانتی‌گراد پس از 10 ساعت گرما‌گذاری بود. نتایج اثرات ضدمیکروبی به روش انتشار از چاهک بر سطح آگار نشان داد که نانوذرات زیستی تولیدشده علیه همه میکروبهای تست‌شده اثر مهارکنندگی رشد را دارد. نانوذرات سولفید کادمیوم سنتز شده در مطالعه اخیر دارای دامنه پراکنش اندازه ذرات مناسب و همگن بوده که همین امر کارآیی نانوذرات زیستی سنتز شده را مناسب می کند.

واژه های کلیدی: نانوسولفید کادمیوم، سنتز برون سلولی، الگوی مقاومت، خاصیت ضد میکروبی،
 Cd11 P. pseudoalcaligenes

* نویسنده مسئول، تلفن: 33664600-087، پست الکترونیکی:m.ashengroph@uok.ac.ir

مقدمه

 

نانوذرات سولفید کادمیوم دارای خواص فیزیکی، شیمیایی و ساختاری منحصر به فرد نسبت به حالت بالک هستند. نقطه ذوب، طیف جذب نوری، ساختار بلوری و دیگر خواص نانو ذرات سولفید کادمیوم، همگی تحت تأثیر اندازه نانوذرات است. با توجه به پایداری بالا، خواص شیمیایی، فیزیکی و ساختاری منحصربه فرد، در دسترس بودن و سهولت آماده سازی، نانو ذرات سولفید کادمیوم را می­توان در زمینه­های مختلف زندگی به­کار برد. با در نظر گرفتن اثرات سطح و اثرات اندازه کوانتومی نانو ذرات سولفید کادمیوم می­توانند خواص جدید نوری، الکترونیکی، مغناطیسی، شیمیایی و ساختاری را نمایش دهند که ممکن است در بسیاری از زمینه­های فناوری کاربرد داشته باشند. بنابر­این نانوذرات سولفید کادمیوم در مجموعه یک سیستم جذاب برای بررسی سنتیک شیمیایی نانوکریستالها و نحوه ساخت مراحل نانو مواد و همچنین کاربرد­های مختلف آن است (31). از کاربرد­های نانوذرات سولفید کادمیوم می­توان به ساخت نانو بیو­سنسور­های الکتروشیمیایی (17)، سیستمهای تحویل دارو (قابلیت حمل دزهای مؤثری از دارو به سلولهای بافت هدف) (29) و همچنین تجزیه آب و تولید هیدروژن (35) به منظور ایجاد توسعه منابع انرزی پاک و جایگزین جدید مانند تولید فوتوکاتالیتکی هیدروژن از منابع طبیعی نظیر آب و انرژی خورشید انجام شده است، اشاره نمود. انواع مختلف روشهای فیزیکی و شیمیایی از جمله استفاده از لیگاندهای سمی جهت ایجاد حلالیت در حلالهای آلی (18)، روش سنتز از فاز بخار (24)، روش پرتو لیزر-پالسی (31) و روش سنتز احتراقی (3) برای سنتز کوانتوم دات سولفید کادمیوم وجود دارد. استفاده از روشهای سنتزی فیزیکی به دلیل هزینه بالای تجهیزات و راندمان پایین  و همچنین روشهای سنتز شیمیایی به دلیل نیاز به مواد شیمیایی قوی و عوامل حفاظتی ( سدیم بوروهیدرات، سدیم سیترات و الکل) که اکثراً سمی و قابل اشتعال بوده و به علت مسائل زیست محیطی با محدودیت و چالشهای جدی روبرو شده است ( 3 و 27). این در حالی است که فرآیند سنتز زیستی با استفاده از سلولهای میکروبی نسبت به روشهای فیزیکی و شیمیایی یک تکنیک کم هزینه، غیر سمی و با وجود راندمان نسبتاً پایین صنعتی، یک رویکرد سازگار با محیط زیست می­باشد (10). بنابراین باتوجه به نکات فوق، هر چند با روشهای شیمیایی وفیزیکی می­توان مقدار زیادی نانوذره با اشکال متفاوت در زمان نسبتاً کوتاهی تولید کنند اما این روشها قدیمی، پیچیده و پرهزینه هستند و باعث تولید ضایعات سمی می­شوند که نه تنها به محیط زیست بلکه به سلامت انسان نیز آسیب می­رسانند. در روش زیستی با استفاده از سلولهای میکروبی به­عنوان کاتالیزگر استفاده از مواد شیمیایی گران قیمت حذف می­شود. همچنین انرژی مصرفی در این روش بسیار کمتر از روشهای شیمیایی است و باتوجه به سازگار بودن با محیط زیست یک تکنیک برتر است (16). علیرغم سمیت کادمیوم برای بسیاری از میکروارگانیسم­ها تعدادی از آنها نه تنها در برابر آن مقاوم هستند بلکه قادر به احیای آن به صورت نانو ذرات سولفید کادمیوم و اکسید کادمیوم می­باشند (22). دامرون (Dameron) و همکاران اولین کسانی بودند که در سال 1989 با استفاده از سویه های مخمری Candida glabrata و Schizosaccharomyces pombeکشت داده شده در حضور نمکهای کادمیومموفق به سنتز درون سلولی نانوذرات نیمه هادی سولفید کادمیوم شدند، آنها گزارش دادند که تشکیل نانوذرات سولفید کادمیوم بستگی به مرحله­ای از رشد باکتری دارد که طی آن یونهای کادمیوم اضافه می­شود و هنگامی که یون کادمیوم در مرحله رشد لگاریتمی اضافه گردد حداکثر تولید نانوذره به دست خواهد آمد (9). سنتز درون سلولی و برون سلولی زیستی نانوذرات سولفید کادمیوم در طیف وسیعی از سویه­های مختلف میکروبی متعلق به جنسهای باکتریایی و قارچی شامل  Clostridium(8)،Klebsiella(11)،Schizosaccharomyces(15)،Fusarium(2)،Escherichia coli(32)،Rhodopseudomonas(4)،Coriolus(28)، Sachharomyces (23)،Phormidium(19)، Serratia(23)،Pseudomonas  (26)گزارش شده است. در این پژوهش، قابلیت ذاتی سویه‌های بومی باکتریایی آبزی به‌عنوان زیست کاتالیزگر در احیای زیستی سولفات کادمیوم به نانوذرات سولفید کادمیوم و همچنین بررسی اثرات ضدباکتریایی نانوذرات سبز سنتز شده مورد بررسی قرار گرفته و برای نخستین بار سنتز سریع و خارج سلولی نانوکوانتوم دات سولفید کادمیوم در سویه بومی متعلق به Cd11 P. pseudoalcaligenesگزارش شده است.

