نوع مقاله: مقاله پژوهشی

نویسندگان

1 گروه زیست شناسی دانشکده علوم پایه دانشگاه آزاد اسلامی واحد اهر، ایران

2 گروه علوم دامی دانشگاه آزاد اسلامی، واحد شبستر

چکیده

چکیده:
سرطان تخمدان شایع ترین سرطان در زنان است که برخی از عوامل محیطی و ژنتیکی در بروز این سرطان نقش دارند. تحقیقات بالینی نشان داده‌اند که بیان بیش از حد ژن HER2 باعث سرطان‌زایی می شود که دربرگیرنده 20 الی 30 درصد سرطان‌های پستان و تخمدان می‌باشد. در این تحقیق چند شکلی بخشی از کدون 655 ژن HER2(rs1136201) در ارتباط با سرطان تخمدان مورد بررسی قرار گیرد.
مواد و روش ها: در این مطالعه پلی مورفیسم ژن her2(1136201) در 70 نفر خانم مبتلا به سرطان تخمدان و 70 خانم سالم استان آذربایجان شرقی توسط روش PCR-RFLP با استفاده ازآنزیم BSMI مورد بررسی قرار گرفت.
نتایج: توزیع چندشکلی جایگاه HER2(rs1136201) در دوگروه سالم و بیمار بیشترین تفاوت را در ژنوتیپ AA نشان داد (40 در برابر 3) یعنی بین فراوانی ژنوتیپ‌های هموزیگوت در گروه سالم و بیمار اختلاف معنی دار بود. آزمون کای مربع برای بررسی تفاوت فراوانی ژنوتیپ‌ها در دو جمعیت، حاکی از آن است که بین دو جمعیت از لحاظ مقدار فراوانی اختلاف معنی داری وجود دارد (P<0/0001) که نشان دهنده ارتباط احتمالی این جایگاه با بروز بیماری است.
نتیجه‌گیری: نتایج حاصل از این مطالعه نشان داد که چندشکلی ژن her2 ریسک ابتلا به سرطان تخمدان را افزایش می دهد.

کلیدواژه‌ها

موضوعات

عنوان مقاله [English]

The study of her2 codon 655 gene polymorphism relationship with ovarian cancer in East Azarbaijan Province

نویسندگان [English]

  • seyedeh rogayeh tizmaghz 1
  • abolfazl gorbani 2

1 Faculty of Basic Sciences Biology Department, azad Islamic Ahar university, Ahar, Iran

2 Department of animal Sciences, Islamic azad university, shabestar branch

چکیده [English]

Abstract
Ovarian cancer is the most common cancer among women that some environmental and genetic factors contribute to this cancer. Clinical research has shown that excessive expression of HER2 gene leads to carcinogenesis, which includes 20-30% of ovarian and breast cancers. In this study, the polymorphism of a part of codon of 655 HER2(rs1136201) gene associated with ovarian cancer was studied.
Materials and methods: in this study, the polymorphism of HER2 (1136201) was studied gene in 70 women with ovarian cancer and 70 healthy women in East Azerbaijan province using of BSMI enzyme by PCR-RFLP method.
Results: The distribution of polymorphism of HER2 (rs1136201) site provided the most differences in AA genotype between healthy group and unhealthy one (40 against 3); that is, there was a significant difference in the frequency of homozygote genotypes between healthy and patient groups. Chi-Square test used for studying the difference of genotype frequency between two population indicates that there is a significant difference between two population in terms of abundance (p<0/0001), which is the indicator of probable relation of this site with the incidence of disease.
Conclusion: The results of this study showed that the polymorphism of HER2 gene increases the risk of ovarian cancer.

کلیدواژه‌ها [English]

  • ovarian cancer
  • her2
  • PCR-RFLP

بررسی ارتباط چند شکلی کدون 655 ژن her2 با ابتلاء به سرطان تخمدان در استان آذربایجان­شرقی

رقیه تیزمغز1 و ابوالفضل قربانی2*

1 ایران، اهر، دانشگاه آزاد اسلامی، واحد اهر، دانشکده علوم پایه، گروه زیست شناسی

2 ایران، شبستر، دانشگاه آزاد اسلامی، واحد شبستر، دانشکده علوم دامی و دامپزشکی، گروه علوم دامی

