نوع مقاله: مقاله پژوهشی

نویسندگان

1 دانشجوی دکتری دانشگاه تبریز

2 هیأت علمی- دانشگاه تبریز

3 هیات علمی دانشگاه تبریز

چکیده

آگروباکتریوم ریزو‍‍ژنز(Agrobacterium rhizogenes) باکتری گرم منفی خاکزی است که در گیاهان موجب القای ریشه های موئین می گردد. وجود DNA انتقالی (transferred DNA or T-DNA) در پلاسمید القاگر ریشه root-inducing plasmid)) باکتری-که حامل ژن های لوکوس ریشه (root locus or rol) rolA، rolB و rolC می باشد- مسئول انتقال مواد ژنتیکی باکتری به درون ژنوم گیاه میزبان است. در این پژوهش تأثیر ژن rolC باکتریایی و هومولوگ گیاهی آن، trolC، بر ویژگی های رشدی گیاهچه های تراژن توتون (Nicotiana tabacum) در شرایط کشت in vitro و در قالب یک طرح کاملاً تصادفی با 3 تکرار مورد بررسی قرار گرفت. ژن های rolC و trolC در این گیاهان تحت کنترل پروموتر القایی با گلوکوکورتیکوئید دگزامتازون بودند که به منظور بیان آنها از غلظتهای مختلف دگزامتازون (10،3،1،0و Mµ30) استفاده شد. نتایج آماری نشان دادند که استعمال حتی مقادیر بسیار اندک از دگزامتازون (Mµ1) موجب بیان ژن های مذکور شده و اثر معنی داری بر اغلب ویژگی های رشدی گیاهچه های تراژن داشت. به لحاظ ویژگی های فنوتیپی ظاهر ریشه در گیاهچه های تراژن پیچ خورده و برگ ها نیز در مقایسه با گیاهچه های شاهد کلروزه و کوچکتر بودند. از آنجایی که این ویژگی ها در هر دو گروه از گیاهچه های تراژن rolC و trolC مشاهده شد؛ می توان نتیجه گیری نمود که ژن rolC باکتریایی پس از انتقال افقی به گیاه مذکور در طول زمان و تکامل گیاه توانسته است ویژگیهای عملکردی خود را حفظ نماید.

کلیدواژه‌ها

موضوعات

عنوان مقاله [English]

Investigation of the effect of rolC and trolC genes on germination and growth parameters of transgenic tobacco (Nicotiana tabacum) seedlings

نویسندگان [English]

  • gita amini 1
  • elham mohajjel kazemi 3
  • rohollah motafakker azad 3

1 PhD student of University of Tabriz

3 assistant proffessor

چکیده [English]

Agrobacterium rhizogenes is a soil-borne, gram negative bacterium which induces hariy root disease in plants. A DNA sequence in the bacterial plasmid called T-DNA (transferred DNA) is transferred in to the plant genome upon infection. T-DNA carries the rooting-locus (rol) genes: rolA, rolB and rolC. Somme plants also contain, naturally, the homologues of rol genes. In this study, the effects of bacterial rolC gene and its homologous in tobacco, trolC, was evaluated in transgenic plants in a completely randomized design experiment with 3 replications. The expression of rolC and trolC genes in transgenic tobacco seedlings was under the control of dexamethasone inducible promoter. Different concentrations of dexamethasone (0, 1, 3, 10 and 30 µM) were used in order to induce the expression of transgenes. Our results showed that the presence of only very low quantity of dexamethasone (1µM) in the culture medium induces the expression of genes and affect significantly the growth of seedlings. Phenotypically, the length of seedlings was shorter in both transgenic plants than control and the roots of transgenic seedlings were twisted and the leaves were smaller and pale green. Since these characteristics are present in both transgenic seedlings, we can conclude that the bacterial rolC gene has preserved its ancestral function after insertion into the plant genome during evolution.

کلیدواژه‌ها [English]

  • Agrobacterium
  • rolC/trolC genes
  • T-DNA
  • N. tabacum

بررسی تأثیر ژنهای rolC و trolC برجوانه زنی و رشد گیاهچه های تراژن توتون

(Nicotiana tabacum)