مواد و روشها

نمونه برداری، غنی سازی و جداسازی سویه های باکتری: ﺑﺮای ﻏﻨﻲ ﺳﺎزی باکتریهای آبزی ﺑﻮﻣﻲ ﻣﻘﺎوم ﺑﻪ یون کادمیوم، ﻧﻤﻮﻧﻪ ﮔﻴﺮی از ﻋﻤﻖ 15 تا 30 ﺳﺎﻧﺘﻴﻤﺘﺮی از آﺑ­ﻬﺎی مناطق مختلف ایران شامل سواحل بوشهر، ﺳﻮاﺣﻞ ﺟﺰاﻳﺮ ﻗﺸﻢ، ﻛﻴﺶ و ﻻوان و همچنین از آب چشمه های مختلف استان کردستان و کرمانشاه انجام شد. نمونه های آب در ظروف دردار استریل جمع آوری و پس از انتقال به آزمایشگاه در دمای 4 درجه سانتی گراد تا هنگام استفاده نگهداری شدند. 20 ﻣﻴﻠﻲ ﻟﻴﺘﺮ از ﻧﻤﻮﻧﻪ ﻫﺎی آب ﺟﻤﻊ  آوری ﺷﺪه ﺑﻪ ﻟﻮﻟﻪﻫﺎی ﻓﺎﻟﻜﻮن 45 میلی لیتری اﺳﺘﺮﻳﻞ ﻣﻨﺘﻘﻞ ﺷﺪ و در دور × g 4500 به مدت10 دﻗﻴﻘﻪ ﺳﺎﻧﺘﺮﻳﻔﻴﻮژ شد. ﺳﭙﺲ ﻣﺤﻠﻮل روﻳﻲ را دور رﻳﺨﺘﻪ و ﻣﻘﺪار ﻳﻚ ﻣﻴﻠﻲ ﻟﻴﺘﺮ از ﻣﺎﻳﻊ ﺗﺤﺘﺎﻧﻲ ﺑﻪ ﻣﺤﻴﻄﻬﺎ ی ﻛﺸﺖ غنی شده و انتخابی تریپتیک سوی آگار ﻣﻨﺘﻘﻞ ﺷﺪ. ﺑﻪ محیطهای ﻛﺸﺖ ﻣﺬﻛﻮر، ﻳﻮن کادمیوم در ﻏﻠﻈﺖ ﻧﻬﺎﻳﻲ 5/0میلی مولار، ﭘﺲ از اﺳﺘﺮﻳﻞ ﺷﺪن ﺗﻮﺳﻂ ﻓﻴﻠﺘﺮﻫﺎی ﺳﺮﺳﺮﻧﮕﻲ 25/0ﻣﻴﻜﺮوﻧﻲ، اﻓﺰوده شد. ﭘﻠﻴﺘﻬﺎ ﺑﻪ ﻣﺪت 48 تا 72 ساعت در دﻣﺎی 25 درﺟﻪ ﺳﺎﻧﺘﻲ ﮔﺮاد ﮔﺮﻣﺎﮔﺬاری ﺷﺪﻧﺪ . ﻛﻠﻨﻴﻬﺎی باکتریایی ﺑﺎ اﺳﺘﻔﺎده از وﻳﮋﮔﻴﻬﺎی ﻇﺎﻫﺮی ﻣﺸﺨﺺ ﺷﺪﻧﺪ. ﺑﻪ ﻣﻨﻈﻮر ﺧﺎﻟﺺ ﺳﺎزی ﺳﻮﻳﻪﻫﺎی باکتری ﻏﻨﻲ ﺷﺪه، ﻫﺮ کلنی باکتری ﺑﻪ محیطهای ﻛﺸﺖ تریپتیک سوی آگار حاوی 5/0 میلی مولار کادمیوم ﻣﻨﺘﻘﻞ و ﺑﻪ روش ﺧﻄﻲ ﻛﺸﺖ داده ﺷﺪ. ﺗﺠﺪﻳﺪ ﻛﺸﺖ ﺗﺎ ﺣﺼﻮل اﻃﻤﻴﻨﺎن از ﺧﺎﻟﺺ ﺑﻮدن ﺟﺪاﻳﻪﻫﺎی باکتری اﻧﺠﺎم ﺷﺪ.

تعیین الگوی مقاومت سویه­های باکتری جدا شده نسبت به یون سمی کادمیوم: از روش میکروپلیت با استفاده از چاهکهای الیزای 96 تایی برای سنجش میزان تحمل پذیری به یون سمی کادمیوم استفاده شد (6). برای این منظور ابتدا محلولهای استوک کادمیوم در آب مقطر استریل تهیه شد. پس از آن با استفاده از پالایه­های غشایی میلی پور 2/0 میکرونی استریل شد. میزان تراکم استفاده شده برای یون کادمیوم بر حسب میلی مولار عبارت بود از 5/0، 1، 5/1، 2، 5/2، 3، 5/3، 4، 5/4، 5، 5/5، 6، 5/6، 7، 5/7، 8، 5/8، 9، 5/9، 10، 5/10، 11، 5/11 و 12. پس از تهیه محلولهای استوک کادمیوم و تهیه رقتهایی از تراکمهای ذکر شده در محیط تریپتیک سوی براث، به میزان 10 میکرولیتر از سوسپانسیون تهیه شده باکتریها (با تراکم 5/0 مک فارلند: 1.5× 108 CFU/ml) به چاهکهای الیزای حاوی 140 میکرولیتر تریپتیک سوی براث شامل غلظتهای مشخصی از یون کادمیوم، اضافه گردید. پلیتهای مذکور در دمای 25 درجه سانتی گراد به مدت 24، 48 و 72 ساعت گرماگذاری شدند. پس از طی مدت زمان گرماگذاری، میزان کدورت باکتریایی توسط دستگاه الیزا ریدر در مقایسه با شاهدهای تهیه شده در طول موج 620 نانومتر اندازه گیری شد.

بررسی توانایی سنتز خارج سلولی کوانتوم دات سولفید کادمیوم توسط سویه­های باکتری مقاوم به کادمیوم: یک لوپ از باکتریهای رشد یافته تازه (24 ساعته) بر روی محیط تریپتیک سوی آگار را به محیط تریپتیک سوی براث ( 50 میلی لیتر محیط کشت تریپتیک سوی براث در یک ارلن 250 میلی لیتری) تلقیح کرده و به مدت 24 ساعت در انکوباتور شیکردار با دور 150 و دمای 25 درجه سانتی گراد گرماگذاری گردید. از این محیط به منظور تلقیح در محیطهای کشت استفاده گردید. 5 درصد از سوسپانسیون های باکتری تهیه شده را در ارلنهای 250 میلی لیتری حاوی 50 میلی لیتر محیط کشت مایع تریپتیک سوی براث در دمای 25 درجه سانتی گراد بر روی شیکر مدور (150 دور در دقیقه)، به مدت 24 ساعت گرماگذاری شد. برای جدا کردن توده زیستی باکتری از محیط کشت تریپتیک سوی براث، از سانتریفیوژ یخچالی با دور g ×5000 در دقیقه در دمای 4 درجه سانتی گراد به مدت 10 دقیقه استفاده گردید. پس از سه بار شستشو با آب دمین استریل، 10 گرم از توده زیستی مذکور در ارلنهای 250 میلی لیتری که حاوی 50 میلی لیتر آب دمین استریل بود، ریخته شد و به مدت 24 ساعت در شیکر انکوباتوردار در دمای 25 درجه سانتی گراد و دور شیکر 150 قرار داده شد. پس از طی دوره گرماگذاری، میسیلیوم­های باکتری با استفاده از سانتریفیوژ جدا شده و از سوپرناتانت­های عاری از میسیلیوم باکتری جمع آوری شده به­عنوان زیست کاتالیزگر برای احیای زیستی سولفات کادمیوم به کوانتوم دات سولفید کادمیوم استفاده شد. برای این منظور به فلاسکهای 250 میلی لیتری حاوی 50 میلی لیتر از سوپرناتانت برداشت شده باکتری، محلول سولفات کادمیوم (با غلظت نهایی 1 میلی مولار یون کادمیوم) اضافه شده و به مدت 24 ساعت تحت شرایط دمایی 25 درجه سانتی گراد و دور شیکر  rpm150 گرماگذاری شد. به طور همزمان از محلول سولفات کادمیوم (بدون تلقیح سوپرناتانت کشت باکتری) و سوپرناتانت کشت (بدون حضور یون کادمیوم) به­عنوان محیطهای کنترل منفی استفاده شد (1). طیف جذبی نانوذرات سولفید کادمیوم تشیکل شده در محلول واکنش زیست تبدیلی، مورد آنالیز UV-visible spectrophotometer (مدلSpecord 210 ساخت کشور آلمان) قرار گرفت