تاریخ دریافت: 5/9/96                     تاریخ پذیرش: 16/11/96

چکیده

سرطان تخمدان ششمین سرطان شایع در زنان است که برخی از عوامل محیطی و ژنتیکی در بروز این سرطان نقش دارند. تحقیقات بالینی نشان داده­اند که بیان بیش از حد ژن her2 باعث سرطان­زایی می شود که دربرگیرنده 20 الی 30 درصد سرطانهای پستان و تخمدان می­باشد. بنابراین در پژوهش حاضر ارتباط چند شکلی بخشی از کدون 655  ژن her2 که با تغییر در فرم فعال گیرنده همراه است با ابتلاء به سرطان تخمدان مورد بررسی قرار گرفت. در مواد و روشهای این مطالعه، چندشکلی ژن فوق در 70 خانم مبتلا به سرطان تخمدان و 70 خانم سالم استان آذربایجان شرقی توسط روش PCR-RFLP با استفاده ازآنزیم BSMI مورد بررسی قرار گرفت. نتایج توزیع چندشکلی جایگاه مورد بررسی در دوگروه سالم و بیمار بیشترین تفاوت را در ژنوتیپ AA نشان داد (40 در برابر 3). بررسی تفاوت فراوانی ژنوتیپها در دو گروه با استفاده از آزمون کای مربع، اختلاف آماری معنی داری را بین دو گروه نشان داد (P<0/0001)  که بیانگر ارتباط احتمالی این جایگاه با بروز بیماری است. نتیجهگیری حاصل از این مطالعه نشان داد که چندشکلی ژن her2 در جایگاه فوق، ریسک ابتلاء به سرطان تخمدان را افزایش می دهد.

واژه های کلیدی: سرطان تخمدان- HER2 –PCR- RFLP

* نویسنده مسئول، تلفن: 09143002191، پست الکترونیکی: abolfazlgorbani@gmail.com

مقدمه

 

سرطان تخمدان ششمین سرطان شایع است که در میان زنان کشورهای توسعه یافته باعث مرگ می‌شود. تقریباً سالانه 190 هزار مورد سرطان تخمدان گزارش می‌شود (9) و بیشترین شیوع این بیماری، در کشورهای صنعتی و غربی می‌باشد (18). این سرطان در اکثر موارد به دلیل نداشتن علایم و نشانه‌های خاص و نبود غربالگری صحیح جهت تعیین و تشخیص سریع نارساییهای تخمدان، دیر شناسایی می‌گردد (29).

سابقه فامیلی سرطان تخمدان، اندومتریوزیس، کاهش قرار گیری در معرض نور خورشید، استفاده از درمانهای هورمونی و ژنتیک از عوامل خطر مهم ابتلاء به سرطان تخمدان در زنان می‌باشد. به طوری‌که در حدود 10 درصد سرطانهای بدخیم اپیتلیایی تخمدان به دلیل وجود جهش‌های ارثی در ژنهای با نفوذپذیری بالا رخ می‌دهد (4، 13، 14، 16 و 36).

تقریباً 90 درصد سرطانهای تخمدان را سرطان اپیتلیال تخمدان تشکیل می‌دهد که هتروژن بوده و رده‌بندی آن براساس نوع سلول درگیر است (5). هر یک از این تومورها به نوبه خود به سه گروه خوش‌خیم، بینابینی و بدخیم تقسیم می‌شوند (26). بیان بیش از حد و جهش در برخی از ژنها نظیر فاکتور رشد شماره ۲ ایپیدرمال (her2) نقش مهمی در ابتلاء به سرطان تخمدان دارد. این ژن که روی بازوی بلند کروموزوم 17(17q12)  انسان قرار دارد عضوی از خانواده گیرنده فاکتور رشد اپیدرمال است که به خانواده گیرنده تیروزین کینازها تعلق داشته (7، 19 و 30) و شامل چهار گیرنده همسان می‌باشد. her2 شامل یک پروتئین با 1255 اسید آمینه و یک گلیکو پروتئین تراغشایی 185 کیلو دالتون است (3). گیرنده her2 در اکثر بافتها بیان می‌شود و نقش مهم و کلیدی درعمل‌کردهایمختلفازقبیلرشدوتکثیر وتمایزسلولیدارد (33). تحقیقات بالینی نشان داده است بیان یا تولید بیش از حد her2 با بیش از 30 درصد سرطانهای تخمدان همراه است (6، 20، 21، 34 و 39). همچنین افزایش بیان ژن her2 در افراد مبتلا به سرطان معده (8 و 20) و سرطان روده بزرگ، مشاهده شده است (17 و 37) و مشخص شد این افزایش بیان ارتباط نزدیکی با کاهش بقا دارد (4).