شناسایی فنوتیپی و مولکولی سویه باکتری Cd11: شناسایی فنوتیپی و بیوشیمیایی سویه مذکور براساس شکل ظاهری، واکنش گرم، تستهای اکسیداز و کاتالاز، احیای نیترات، تست مصرف سیترات، هیدرولیز اوره، هیدرولیز ژلاتین، هیدرولیز کازئین، هیدرولیز تویین، هیدرولیز تیروزین، رشد در دماهای مختلف، تولید اسید از منابع کربوهیدراتی از جمله گلوکز، فروکتوز، آرابینوز، مانیتول، سوکروز، مالتوز، زایلوز و همچنین تولید اسید از منابع الکلی از جمله گلیسرول و اتانول طبق کتاب مرجع برگی (12) انجام شد. استخراج DNAی ژنومی سویه مذکور با استفاده از روش جوشاندن صورت گرفت. در این روش سوسپانسیونی از کلنی خالص باکتری در یک میلی لیتر آب دوبار تقطیر استریل تهیه شد و به مدت 10 دقیقه در بن ماری در حال جوش قرار داده شد. سپس به مدت 5 دقیقه برروی یخ قرار داده می شود و پس از آن در دور ×g 3000 به مدت 5 دقیقه سانتریفیوژ شد. به دنبال سانتریفیوژ کردن، 2 میکرولیتر از مایع رویی حاوی DNA به عنوان DNAی الگو برای واکنشPCR استفاده شد (21). سپس ژن 16S rDNA با جفت آغازگرهای عمومی fd1 (AGAGTTTGATCCTGGCTCAG) و rp2 (ACGGCTACCTTGTTACGACTT) تکثیر شد (34). شرایط اعمال شده در این واکنش مشتمل بود بر: واسرشت اولیه در دمای 95 درجه سانتی گراد به مدت 1 دقیقه سپس 30 سیکل به صورت واسرشت شدن در دمای 95 درجه سانتی گراد به مدت 45 ثانیه، چسبیدن پرایمر به DNA ژنومی در دمای 50 درجه سانتی گراد به مدت 45 ثانیه و تکثیر DNA در دمای 72 درجه سانتی گراد به مدت 2 دقیفه انجام شد. بسط نهایی در دمای 72 درجه سانتی گراد به مدت 10 دقیقه. نتایج مربوط به تعیین توالیهای رفت و برگشت پس از ویرایش توسط نرم افزارهای BioEdit و FinchTV به­صورت یک توالی کامل تهیه شد. سپس توالیهای به دست آمده توسط نرم افزار BLAST موجود در بانک ژنی NCBI با باکتریهای موجود مقایسه شد. در ادامه به منظور تأیید نتایج حاصل از بلاست، درخت فیلوژنتیکی برای سویه Cd11 با استفاده از نرم افزار MEGA. 6 و بر پایه روش neighbor-joining و با بوت استرپ 100 تکرار ترسیم شد. همچنین فاصله ژنتیکی بر پایه روش Kimura-2-parametr محاسبه شد (33).

سنتز برون سلولی کوانتوم دات سولفید کادمیوم توسط سویه منتخب Cd11، بهینه سازی فرآیند و بررسی اثرات ضد باکتریایی: یک لوپ کامل از سویه باکتری Cd11، برداشت شده از یک کشت 24 ساعته بر روی محیط تریپتیک سوی براث، به یک محلول نمکی استریل حاوی 85/0درصد نمک سدیم کلراید منتقل شده و به مدت نیم ساعت بر روی یک شیکر دورانی با سرعت rpm 200 همزده شد. حدود 5 میلی لیتر از غلظت باکتری مورد نظر (  CFU/ml108 ×1) به 100 میلی لیتر محیط کشت مایع تریپتیک سوی براث درون فلاسکهای 250 میلی لیتری و تحت شرایط دمایی 25 درجه سانتی گراد و بر روی شیکر دورانی با سرعت  rpm150به مدت 24 ساعت گرماگذاری شد. برای جدا کردن توده زیستی باکتری از محیط کشت مایع تریپتیک سوی براث، از سانتریفیوژ یخچالی با دور g ×5000 در دقیقه در دمای 4 درجه سانتی گراد به مدت 10 دقیقه استفاده گردید. پس از سه بار شستشو با سرم فیزیولوژیک استریل، 25 گرم از توده زیستی مذکور در ارلنهای 250 میلی لیتری که حاوی 100 میلی لیتر آب دمین استریل بود، ریخته شد و به مدت 24 ساعت در شیکر انکوباتوردار در دمای 25 درجه سانتی گراد و دور شیکر rpm150 قرار داده شد. پس از طی دوره گرماگذاری، توده باکتری با استفاده از سانتریفیوژ جدا شد. پس از جمع آوری، از سوپرناتانت عاری از توده زیستی باکتری، به­عنوان زیست کاتالیزگر، برای سنتز کوانتوم دات سولفید کادمیوم استفاده شد. برای این منظور به فلاسکهای 250 میلی لیتری حاوی 100 میلی لیتر از سوپرناتانت برداشت شده باکتری، محلول سولفات کادمیوم (با غلظت نهایی 1 میلی مولار یون کادمیوم) اضافه شده و به مدت 8 ساعت تحت شرایط دمایی 25 درجه سانتی گراد و دور شیکر rpm150 گرماگذاری شد. به طور همزمان از محلول سولفات کادمیوم (بدون تلقیح سوپرناتانت باکتری Cd11) بعنوان محیط کنترل استفاده گردید. در ادامه و با هدف بهینه سازی فرآیند، بررسی اثر غلظتهای اولیه یون کادمیوم (1، 2، 3، 4 و 5 میلی مولار)، اثرات دما (25، 30، 35 و 40 درجه سانتی گراد)، اثرات pH (5، 6، 7، 8 و 9) و اثر دروه انکوباسیون (4، 6، 8، 10، 12 و 24 و 72 ساعت) بر روی سنتز نانوسولفید کادمیوم در محیط زیست تبدیلی تحت شرایط واکنش مذکور بررسی شد. همه آزمایشات در سه تکرار انجام شد. نانوذرات سولفید کادمیوم تشیکل شده در محیط زیستی حاصل از واکنش سوپرناتانت عاری از کشت باکتری Cd11 به­عنوان زیست کاتالیزگر در معرض سولفات کادمیوم، با استفاده از تستهای دستگاه اسپکتروفتومتری UV-Vis، دستگاه فلورسانس (مدل Cary-Eclipse ساخت کشور آمریکا)، طیف سنج پراش انرژی پرتو ایکس، دستگاه FTIR (مدل Bruker, VECTOR 22 ساخت کشور آلمان)، هیستوگرامومنحنینرمالمربوطبهدامنهپراکنشاندازهنانوذرات سولفید روی و همچنین تصاویر تهیهشده با میکروسکوپ الکترونی روبشی(مدل Mira 3-LMu ساخت کشور چک)  مورد بررسی قرار گرفت. به منظور تعیین طیف جذبی اسپکتروفتومتری و طیف نشر فلورسانس محلول رویی حاصل از سانتریفیوژ، نمونه­ها با سرعت  g×5000 به مدت 5 دقیقه در دمای 4 درجه سانتی گراد، سانتریفیوژ شد. سپس آنالیزهای FTIR، EDX و SEM با هدف بررسی وضعیت نانو کریستالهای تشکیل شده و همچنین بررسی شکل و اندازه آنها انجام پذیرفت. برای این منظور ابتدا سوپرناتانت عاری از توده زیستی باکتری از فیلترهای سرنگی 22/0 میکرونی عبور داده شد و سپس با هدف رسوب نانوذرات سولفید کادمیوم، اتانول مطلق به نسبت 3 به 1 به نمونه ها افزوده شد و پس از چند بار سانتریفیوژ (× g 5000 به مدت 30 دقیقه)، رسوب حاصل با آب دمین استریل شستشو داده شد. در نهایت نمونه ها در دستگاه فریزدرایر (مدل Alpha 1-2Dplus ساخت کشور آلمان) به مدت 24 ساعت خشک شد. فعالیت ضد میکروبی کوانتوم دات سولفید کادمیوم سنتز شده توسط سوپرناتانت کشت سویه باکتری Cd11 در برابر گونه­های مختلف باکتریایی با پتانسیل تشیکل بیوفیلم بر سطوح زنده و غیر زنده از طریق اندازه­گیری هاله عدم رشد و به روش انتشار چاهک بر سطح آگار سنجش شد. در این روش پس از آماده سازی سوسپانسیون میکروبی با کدورت معادل نیم مک فارلند (1 × 108 CFU/ml)، با استفاده از سوآپ استریل بر سطح محیط کشت نوترینت آگار، کشت چمنی از باکتریهای مورد مطالعه انجام شد. بعد به کمک چوب پنبه سوراخ کن چاهکهایی به قطر 5 میلی متر ایجاد شد و کف چاهکها با استفاده از 50 میکرولیتر از سوپرناتانت حاوی نانوذرات سنتز شده پوشانده شد. سپس پلیتها به مدت 24 ساعت در دمای مناسب گرماگذاری شدند. در نهایت با اندازه گیری قطر هاله عدم رشد، میزان حساسیت باکتریها مورد سنجش قرار گرفت. باکتریهای مورد مطالعه شامل E. coli IBRC-M11018، Bacillus subtilis IBRC-M10742،  Staphylococcus aureus IBRC-M10690 ،Pseudomonas aeruginosa IBRC-M10828 ، Lactobacillus plantarum IBRC-M10817 و Pseudomonas fluorescens IBRC-M10752 بودند. این میکروارگانیسم‌های مورد مطالعه به‌صورت آمپول لیوفلیزه از مرکز ذخایر زیستی و ژنتیکی ایران، خریداری شد.

نتایج

جداسازی سویه­های باکتری آب­زی دارای تحمل پذیری بالا به یون سمی کادمیوم: ‌در مجموع 32 سویه باکتریایی (که حداقل مورفولوژی متفاوتی داشتند) در محیط غنی کننده تریپتیک سوی براث/آگار حاوی 5/0 میلی مولار یون کادمیوم، از 25 نمونه آب جمع آوری شده از مناطق مختلف ایران جداسازی شد. تحمل پذیری ذاتی این سویه ها نسبت به یون سمی کادمیوم به وسیله روش میکروپلیت الیزا تعیین گردید. براساس نتایج به دست آمده، 32 سویه باکتری جداسازی شده تحمل پذیری بین 5/0 تا 10 میلی مولار را نسبت به یون سمی کادمیوم از خود نشان دادند (شکل 1). در این میان 11 سویه باکتری (نامگذاری شده تحت عنوان Cd3, Cd4, Cd7, Cd8, Cd11, Cd18, Cd19, Cd20, Cd21, Cd26, Cd30) که تحمل پذیری بالاتر از 5 میلی مولار را از خود نشان دادند انتخاب و جهت بررسی قابلیت احیای یون سولفات کادمیوم به نانو سولفید کادمیوم (به صورت خارج سلولی) در محیط تریپتیک سوی براث مورد بررسی قرار گرفتند.

 

شکل 1- الگوی تحمل پذیری سویه­های باکتری آبزی به یون سمی کادمیوم در محیط کشت تریپتیک سوی براث

 

از میان 11 سویه باکتری با قابلیت تحمل پذیری بالا نسبت به یون سمی کادمیوم، تنها سوپرناتانت کشت سویه Cd11، جدا شده از آب جمع آوری شده از سواحل قشم، قادر به احیای خارج سلولی یونهای کادمیوم به نانو سولفید کادمیوم در غلظت 1 میلی مولار از یون سمی کادمیوم بود که با استفاده از آنالیزهای طیف سنجی جذبی و نشری UV-vis اسپکتروفتومتری و فلورسانس مشخص شد. آنالیز نمونه­ها با اسپکتروفتومتری UV-vis، یک پیک جذبی مشخص را در طول موج نانومتر 367 نانومتر (پیک اختصاصی برای نانوذرات سولفید کادمیوم) را نشان داد که بیانگر وجود کوانتوم دات سولفید کادمیوم در مخلوط واکنش زیست تبدیلی است (شکل 2 قسمت الف). براساس منابع معتبر بیشینه پیک جذبی نانوذرات سولفید کادمیوم در طول موجهای 360 تا 425 نانومتر می باشد (4). در محلول کنترل (عاری از سوپرناتانت کشت باکتری)، در طول موجهای بین 300 تا 700 نانومتر هیچ پیک جذبی مشاهده نشد (شکل 2 قسمت ب).

 

 

شکل 2- طیفهای اسپکتروفتومتری محلولهای سولفات کادمیوم  (غلظت یون کادمیوم 1 میلی مولار، pH برابر 7)، عاری از سوپرناتانت (قسمت ب) و به دنبال اضافه کردن سوپرناتانت کشت سویه Cd11 (قسمت الف)، پس از 8 ساعت واکنش زیست تبدیلی در 25 درجه سانتی گراد روی شیکر مدور (150 دور در دقیقه).

 

در ادامه و با هدف اطمینان از تشکیل نانوسولفید کادمیوم در واکنش زیست تبدیلی توسط سوپرناتانت کشت سویه باکتری Cd11، آنالیز نمونه ها به کمک طیف سنجی فلورسانس انجام شد. آنالیز نمونه­ها با طیف سنجی فلورسانس، یک پیک نشری مشخص را در طول موج نانومتر 445 نانومتر را نشان داد که بیانگر وجود نانو سولفید کادمیوم در مخلوط واکنش زیست تبدیلی است (شکل 3). براساس منابع معتبر بیشینه پیک نشری نانوذرات سولفید کادمیوم در طول موجهای 440 تا 470 نانومتر می باشد (30). در محلول کنترل (عاری از سوپرناتانت کشت باکتری)، در طول موجهای بین 250 تا 550 نانومتر هیچ پیک نشری مشاهده نشد.

 

 

شکل 3- طیفهای نشری فلورسانس محلولهای سولفات کادمیوم  (غلظت یون کادمیوم 1 میلی مولار، pH برابر 7)، عاری از سوپرناتانت (کنترل) و به دنبال اضافه کردن سوپرناتانت کشت سویه Cd11 (نمونه)، پس از 8 ساعت واکنش زیست تبدیلی در 25 درجه سانتی گراد روی شیکر مدور (150 دور در دقیقه).