 علاوه بر نقش کلیدی بیان بیش از حد ژن her2 در ابتلاء به سرطان، تغییر در ترکیبات آمینواسیدی گیرنده نیز ممکن است موجب ایجاد فرم فعال آن و خطر ابتلاء به سرطان گردد (25). در حمایت از این مطلب چندشکلی نوکلئوتیدی موجود در تراغشا که توسط بخشی از کدون 655 ژن her2  کد می‌شود، شناسایی شد که منجر به جایگزینی والین (GTC) به جای ایزولوسین (ATC) می‌شود (32). چندین مطالعه در رابطه با ارتباط بین این چندشکلیهای ژنتیکی her2 کدون 655 در نژادهای مختلف انجام شده است (28).

در حالت طبیعی وجود ایزولوسین در کدون 655 در ناحیه تراغشایی باعث دیمری شدن ناقص پروتئینهای her2 فعال و کاهش انتقال سیگنالی در مقایسه با گونه‌های تغییر یافته ژنتیکی که والین در کدون 655 دارند، می گردد (10 و 30).

چندین تحقیق ارتباط چندشکلی این جایگاه را با ابتلاء به سرطانهای تخمدان و سینه تأیید کرده و ژنوتیپ هموزیگوت لوسین را به عنوان ژنوتیپ مستعد ژنتیکی در بروز سرطان معرفی نمودند (15، 22، 27 و 35).

استفاده از نشانگرهای مولکولی از جمله PCR-RFLP در سالهای اخیر جهت تعیین  تنوع ژنتیکی بین جمعیتها کاربرد گسترده‌ای یافته است. به کمک این چندشکلیها می‌توان ارتباط بین ژنوتیپها و صفات مختلف و تفاوتهای ژنتیکی بین جمعیتها را بررسی نمود (11، 12، 31 و 38). این روش مبتنی بر هضم الگو توسط اندونوکئازهای اختصاصی بوده و با تفسیر باندها روی ژل چندشکلیها شناسایی می‌گردد و بیشترین کاربرد را در بررسی و دریافتهای کروموزومی و نقشه برداری از چند شکلیهای مرتبط با بیماریها از جمله سرطان دارد. اولین گزارش قطعی از کاربرد آن برای شناسایی کم خونی می‌باشد (23، 24 و 39). اطلاعات کمی در مورد ارتباط پلی مورفیسمکدون 655 ژنher2با سرطان تخمدان وجود دارد.

به‌طور کلی با توجه به مطالب یاد شده و به‌دلیل اینکه تاکنون ارتباط چند شکلیکدون 655ژن her2 با سرطان تخمدان در استان آذربایجان شرقی بررسی نشده است و از سوی دیگر چندشکلی این ناحیه در جمعیتهای مختلف متفاوت است. از این رو پژوهش حاضر با هدف بررسی ارتباط چند شکلی ژن  (A/G) کدون 655 ژن با ابتلاء به سرطان تخمدان در منطقه طرح ریزی گردید.

مواد و روشها

افراد مورد مطاله شامل زنان در گروه سنی 25 تا 80 سال از جمعیت استان آذربایجان شرقی بودند. حجم نمونه براساس تحقیقات قبلی و همچنین روابط آماری مناسب 140 نفر در کل انتخاب شد که شامل دو گروه کنترل با 70 خانم سالم (جواب پاتولوژی منفی نمونه تخمدان از نظر سرطان تخمدان) و گروه بیمار با 70 خانم مبتلا به سرطان تخمدان (جواب پاتولوژی مثبت) بود. تمام نمونه­ها از بخش پاتولوژی بیمارستان الزهراء تبریز در مدت 8 ماه با اخذ مجوزهای لازم تهیه شد. بلوک پاتولوژی تمام افراد مورد نظر جدا شده و برش داده شد و DNA آنها با استفاده از کیت استخراج DNA  یکتا تجهیز (cat numi 9030) خالص‌سازی شد. DNA استخراج شده در میکروتیوبها و در دمای 20- درجه نگهداری گردید.

قطعه 148 جفت بازی از کدون 655 ژن her2 توسطآغازگرهای پیش رو

(5`AGAGCGCCAGCCCTCTGACGTCCAT3`)  و پس رو

 5`TCCGTTTCCTGCAGCAGCAGTCTCCGCA3`) و برنامه دمایی پنج دقیقه در 95 درجه برای دناتوراسیون اولیه و برای تکثیر در 35 سیکل یک دقیقه در 95 درجه سانتی‌گراد، یک دقیقه در 62 درجه سانتی­گراد و یک دقیقه در 72 درجه سانتی‌گراد و در نهایت 10 دقیقه در 72 درجه سانتی‌گراد تکثیر گردید. بعد از اطمینان ازصحت تکثیر قطعه مورد نظر با استفاده از آنزیم BSMI و روش RFLP مورد هضم قرار گرفت و محصولات حاصل از هضم بعد از بارگذاری روی ژل 3 درصد مورد شناسایی قرار گرفتند.  برای محاسبه فراوانی و آزمون هاردی واینبرگ از نرم افزار Popgene S2 و برای بررسی ارتباط چند شکلی ژن مورد بررسی با احتمال ابتلاء به سرطان تخمدان در بین زنان استان آذربایجان شرقی از آزمون کای مربع در سطح احتمال 5 درصد و نرم افزار spss نسخه 24 استفاده شد. چنانچه ارزش p مقایسه فراوانی ژنوتیپها بین دو گروه بیمار و سالم کمتر از 5 درصد به دست می آمد این اختلاف به عنوان اختلاف معنی دار در نظر گرفته می شد و احتمال ارتباط معنی دار بین جایگاه مورد بررسی با بروز بیماری در بین زنان استان آذربایجان شرقی وجود داشت.