شناسایی فنوتیپی و مولکولی سویه منتخب Cd11: سویه باکتری Cd11 که براساس آنالیزهای ظاهری و مشاهدات دستگاهی با استفاده از آنالیزهای اسپکتروفتومتری و فلورسانس قابلیت احیای زیستی سولفات کادمیوم به کوانتوم دات سولفید کادمیوم را دارا بود، انتخاب و براساس ویژگیهای ریخت شناسی و بیوشیمیایی تشخیصی متداول باکتریها مورد شناسایی قرار گرفت (جدول 1).

 

جدول 1- ویژگیهای فنوتیپی و بیوشیمیایی سویه منتخب Cd11

سویه CD11

ویژگی

سویه CD11

ویژگی

منفی

تولید  اسید از گلوکز

میله ای شکل

شکل ظاهری

منفی

تولید  اسید از فروکتوز

منفی

واکنش گرم

منفی

تولید  اسید از آرابینوز

مثبت

تست اکسیداز

منفی

تولید  اسید از مانیتول

مثبت

تست کاتالاز

منفی

تولید  اسید از سوکروز

مثبت

احیای  نیترات

مثبت

تولید  اسید از اتانول

مثبت

مصرف سیترات

مثبت

تولید  اسید از گلیسرول

منفی

هیدرولیز اوره

منفی

تولید  اسید از مالتوز

منفی

هیدرولیز ژلاتین

منفی

تولید  اسید از زایلوز

منفی

هیدرولیز کازئین

مثبت

رشد در 37 درجه سانتی گراد

منفی

هیدرولیز تویین 80

مثبت

رشد در 42 درجه سانتی گراد

مثبت

هیدرولیز تیروزین

 

 

براساس خصوصیات مورفولوژیک و بیوشیمیایی و بر طبق کتابهای مرجع، سویه Cd11 به طور موقت به عنوان Pseudomonas pseudoalcaligenesتشخیص داده شد. جهت شناسایی دقیق سویه Cd11، ابتدا DNA ژنومی استخراج (شکل 4 قسمت الف ) و سپس ژن کد کننده نواحی 16S rDNAاز طریق پرایمرهای یونیورسال fd1 و rp2 مورد واکنش PCR قرار گرفت (شکل 4 قسمت ب). همان گونه که در شکل قابل مشاهده می باشد محصول PCR مناسب در ناحیه pb 1500 نمایان شده که بیانگر خلوص DNA مورد استفاده جهت تعیین توالی می باشد.

 

شکل 4- (الف) تصویر DNA ژنومی استخراج شده (ب) ژل الکتروفورز محصول PCR سویه منخب Cd11: ستون 1 مارکر یک کیلوبازی فرمنتاز، ستونهای 2 و 3: سویه باکتری Cd11 و ستون 4: کنترل منفی (فاقد DNAی الگو)

پس از مشخص شدن توالی ژن 16S rDNA سویه مذکور و بلاست نمودن آن در سایت اینترنتی NCBI، باکتری مورد نظر شناسایی شد. براساس نتایج حاصل از بلاست این سویه دارای مشابهت بیش از 98 درصدی با سویه­های متعلق به گونه باگتری P. pseudoalcaligenes می باشد. بعد از تعیین توالی ژن S rDNA16، این ژن در بانک اطلاعات ژنی با شماره دسترسی MG857585 ثبت شد. تجزیه و تحلیلهای فیلوژنیکی نیز تأیید کرد که سویه مورد نظر به جنس Pseudomonas تعلق دارد و علاوه بر این احتمالاً می تواند به عنوان سویه جدید متعلق به گونه باکتری P. pseudoalcaligenes طبقه بندی شود. در درخت فیلوژنی (شکل 5) که بر اساس آنالیزهای توالی ژن S rDNA16 به روش neighbor-joining به دست آمده است، موقعیت سویه Cd11 در میان گونه های متعلق به جنس Pseudomonas نشان داده شده است.

اثر فاکتورهای مختلف بر روی تولید نانوسولفید کادمیوم در واکنش کاتالیست شده توسط سوپرناتانت کشت باکتریCd11P.  pseudoalcaligenes:همان گونه که در شکل (6 قسمتهای الف تا د) نشان داده شده است، بیشترین تولید نانوسولفید کادمیوم در غلظت بهینه 3 میلی مولار از یون کادمیوم، دمای 35 درجه سانتی گراد، pH برابر 8 و پس از 10 ساعت گرماگذاری مشاهده شده است.

 

 

شکل 5- درخت فیلوژنی سویه Cd11 و دیگر اعضای جنسPseudomonas  بر اساس ژن تکتیریافته S rDNA16. شماره دسترسی سویه های ثبت شده در پرانتز آورده شده است.

 

شکل 6- اثر پارامترهای مختلف بر روی سنتز خارج سلولی نانو سولفید کادمیوم در مخلوط واکنش زیست تبدیلی حاوی سوپرناتانت کشت باکتری Cd11 P. pseudoalcaligenes. الف- تأثیر غلظتهای مختلف یون کادمیوم بعد از 8 ساعت گرماگذاری، تحت شرایط دمایی 25 درجه سانتی گراد، pH برابر 7 و دور شیکر rpm 150 ب- اثر دماهای مختلف بر روی سنتز نانوذرات بعد از 8 ساعت گرماگذاری در غلظت بهینه 3 میلی‌مولار یون کادمیوم، دور شیکر rpm 150 و تحت شرایط pH برابر 7 ج- تأثیر pH مختلف بر روی سنتز نانوذرات سولفید کادمیوم در غلظت بهینه 3 میلی مولار یون کادمیوم تحت شرایط دمای بهینه 35 درجه سانتی گراد و دور شیکر rpm 150 و د- اثر دوره گرماگذاری بر روی سنتز خارج سلولی نانو سولفید کادمیوم تحت شرایط بهینه شده توسط روش تک عاملی


بررسیهای میکروسکوپی و طیف سنجی نانوذرات تولید شده توسط Cd11P.  pseudoalcaligenes: به دنبال تشخیص اولیه سنتز نانوسولفید کادمیوم توسط باکتری Cd11P. pseudoalcaligenes، جهت بررسی ساختار، موفولوژی و پایداری نانوذرات تشکیل شده در محلول واکنش زیست تبدیلی از آزمونهای متفاوت از جمله هیستوگرام توزیع اندازه ذرات و تصویربرداری SEM، طیف سنجی پراش انرژی پرتو ایکس و طیف‌سنجی مادون قرمز فوریه استفاده شد. برای این منظور، درابتدا، مطالعات میکروسکوپ الکترونی روبشی و آنالیز توزیع ذرات با هدف بررسی شکل و پراکنش اندازه نانوسولفید کادمیوم سنتز شده به صورت برون سلولی توسط سوپرنانانت کشت باکتری Cd11P. pseudoalcaligenesتعیین گردید. در شکل (7) تصاویر تهیه شده توسط میکروسکوپ الکترونی SEM و دامنه پراکنش اندازه نانوذرات مذکور نشان داده شده است. همان گونه که در شکل (7) نشان داده شده است،تصاویر حاصل، سنتز نانوسولفید کادمیوم با پراکنش باریک اندازه ذرات (19-12 نانومتر) و متوسط اندازه ذرات 5/15 نانومتر را نشان داد.

 

 

شکل 7- (الف) تصویر SEM حاصل از نانوسولفید کادمیوم سنتز شده توسط سوپرناتانت کشتی Cd11 P. pseudoalcaligenesو (ب) هیستوگرام مربوط به دامنه پراکنش اندازه نانوسولفید کادمیوم سنتز شده.

 

در ادامه و با هدف تجزیه و تحلیل ساختاری و مشخص نمودن ترکیب عنصری نمونه نانوذره زیستی سنتز شده، از طیف سنجی پراش انرژی پرتو ایکس استفاده شد. در شکل (8) هریک از پیکهای نشان داده شده مختص یک اتم و نشانگر یک عنصر می باشند. آنالیز EDX وجود عناصر Cd و S را در ترکیب نانوذرات تشکیل شده در مخلوط واکنش زیست تبدیلی را تأیید می کند.

 

 

شکل 8- طیف EDX از نانوذرات سولفید کادمیوم سنتز شده توسط سوپرناتانت کشتی Cd11 P.  pseudoalcaligenes

 

در نهایت و با هدف بررسی وجود احتمالی عوامل پوشاننده (Capping Agents) زیستی در نانوذرات سنتز شده، آنالیز FTIR انجام شد (شکل 9). با توجه به نتایج به دست آمده از آنالیز FTIR می توان گفت که پیک پهن ظاهر شده در محدوده عدد موجی 3000 تا 3500 مربوط به گروه OH موجود در حلال آب و یا گروه کربوکسیلیک اسید می­باشد. از طرفی چون پیک مربوطه پهن می­باشد می­توان گفت که گروه OH پیوند هیدروژنی برقرار نموده است. این پیوند می­تواند مربوط به خود حلال آب یا مربوط به پیوند ­ OH با ترکیبات آمینی موجود در ساختار پروتئین پوشش دهنده باکتری باشد. دو پیک ظاهر شده در محدوده 2929 ­تا 2962 مربوط به گروه C-H کششی موجود در ترکیبات آلی می­باشد. پیک ظاهر شده در عدد موجی 1652 مربوط به C=O کششی در ترکیبات آلی است. پیک ظاهر شده در عدد موجی 1033 مربوط به پیوند C-N موجود در پروتئینها می­باشد و در نهایت پیک ظاهر شده در عدد موجی 86/556 مربوط به تشکیل پیوند فلزی می­باشد که این می­تواند نشان بدهد پیوند Cd-S در این محدوده تشکیل گردیده و نشان از سنتز نانوذرات زیستی سولفید کادمیوم توسط باکتری است (شکل 9).

 

 

شکل 9- طیف FTIR از نانوذرات سولفید کادمیوم سنتز شده توسط سوپرناتانت کشتی Cd11 P.  pseudoalcaligenes


نتایج حاصل از بررسی فعالیت ضد میکروبی نانوذرات سولفید کادمیوم تشکیل شده توسط سوپرناتانت کشت باکتری Cd11P. pseudoalcaligenesبه روش انتشار از چاهک بر آگار: نتایج بررسی فعالیت ضد میکروبی نشان‌‌دهنده اثر مهاری نانوذرات سولفید کادمیوم تولید شده می‌باشد. طی این روش، بیشترین اثر مهاری نانوذره برعلیه باکتری L. plantarum با مهار 38 میلی‌متر از خود نشان داد و کمترین میزان مهارکنندگی را با مهار 18 میلی‌متری برعلیه باکتری P. fluorescens نشان داد. اثر مهاری بر سایر باکتریهای مورد مطالعه نیز با میانگین مهاری 19 تا 35 میلی‌متری نشان داده شد (شکل 10).

 

 

شکل 10- اثر مهاری نانوذرات سولفید کادمیوم تشکیل ‌شده در مخلوط واکنش زیست تبدیلی برعلیه برخی گونه های باکتری.