نتایج

در مطالعه حاضر میانگین سنی زنان مبتلا به سرطان تخمدان 91/14 ± 68/49 سال و میانگین سن زنان سالم 94/9±99/52 سال بود که اختلاف آماری معنی داری نداشت (p≥0.1).بعد از برش و آشکارسازی قطعات، آلل A با طول 148 جفت باز و آلل G با طول  116 و32 جفت باز مشاهده گردید در نتیجه سه ژنوتیپ AA با اندازه 148 جفت باز، AG بااندازه 148، 116 و 32 جفت باز و GG با اندازه 116 و 32 جفت باز مشاهده شد. فراوانی ژنوتیپی و آللی دو گروه از نظر جایگاه مورد نظر مورد بررسی قرار گرفت (جدول 1 و شکل 1). نتایج نشان داد که در گروه بیمار ژنوتیپ AA با فراوانی 635/0 درصد و آلل A با 802/0 درصد بیشترین و ژنوتیپ GG با فراوانی 217/0 درصد و آلل G با فراوانی 198/0 درصد کمترین فراوانی را داشتند. در حالی که در گروه سالم ژنوتیپ AG و آلل G دارای بیشترین فراوانی بود. در بررسی کل جمعیت نیز ژنوتیپ AG با فراوانی 578/0 درصد و آلل A با فراوانی  607/0 درصد بیشترین فراوانی را داشتند. بررسی تعادل هاردی-­واینبرگ در جمعیت مورد مطالعه به تفکیک گروههای سالم و بیمار نشان داد که گروه بیمار در تعادل می­باشد در حالی­که گروه سالم و کل جمعیت در تعادل هاردی واینبرگ نمی­باشند که دلیل این امر می­تواند کوچک بودن جمعیت مورد مطالعه باشد.

بر اساس نتایج، توزیع چند شکلی جایگاه کدون 655 ژن her2 در دو گروه سالم و بیمار بیشترین تفاوت را در ژنوتیپ AA نشان داد ( 40 در برابر 3) و بررسی تفاوت فراوانی ژنوتیپها در دو جمعیت با آزمون کای مربع اختلاف آماری معنی داری را بین دو گروه نشان داد (P<0/0001) که بیانگر ارتباط احتمالی این جایگاه با بروز بیماری است.

برای مقایسه بهتر ژنوتیپها و یافتن ژنوتیپ احتمالی دخیل در بیماری مقایسه بین دو گروه سالم و بیمار به ترکیبات صفحه بعد انجام گرفت.

 

 

جدول 1- جدول توزیع فراوانی، آزمون کای مربع تعادل هاردی واینبرگ، فراوانی اللی، ارزش p مقایسه دو گروه سالم بیمار و برآورد odd ratio و دامنه اطمینان برای جایگاه کدون 655 ژن her2 درگروه­ در زنان استان آذربایجان شرقی

 

فراوانی ژنوتیپ­ها

فراوانی الل­ها

تعادل

هاردی

واینبرگ

مقایسه فراوانی دو گروه سالم و بیمار

 

AA

AG

GG

A

G

ارزش کای مربع

ارزش P

بیمار

(635/0)40

(333/0)21

(022/0)2

880/0

12/0

14/0

0001/0

سالم

(042/0)3

(792/0)57

(167/0)12

436/0

562/0

*66/26

کل

(319/0)43

(579/0)78

(102/0)14

607/0

393/0

*40/6

Odd ratio(CI)

(2-95) 13/0

(16-96/38)60/0

1

 

 

 

 

ارزشp

0001/0

0001/0

---

 

 

 

 

                 

 

 

الف) ژنوتیپهای حاول آلل A در مقابل ژنوتیپ هموزیگوت GG: این مقایسه با استفاده از آزمون کای مربع مورد بررسی قرار گرفت و نتایج حاکی از آن بود که ژنوتیپهای حاوی آلل A در بروز بیماری نسبت به ژنوتیپهای GG اختلاف معنی داری را نشان می‌دهد و مقدار OR حاکی از آن است که احتمالاً ژنوتیپهای حاوی A تا شش برابر در بروز بیماری بیشتر از ژنوتیپهای GG نقش دارند. (جدول 2).