بحث

با توجه به مشکلات عمده­ای که در روشهای فیزیکی و شیمیایی برای سنتز نانوذرات فلزی وجود دارد، استفاده از میکرواورگانیسم های محتلف به­عنوان نانوکارخانه های بالقوه سبز برای سنتز نانوذرات فلزی همسو و سازگار با محیط زیست، پایدار و همچنین مقرون به صرفه بودن از نظر اقتصادی پیشنهاد شده است. نانوذرات فلزی شامل نانوذرات عنصری، نانواکسیدهای فلزی و سولفیدهای فلزی (به ویژه کوانتوم دات سولفید کادمیوم) دارای خواص الکتریکی منحصر به فردی هستند که با توجه به این خواص در بسیاری از زمینه­های تحقیقاتی کاربرد دارند. در حال حاضر این نانو ذرات به عنوان بهترین حامل برای تحویل دارو و بیوسنسور ظاهر شده­اند. کار کردن روی سطح این نانو ذرات به راحتی انجام می­پذیرد و می­توان لیگاند­های مختلف مانند قندها، پپتید­ها، پروتئین و DNA به آنها متصل شوند. از کار ­برد­های این نانو ذرات می­توان به: تحویل فعال دارو، آزمایشهای تشخیص زیستی و تصویر برداری اشاره کرد (17 و 29). در این پژوهش، جداسازی و تعیین هویت سویه‌های باکتری آبزی با توانمندی سنتز برون سلولی نانوذرات سولفید کادمیوم مورد مطالعه قرار گرفت. میکروارگانیسم­های دریازی شامل باکتری، مخمر، قارچ، سیانوباکتر و اکتینو­باکتر می­باشد که در اقیانوسها زندگی می­کنند و 98 درصد از زیست توده اقیانوسها را تشکیل می­دهند. این میکروارگانیسم­ها در دریا که محیطی پر تنش است در طیف وسیعی از شرایط اسیدی، قلیایی، حرارت بالا، مواد مغذی کم، محتوای فلزی بالا و شوری بیش از حد حضور دارند. شرایط در دریاها پویاست و میکرارگانیسم­هایی که در آن حضور دارند دارای مکانیسمهای منحصر به فرد برای انطباق سریع با این تغییرات هستند (5). عواملی مانند انتشار فاضلابهای صنعتی، حمل ونقلهای دریایی، آتشفشانها، فرسایش سنگها و نشت نفت باعث افزایش اثرات مواد تشکیل دهنده آلی و غیره آلی در محیط دریا می­شوند. میکرارگانیسم­هایی که در چنین محیطهای خشنی زندگی می­کنند اغلب انواع مولکولهای زیستی را برای مقابله با آلودگیهای مختلف از جمله گونه­های فلزی سنتز می­کنند. اکثر میکروارگانیسم­ها که در حضور فلزات زندگی می­کنند از طریق مکانیسمهایی مانند جذب زیستی، رسوب زیستی و ترشح خارج سلولی خود را با شرایط سازگار کرده­اند. نتیجه این فرآیندها ممکن است منجر به سنتز نانوذرات به شکل داخل سلولی یا خارج سلولی شود. در حال حاضر روشهای میکروبی برای سنتز نانومواد با ترکیبات مختلف بسیار محدود بوده و بیشتر مربوط به سنتز نانو ذرات فلزی و تا حدودی سولفیدهای فلزی و تعداد بسیار کم از اکسید فلزها می­باشد. مطالعه میکروبهای دریازی برای بیوسنتز نانو ذرات و کشف مسیرهای بیوشیمیایی که منجر به کاهش یونهای فلزی می گردد بسیار حائز اهمیت است (13). براساس یافته‌های به‌دست‌ آمده در این پژوهش، سوپرناتانت P. pseudoalcaligenesسویهCd11قادر به سنتز زیستی نانوذرات سولفید کادمیوم به‌صورت برون سلولی بود. مزیت تولید برون سلولی نانوذره سولفید کادمیوم توسط سویه باکتری جدا شده در تحقیق حاضر در این است که تولید درون سلولی نانوذره مذکور پرهزینه بوده و نیاز به مراحل اضافی جهت استخراج نانوذرات از درون سلول دارد؛ بنابراین به‌وسیله باکتری مذکور می‌توان به تولید برون سلولی نانوذرات سولفید کادمیوم، بدون نیاز به مراحل پیچیده استخراج دست‌ یافت. سنتز برون سلولی نانوذرات سولفید کادمیوم تولید شده توسط باکتری P. pseudoalcaligenes Cd11 تحت شرایط بهینه واکنش زیست تبدیلی مورد بررسی قرار گرفت که بر اساس نتایج به‌دست‌ آمده، سوپرناتانت سویه مذکور بعد از مواجهه با محلول سولفات کادمیوم (غلظت بهینه 3 میلی‌مولار از یون کادمیوم)، قادر به سنتز برون سلولی نانوذرات سولفید کادمیوم کروی در محدوه پراکنش ذرات بین 12 تا 19 نانومتر با میانگین اندازه 5/15 نانومتر در pH بهینه برابر 8 و دمای بهینه 35 درجه سانتی‌گراد پس از 10 ساعت گرما‌گذاری در دور شیکر g 150 بوده است. در این پژوهش همچنین فعالیت ضد میکروبی نانوذرات سولفید کادمیوم تشکیل‌شده توسط سوپرناتانت کشت باکتری P. pseudoalcaligenesسویه Cd11، علیه برخی باکتریهای گرم مثبت، گرم منفی بررسی شد. نتایج نشان داد که نانوذرات زیستی تولیدشده علیه همه میکروبهای تست‌شده اثر مهارکنندگی رشد را دارد. با این ‌حال، حساسیت باکتریهای گرم مثبت تست شده در مقایسه با باکتریهای گرم منفی تست‌ شده بیشتر بود. سنتز برون سلولی نانوذرات سولفید کادمیوم در طیف وسیعی از میکروارگانیسم ها گزارش شده است. احمد (Ahmad) و همکاران (2) با استفاده از سوپرناتانت کشت قارچ Fusarium oxysporum، سنتز نانوذرات سولفید کادمیوم از محلول نمکی سولفات کادمیوم را در محدوده بین 5 تا 20 نانومتر را گزارش دادند. سانگی (Sanghi) و همکاران (28) با استفاده از سوپرناتانت قارچ Coriolus versicolor سنتز خارج سلولی نانوذرات سولفید کادمیوم از محلولهای نمکی نیترات کادمیوم و سولفید سدیم (به­عنوان پیش ساز) را در محدوده ذرات بین 8 تا 15 نانومتر را گزارش کردند. بای (Bai) و همکاران (4) با استفاده از سوپرناتانت کشت باکتری Rhodopseudomonas palustris، سنتز نانوذرات سولفید کادمیوم از محلول نمکی سولفات کادمیوم را در محدوده بین 6 تا 11 نانومتر را گزارش دادند. پرساد (Prasad) و همکاران (25) با استفاده از مخمر Sachharomyces cerevisiae موفق به دست یابی به نانوذرات خارج سلولی سولفید کادمیوم با پراکنش ذرات بین 5/2 تا 5/5 نانومتر از محلولهای پیش ساز کلرید کادمیوم و سولفید هیدروژن شدند. شانسوری (Shanshoury) و همکاران (30) با استفاده از سویه باکتری استاندارد Bacillus subtilis ATCC6633 موفق به سنتر خارج سلولی نانوذرات سولفید کادمیوم از پیش سازهای کلرید کادمیوم و سولفید سدیم با محدوده پراکنش 5/2 تا 5/5 نانومتر شدند. در مطالعه مشایه صورت گرفته، حسینی (Hosseini) و همکاران (14) با استفاده از سویه باکتری استانداردBacillus licheniformis MTCC 9555 موفق به سنتز برون سلولی نانوسولفید کادمیوم از پیش سازهای کلرید کادمیوم و سولفید سدیم با محدوده پراکنش 6/4 تا 6/5 نانومتر شدند. مالارکودی (Malarkodi) و همکاران (20) با استفاده از سویه باکتری Klebsiella pneumonia MAAموفق به دست یابی به نانوذراتخارج سلولی سولفید کادمیوم با پراکنش ذرات بین10 تا 25 نانومتر از محلولهای سولفات کادمیوم شدند. براساس نتایج حاصل از این پژوهش و در مقایسه با پژوهشهای مشابه صورت گرفته می توان گفت که نانوذرات سولفید کادمیوم سنتز شده از پیش ساز نمکی ارزان قیمت سولفات کادمیوم در مطالعه اخیر دارای دامنه پراکنش اندازه ذرات مناسب و همگن بوده که همین امر کارآیی نانوذرات زیستی سنتز شده را برای فعالیتهای آزمایشگاهی و پژوهشی مناسب می کند.

نتیجه گیری

جداسازی و شناسایی سویه­های جدید میکروبی با امکان تولید برون سلولی کوانتوم دات سولفید کادمیوم می تواند منجر به توسعه کاتالیزگرهای میکروبی کارآمد در صنایع فناوری نانو گردد. این پژوهش بر جداسازی و شناسایی سویه­های باکتری آبزی با قابلیت تحمل پذیری بالا به یون سمی کادمیوم و امکان بهره برداری از ترشحات باکتری به­عنوان کاتالیزگر برای سنتز برون سلولی نانوذرات سولفید کادمیوم متمرکز شده است. در این مطالعه برای نخستین بار سنتز برون سلولی کوانتوم دات سولفید کادمیوم در دامنه پراکنش محدود و همگن در سویه باکتری آبزی P. pseudoalcaligenese Cd11 گزارش شده است. بنابراین نتایج این پژوهش می تواند در راستای معرفی سویه­های میکروبی جدید به مراکز علمی پژوهشی، مراکز دانشگاهی و نانوزیست فناوری به منظور انجام تحقیقات بیشتر با هدف بهره برداری تجاری از نانوذرات سنتز شده، مورد استفاده قرار گیرد.

تشکر و قدردانی

این مقاله بخشی از پایان نامه کارشناسی ارشد بوده که با حمایت دانشگاه کردستان به انجام رسیده است. نویسندگان این مقاله از تمام کسانی که در اجرای این مطالعه همکاری نموده اند، کمال قدردانی و سپاسگزاری را دارد. 

1- آشنگرف م. 1393. معرفی سویه جدید مخمری Candida sp. strain MY2 با توان بالقوۀ سنتز سریع و برون سلولی نانوکریستالهای اکسید روی. مجله پژوهشهای سلولی و مولکولی (زیست شناسی ایران)، جلد 27، شماره 2، صفحات 155-166.

 

2- Ahmad, A. Mukherjee, P. Mandal, D. Senapati, S. Khan, M.I. Kumar, R. and Sastry, M. (2002) Enzyme mediated extracellular synthesis of CdS nanoparticles by the fungus Fusarium oxysporum. J Am Chem Soc 124:12108–12109.