 

جدول 2- مقایسه ترکیبی ژنوتیپهای حاوی آلل A در مقابل ژنوتیپ GG در زنان سالم و بیمار استان آذربایجان شرقی

گروه

ترکیب ژنوتیپی

AG       AA+AG

سطح معنی دار

OR(CI)

بیمار

سالم

61

60

2

12

1%

 (429/28، 309/1)1/6

         

                                                                                                     

 


ب)ژنوتیپهای حاوی آلل G در مقابل ژنوتیپ هموزیگوت AA : نتایج این مقایسه نشان می‌دهد که اختلاف معنی‌داری بین دوگروه وجود دارد و مقدار OR حاکی از تأثیر 40 برابری ژنوتیپ AA  در بروز بیماری می‌باشد و به نظر می‌رسد که افراد دارای این ژنوتیپ حساسیت بالایی نسبت به بروز بیماری نشان می‌دهند (جدول3).

 

جدول 3 - مقایسه ترکیب ژنوتیپهای حاوی آلل G در مقابل ژنوتیپ AA درزنان سالم و بیمار استان آذربایجان شرقی

گروه

ترکیب ژنوتیپی

GG+AG       AA

سطح معنی دار

OR(CI)

بیمار

سالم

40

3

23

69

0001/0

(97/141، 29/11) 40

         

                                                                                                     


ج) مقایسه افراد دارای آلل A  در مقابل افراد دارای آلل G: این مقایسه به منظور تأثیر آلل تأثیرگذار در بروز افزایش حساسیت بیماری انجام گرفت و نتایج به دست آمده مطابق جداول قبلی نشان داد که دو آلل در بروز بیماری اختلاف معنی داری دارند و آلل A نسبت به آلل G خطر ابتلاء به بیماری را احتمالاً حدود پنج برابر افزایش می­دهد که می تواند به عنوان نشانگر خطر در پیش بینی ابتلاء افراد  مورد نظر قرار گیرد.­ (جدول 4).

 

جدول 4- مقایسه افراد دارای آلل A در مقابل افراد دارای آلل G در دو گروه سالم و بیمار زنان استان آذربایجان شرقی

گروه

آللی

G            A

سطح معنی داری

OR(CI)

بیمار

سالم

101

63

25

81

0001/0

(983/8، 003/3)194/5

         

 

147

116

32

 

500

400

300

200

100

 

9          8         7        6           5          4          3          2           1          M

 

شکل 1- بررسی چند شکلی کدون 655 ژن her2 با از روش RFLP با استفاده از آنزیم BSMI روی ژن آگارز 3 درصد. نتیجه هضم دو آلل A با طول 148 جفت باز و آلل G با طول  116 و32 جفت باز مشاهده گردید . شماره 1 ژنوتیپ AA، شماره های 3،2، 6 ،7 و8  و9 ژنوتیپ AG و شماره های 4 و 5 ژنوتیپ GG و شمارM  مارکر 100 جفت بازی را نشان می دهند


بحث

بیماری سرطان دومین عامل مرگ و میر بعد از بیماریهای قلبی و عروقی در کشورهای صنعتی و کشورهای درحال توسعه می‌باشد. بنابراین امروزه توجه زیادی به تشخیص و درمان این بیماری معطوف شده است. ایران نیز در کمربند سرطانی دنیا قرار دارد(2). با وجود اینکه فاکتورهای خطر متعددی در بروز سرطان شناسایی و معرفی گشته ولی علت دقیق آن هنوز مبهم باقی مانده است (1). در بین همه سرطانهای دستگاه تناسلی زنان، بدخیمیهای تخمدان، بررسیهای بسیار گسترده بالینی را به خود اختصاص دادهاند. سرطانهای اپیتلیال تخمدان به دلیل آن که تا هنگام متاستاز معمولاً بدون علامت باقی می­ماند، رایج ترین بدخیمیهای تخمدان هستند که در بیش از دو سوم بیماران در هنگام تشخیص در مراحل پیشرفته بیماری هستند. سرطان تخمدان یکی از مباحث عمده در حیطه جراحی است، که نیاز به درمان جدی و غالباً پیچیده دارد و انرژی روانی و فیزیکی بیمار را تحلیل می­برد. این سرطان، در مقایسه با سایر بدخیمیهای دستگاه تناسلی زنان، از بالاترین موارد مرگ و میر برخوردار است(9).اطلاعات کمی در مورد ارتباط پلی مورفیسمکدون 655 ژنher2  با سرطان تخمدان وجود دارد. پینتو و همکاران هیچ توجیه قابل توجهی در توزیع ژنوتیپهای کدون 655 ژنher2  و آلل بین بیماران مبتلا به سرطان تخمدان و افراد سالم در پرتغال گزارش نکردند (21).