3- Ajayan, P.M. Schadler, L.S. and Braun, P.V. (2003) Nanocomposite Science and Technology (Wiley VCH, Weinheim).

4- Bai, H. Zhang, Z. Guo, Y. and Yang, G. (2009) Biosynthesis of cadmium sulfide nanoparticles by photosynthetic bacteria Rhodopseudomonas palustris. Colloids Surf B 70: 142-146.

5- Baker, S. Harini, B.P. Rakshith, D. and Satish, S. (2013) Marine microbes: invisible nanofactories. J Pharm Res 6: 383–388.

6- Balouiri, M. Sadiki, M. and Ibnsouda, S.K. (2016) Methods for in vitro evaluating antimicrobial activity: a review. J Pharm Anal 6 (2): 71-79.

7- Bhatia, S. (2016) Nanoparticles types, classification, characterization, fabrication methods and drug delivery applications. In: Natural polymer drug delivery systems. Springer, pp 33–93.

8- Cunningham, D.P. and Lundie, L. (1993) Precipitation of cadmium by Clostridium thermoaceticum. Appl Environ Microbiol 59: 7-14.

9. Dameron, C. Reese, R. Mehra, R. Kortan, A. Carroll, P. Steigerwald, M. Brus, L. and Winge, D. (1989) Biosynthesis of cadmium sulphide quantum semiconductor crystallites. Nature 338: 596–597.

10- Hulkoti, N.I. and Taranath, T. (2014) Biosynthesis of nanoparticles using microbes—a review. Colloids Surf B: Biointerfaces 121: 474-483.

11- Holmes, J.D. Richardson, D.J. Saed, S.R. Evans-Gowing, D.A. and Russell, J.R. (1993) Cadmium-specific formation of metal sulfide ‘Q-particles’ by Klebsiella pneumoniae, Microbiology 14: 2521-2530.  

12- Holt, J.G. Krieg, N.R. Sneath, P.H.A. Staley, J.T. and Williams, S.T. (1994) Bergey's Manual of Determinative Bacteriology, 9nd ed. Baltimore: Williams and Wilkins.

13- Haferburg, G. and Kothe, E. (2007) Microbes and metals: interactions in the environment. J Basic Microbiol 47(6):453-67.

14- Hosseini, M.R. and Sarvi, M.N. (2015) Recent achievements in the microbial synthesis of semiconductor metal sulfide nanoparticles. Mater Sci Semicond Process 40: 293-301.

15- Kowshik, M. Deshmukh, N. Vogel, W. Urban, J. Kulkarni, S.K. and Paknikar, K.M. (2002) Microbial synthesis of semiconductor CdS nanoparticles, their characterization, and their use in the fabrication of an ideal diode. Biotechnol Bioeng 78:583–588.

16- Li, X. Xu, H. Chen, Z.S. and Chen, G. (2011) Biosynthesis of nanoparticles by microorganisms and their applications. J Nanomater 2011: 270974.

17- Mehdinia, A. Kazemi, S.H. Bathaie, S.Z. Alizadeh, A. Shamsipur, M. and Mousavi, M.F. (2009) Electrochemical DNA nano-biosensor for the study of spermidine–DNA interaction. J Pharm Biomed Anal 49: 587-593.

18- Mo, X. Wang, C. Hao, L. You, M. Zhu, Y. Chen, Z. and Hu, Y. (2001) Convenient microemulsionroutetostar-shaped cadmium sulphide pattern at room temperature. Mater Res Bull 36(11): 1925–1930.

19- Mubarak, A.D, Gopinath, V. Rameshbabu, N. and Thajuddin, N. (2012) Synthesis and characterization of CdS nanoparticles using C-phycoerythrin from the marine cyanobacteria. Mater Lett 74: 8-11.

20- Malarkodi, C. Rajeshkumar, K. Paulkumar, M. Vanaja, G. and Annadurai. G (2014) Biosynthesis and antimicrobial activity of semiconductor nanoparticles against oral pathogens, Bioinorg Chemistry Appl  (2014): 1-10.

21- Malorny, B., Hoorfar, J., Bunge, C and Helmuth, R. (2003) Multicenter validation of the analytical accuracy of Salmonella PCR:  towards an international standard. Appl Environ Microbiol 69, 290-296.

22- Narayanan, K.B. Sakthivel, N. (2010) Biological synthesis of metal nanoparticles by microbes. Adv Colloid Interface Sci 156: 1–13.

23- Pawar, V. Shinde, A. Kumar, A.R. Zinjarde, S. and Gosavi, S. (2012) Tropical marine microbe mediated synthesis of cadmium nanostructures  Sci AdvMater 4: 135-142.

24- Pena, J. Martinez, A. Conde, F. Gonzalez-Callet, J.M. and Vallet-Regi, M. (1997) In situ growth of SrTiO3 thin films prepared by AACVD from strontium and titanium oxide bisdipivaloylmethanates, Solid State Ionics 101–103 (1997) 183.

25- Prasad, K. Jha, A.K. (2010) Biosynthesis of CdS nanoparticles: an improved green and rapid procedure. J Colloid Interface Sci 342: 68-72.

26- Raj, V. Dalei, K. Chakraborty, J. and Das, S. (2016) Extracellular polymeric substances of a marine bacterium mediated synthesis of CdS nanoparticles for removal of cadmium from aqueous solution. J Colloid Interface Sci 462: 166-175.

27- Rai, M. Gade, A. Yadav, A. (2011) Biogenic nanoparticles: an introduction to what they are, how they are synthesized and their applications, Metal nanoparticles in microbiology, Springer, pp. 1-10.

28- Sanghi R, Verma, P. (2009) A facile green extracellular biosynthesis of CdS nanoparticles by immobilized fungus. Chem Eng J 155: 886-891.

29- Slowing, I.I. Vivero-Escoto, J.L. Wu, C.W. and Lin, V.S.Y. (2008) Mesoporous silica nanoparticles as controlled release drug delivery and gene transfection carriers. Adv drug deliv rev 60: 1278-1288.

30- Shanshoury, A.E.R.R. Elsilk. S.E.  Ebeid M.E. (2012) Rapid biosynthesis of cadmium sulfide (CdS) nanoparticles using culture supernatants of Escherichia coli ATCC 8739, Bacillus subtilis ATCC 6633 and Lactobacillus acidophilus DSMZ 20079T. Afr J Biotechnol 11: 7957-7965.

31- Steen, W.M. and Mazumder, J. (2010) Laser Material Processing (4th edition). Great Britain. Springer-Verlag. ISBN 978-1-84996-062-5.

32- Sweeney, R.Y.C. Mao, X. Gao, J.L. and Burt, A.M. (2004) Belcher, G. Georgiou, B.L. Iverson, Bacterial biosynthesis of cadmium sulfide nanocrystals. Chem Biol 11: 1553-1559.

33- Tamura, K. Stecher, G. Peterson, D. Filipski, A. Kumar, S. (2013) MEGA6: molecular evolutionary genetics analysis version 6.0. Mol Biol Evol. 30: 2725–2729

34- Weisburg, W.G. Barns, S.M. Pelletier, D.A. and Lane, D.J. (1991) 16S ribosomal DNA amplification for phylogenetic study. J Bacteriol. 173: 697–703.

35- Xie Q., Wang Y., Pan B., Wang H., Su W., Wang X., A novel photocatalyst LaOF: Facile fabrication and photocatalytic hydrogen production, Catal. Commun 27 (2012) 21-25.