شامکوپریا و همکاران (2013) در بررسی ارتباط چند شکلی her2 با ابتلاء به سرطان تخمدان در زنان هندی، استعداد ژنتیکی ابتلاء به سرطان تخمدان در زنانی که برای اللG ژن her2 هموزیگوت بودند بالا بود (27). در این بررسی فراوانی ژنوتیپهای هموزیگوت در گروه بیمار و کنترل اختلاف معنی­داری داشت که فراوانی ژنوتیپ GG در گروه بیمار 8/13 و در گروه کنترل 1/1 و فراوانی ژنوتیپهای AA در گروه بیمار 3/65 و در گروه کنترل 6/82 درصد و (P<0/001) بود که در مقایسه آماری گروههای مورد این مطالعه نیز فراوانی ژنوتیپهای هموزیگوت و دو گروه بیمار و کنترل اختلاف معنی داری داشت در این مطالعه فراوانی ژنوتیپهای AA در گروه بیمار 6349/0 و در گروه کنترل 417/0 و فراوانی ژنوتیپهای GG در گروه بیمار 217/0 و در گروه کنترل 1667/0 بود و نتایج حاضر در مورد ژنوتیپهای هموزیگوت هماهنگ با نتایج حاصله از مطالعه شانموگاپریا و همکاران (2013) (27) می باشد.

مجتهدی و همکاران (2013) ارتباط میان چندشکلی کدون 655 ژن her2 را در بیماران مبتلا به سرطان تخمدان در استان شیراز بررسی و گزارش نمودند که این چندشکلی با ریسک سرطان تخمدان در زنان ایرانی مرتبط نیست (15). که در فراوانی ژنوتیپهای هموزیگوت برای گروه بیمار و کنترل اختلاف معنی­داری وجود نداشت فراوانی ژنوتیپهای AA در گروه بیمار 5/75 درصد و فراوانی در گروه کنترل6/76 درصد و فراوانی ژنوتیپ GG در گروه بیمار یک درصد گروه کنترل 4/2 درصد بود در حالی که در مقایسه آماری گروههای مورد مطالعه در این بررسی بین فراوانی ژنوتیپهای هموزیگوت برای دو گروه بیمار و کنترل اختلاف معنی­دار بود همچنین ژنوتیپهای AA در گروه بیمار 6349/0 و در گروه کنترل 417/0 و فراوانی ژنوتیپهای GG در گروه بیمار 217/0 و در گروه کنترل 1667/0 بود که با نتایج حاصل از مطالعه مجتهدی و همکاران (2013) (15) متناسب نیست البته لازم به ذکر است که عوامل متعددی از قبیل اندازه جامعه آماری، نژاد، قومیت و زمینه ژنتیکی می تواند در تفاوت داده­های به دست آمده مؤثر باشد. مطالعات بیشتری لازم است تا اهمیت اختلاف آللهای آلل این جایگاه در بافت سرطان تخمدان مشخص شود.

1- متولی باشی م.، کوه کن ف. و حجتی ز. (1392). نقش سلولهای بنیادی سرطانی در افزایش ریسک ابتلاء به متاستاز و کاهش میزان بقای افراد مبتلا به سرطان پستان مجله پژوهشهای سلولی و مولکولی. 26 (3). 365- 377.

2- محمدگنجی ش.،  مهبودی ص. و رستگار جزی ف. (1394). مطالعه مولکولی متیلاسیون پروموتر ژن های p14, p15 و p16 در بیماران ایرانی مبتلا به سرطان بافت سنگفرشی مری. مجله پژوهش‌های سلولی و مولکولی. 28 (3) 403-412.

 

3- Akiyama, T, C. Sudo, H. Ogawara H, K. Toyoshima and T. Yamamoto (1986) The product of the human c-erbB-2 gene: a 185-kilodalton glycoprotein with tyrosine kinase activity. Science 232:1644-1646.

4- Berchuck, A., J.M. Schildkraut, J.R. Marks and P.A. Futreal. (1999). Managing hereditary ovarian cancer risk. Cancer 86, 2517–2524.

5- Berek, S.J. (2002) Novaks Gynecology. 2:1065-1129.

6- Camilleri-Broët, S., AC. Hardy-Bessard, A. Le Tourneau, D. Paraiso, O. Levrel, B. Leduc, S. Bain, H. Orfeuvre, J. Audouin, E.  Pujade-Lauraine  and  GINECO group.(2004) HER-2 overexpression is an independent marker of poor prognosis of advanced primary ovarian carcinoma:a multicenter study of the GINECO group. Ann Oncol. 15: 104-112.

7- Demir, L, S. Yigit, C. Sadullahoglu, M. Akyol, S. Cokmert, Y. Kucukzeybek, A. Alacacioglu, F. Cakalagaoglu, MO.Tarhan MO. (2014) Hormone receptor, HER2/NEU and EGFR expression in ovarian carcinoma—is here a prognostic phenotype?Asian Pac J Cancer Prev.15:9739-9745. 

8- Ferretti G, A. Felici, P. Papaldo, A. Fabi and F. Cognetti F. (2007) HER2/neu role in breast cancer: from a prognostic foe to a predictive friend. Curr Opin Obstet Gynecol.19:56-62.

9- Gadducci, A., S. Cosio, A. Gargini and  AR. Genazzani  )2004(. Sex-steroid hormones, gonadotropin and ovarian carcinogenesis: a review of epidemiological and experimental data. Gynecol Endocrinol 19: 216–228.

10- Hishida, A., N. Hamajima, H. Iwata,   K. Matsuo, K.H. Nobuhiko and EK. Tajima. (2002) Re: population based, case–control study of HER2 genetic polymorphism and breast cancer risk. J Natl Cancer Inst. 94: 1807-1808.

11- Kharrati Koopaei, H, MR. Mohammad Abadi, S. Ansari Mahyari, AR Tarang, P. Potki and AK Esmailizadeh. (2012). Effect of DGAT1 variants on milk composition traits in Iranian Holstein cattle population. Animal Science Papers and Reports 30: 231-240. 

12- Kharrati Koopaei, H, MR. Mohammadabadi, S. Ansari Mehyari, AK. Esmailizadeh, A Tarang and M. Nikbakhti (2011). Genetic Variation of DGAT1 Gene and its Association with Milk Production in Iranian Holstein Cattle Breed Population. Iranian Journal of Animal Science Research 3: 185-192 .

13- Lefkowitz, E.S. and  C.F. Garland. (1994). Sunlight, vitamin D, and ovarian cancer mortality rates in US  women. Int. J. Epidemiol. 23: 1133–1136.

14- Lichtenstein, P., N.V. Holm,  P.K. Verkasalo, A. Iliadou, J. Kaprio,  M. Koskenvuo, E. Pukkala, A. Skytthe and Hemminki, K. (2000). Environmental and heritable factors in the causation of cancer – analyses of cohorts of twins from Sweden, Denmark, and Finland. N. Engl. J. Med. 343: 78–85.

15- Mojtahedi, Z, N. ErfaniMalekzadeh M, MR. Haghshenas, A. Ghaderi and A. Samsami Dehaghani. (2013). HER2 Ile655Val single nucleotide polymorphism in patients with ovarian cancer. Iranian Red Cres. Med. J. 15(1):1.

16- Ness, R.B., (2003). Endometriosis and ovarian cancer: thoughts on shared pathophysiology. Am. J. Obstet. Gynecol. 189: 280–294.

17- Otsu H, E. Oki, A. Ikawa-Yoshida, H. Kawano, K. Ando, S. Ida, Y. Kimura, S. Aishima, H. Saeki, M. Morita, S. Kohnoe, Y. Oda and Y Maehara (2015) Correlation of HER2 expression with clinic-pathological characteristics and prognosis in resectable gastric cancer. Anticancer Res. 35: 2441-2446.

18- Parazzini, F, S. Franceschi, C. La Vecchia and M. Fasoli. (1991) The epidemiology of ovarian cancer. Gynecol Oncol 43:9 –23.

19- Parsons, R. (2004) Human cancer, PTEN and the PI-3 kinase pathway. Semin Cell Dev Biol 15: 171-176.

20- Pils, D, A. Pinter, J. Reibenwein, A. Alfanz, P. Horak, BC. Schmid, L. Hefler, R. Horvat, A. Reinthaller, R.  Zeillinger and M. Krainer. (2007) In ovarian cancer the prognostic influence of HER2/neu is not dependent on the CXCR4/SDF-1 signalling pathway. Br J Cance. 96:485-491.

21- Pinto D., D. Pereira, C. Portela, JL. da Silva, C. Lopes and R. Medeiros. (2005) The influence of HER2 genotypes as molecular markers in ovarian cancer outcome. Biochem Biophys Res Commun. 335:1173–8.

22- Puputti, M., H. Sihto, J. Isola,R. Butzow, H. Joensuu and NN. Nupponen. (2006). Allelic imbalance of HER2 variant in sporadic breast and ovarian cancer. Cancer genetics and cytogenetics 167(1): 32-38.

23- Rasmussen, HB. (2012) Restriction Fragment Length Polymorphism Analysis of PCR-Amplified Fragments (PCR-RFLP) and Gel Electrophoresis – Valuable tool for Genotyping and Genetic Fingerprinting. Institute of Biological Psychiatry, Mental Health Centre Sct. Hans, Copenhagen University Hospitals, Roskilde, Denmark. www.intechopen.com.

24- Saiki, RK, S. Schaff, F. Faloona, KB. Mullis, HA. Erlich and N. Arnhem. (1985) Enzymatic amplification of beta-globin genomic sequences and restriction site analysis for diagnosis of sickle cell anemia. Sci; 230 (4732): 1350-1354.

25- Samuels, Y., Z. Wang, A. Bardelli, N. Silliman, J. Ptak, S. Szabo, H. Yan, A. Gazdar, SM. Powell and GJ. Riggins (2004). High frequency of mutations of the PIK3CA gene in human cancers. Science 304: 554.

26- Seidman, JD., P. Russell and RJ. Kurman. (2002). Surface epithelial tumors of the ovary. In: Kurman RJ, editor. Blaustein's Pathology of the Female Genital Tract. 5th ed. New York: Springer Verlag; pp. 791–904.

27- Shanmughapriya, S., G. Senthilkumar, ArunVinodhini K., S. Sudhakar and K. Natarajaseenivasan (2013). Polymorphism and overexpression of HER2/neu among ovarian carcinoma women from Tiruchirapalli, Tamil Nadu, India." Archives of gynecology and obstetrics 288(6):1385-1390.

28- Teplinsky, E and F. Muggia. (2014) Targeting HER2 in ovarian and uterine cancers: challenges and future directions. Gynecol Oncol.135:364-370.

29- Tingulstad, S., FE. Skjeldestad, TB. Halvorsen and B. Hagen (2003) Survival and prognostic factors in patients with ovarian cancer. Obstet Gynecol 101:885–891.

30- Tuefferd, M, J. Couturier, F. Penault-Llorca, A. Vincent-Salomon, P. Broët, JP. Guastalla, D. Allouache, M. Combe, B. Weber, E. Pujade-Lauraine and S. Camilleri-Broët. (2007) HER2 status in ovarian carcinomas: a multicenter gineco study of 320 patients. PLoS One; 2:1138.

31- Vajed Ebrahimi, MT, MR. Mohammad Abadi and AK. Esmailizadeh (2017). Using microsatellite markers to analyze genetic divesity in 14 sheep types in Iran. Archiv fuer Tierzucht (Arch. Anim. Breed) 60: 183-189. 

32- Vanhaesebroeck, B. and MD. Waterfield. (1999). Signaling by distinct classes of phosphoinositide 3-kinases. Exp Cell Res 253: 239-254.

33- Vivanco I. and CL. Sawyers. (2002). The phosphatidylinositol 3-kinase AKT pathway in human cancer. Nat Rev Cancer 2: 489-501.

34- Wang Y, D. Wang and M. Ren. (2014) Prognostic value of HER-2/neu expression in epithelial ovarian cancer: a meta-analysis. Tumour Biol.35:33-38. Doi: 10/1007/s13277-013-1003-9. 

35- Watrowskil, R., DC. Castillo-Tong, E. Schuster, MB Fischer, P. Speiser and R Zeillinger. (2016). Association of HER2 codon 655 polymorphism with ovarian cancer." Tumor Biology 37(6): 7239-7244. 

36- Whittemore, A.S., R. Harris, and J. Itnyre. (1992). Characteristics relating to ovaria cancer risk: collaborative analysis of 12 US case–control studies. II. Invasive epithelial ovarian cancers in white women. Collaborative Ovarian Cancer Group. Am. J. Epidemiol. 136: 1184–1203.

37- Wu S., CC. Ma and Y. Yang. (2014) The prognostic value of HER-2/neu overexpression in colorectal cancer: evidence from 16 studies. Tumour Biol.35:10799-10804. 

38- Zamani,  P, M. Akhondi and MR Mohammadabadi (2015). Associations of Inter-Simple Sequence Repeat loci with predicted breeding values of body weight in sheep. Small Ruminant Research 132: 123-127.

39- Zawacka-Pankau J., J. Nakonieczna and M. Grinholc  (2011) Nucleic acid techniques in molecular diagnosis of human diseases and pathogens. Intercollegiate Faculty of Biotechnology UG&MUG 2011.