گیتا امینی، هانیه محجل شجا*، الهام محجل کاظمی و روح اله متفکر آزاد

ایران، تبریز، دانشگاه تبریز، دانشکده علوم طبیعی، گروه علوم گیاهی

تاریخ دریافت: 14/7/96                تاریخ پذیرش: 12/10/96

چکیده

آگروباکتریوم ریزو‍‍ژنز(Agrobacterium rhizogenes)  باکتری گرم منفی خاکزی است که در گیاهان موجب القای ریشه های موئین می گردد. وجود DNA انتقالی (transferred DNA or T-DNA) در پلاسمید القاگر ریشه root-inducing plasmid)) باکتری-که حامل ژنهای لوکوس ریشه (root locus or rol) rolA، rolB و rolCمی باشد-  مسئول انتقال مواد ژنتیکی باکتری به درون ژنوم گیاه میزبان است. در این پژوهش تأثیر ژن rolC باکتریایی و همولوگ گیاهی آن، trolC، بر ویژگیهای رشدی گیاهچه های تراژن توتون (Nicotiana tabacum) در شرایط کشت in vitro و در قالب یک طرح کاملاً تصادفی با 3 تکرار مورد بررسی قرار گرفت. ژنهای rolC و trolC  در این گیاهان تحت کنترل پروموتر القایی با گلوکوکورتیکوئید دگزامتازون بودند که به منظور بیان آنها از غلظتهای مختلف دگزامتازون (10،3،1،0و Mµ30) استفاده شد. نتایج آماری نشان دادند که استعمال حتی مقادیر بسیار اندک از دگزامتازون (Mµ1) موجب بیان ژنهای مذکور شده و اثر معنی داری بر اغلب ویژگیهای رشدی گیاهچه های تراژن داشت. به لحاظ ویژگیهای فنوتیپی ظاهر ریشه در گیاهچه های تراژن پیچ خورده و برگها نیز در مقایسه با گیاهچه های شاهد کلروزه و کوچکتر بودند. از آنجایی که این ویژگیها در هر دو گروه از گیاهچه های تراژن rolC و trolC  مشاهده شد؛ می توان نتیجه گیری نمود که ژن rolC باکتریایی پس از انتقال افقی به گیاه مذکور در طول زمان و تکامل گیاه توانسته است ویژگیهای عملکردی خود را حفظ نماید.

واژه های کلیدی: اگروباکتریوم، ژنهای rolC و trolC، T-DNA، N. tobaccum

* نویسنده مسئول، تلفن: 04133379762 ، پست الکترونیکی: h_mohajjel@tabrizu.ac.ir

مقدمه

 

گیاه توتون (Nicotiana tabacum) که به خانواده Solanaceae تعلق دارد یکی از مهم ترین محصولات زراعی است که به طور گسترده ای در سطح جهان کشت شده (23) و به عنوان یکی از گیاهان مدل در زیست شناسی محسوب می شود (25). سهولت ترانسفورماسیون این گیاه توسط آگروباکتریوم و در دسترس بودن مقدار زیادی از توالی ژنوم آن یکی از دلایل انجام پژوهشهای مولکولی بر روی این گیاه می باشد (31).
Agrobacterium rhizogenes باکتری گرم منفی خاکزی است که از طریق زخمها قادر به آلوده کردن گیاهان می‍باشد. این باکتری به علت وجود پلاسمید القاگر ریشه یا
 (root inducing plasmid) pRiموجب القای بیماری ریشه های موئین در محل آلودگی می گردد (2، 31). در زمان آلودگی بخشی از pRi موسوم به T-DNA، به درون سلول گیاهی انتقال یافته و در ژنوم گیاه ادغام می شود و ژنهای مستقر بر آن در گیاه میزبان بیان می شوند. 3 لوکوس ژنی در T-DNA شناسایی شده است که در ایجاد ریشه های موئین دخالت دارند و لوکوسهای ریشه ای (rol) A، B و C نامیده می شوند (32). ژن rolC در تمام سویه های
A. rhizogenes مورد مطالعه وجود دارد و حفاظت شده ترین ژن rol می باشد (10). بیان این ژن درگیاهان موجب تغییرات بیوشیمیایی و مورفولوژیکی اساسی می شود (24). اثرات مورفولوژیکی ژن rolCدر گیاهان تراژن در مقایسه با گیاهان شاهد شامل میانگره های کاهش یافته، غالبیت رأسی کاهش یافته، برگهای نیزه ای با رنگ پریده و چروک خورده در حاشیه، گلهای کوچک، تغییر در فنوتیپ ریشه مانند افزایش انشعاب و تغییر در ژئوتروپیسم ریشه ای، باروری کاهش یافته گرده و گذر زودهنگام به فاز گلدهی می باشد (22 و 25). در گیاهان تراژن rolC به علت کاهش میزان کلروفیل، فتوسنتز کمتری انجام می گیرد و در مقایسه با انواع گیاهان طبیعی برگها به رنگ سبز متمایل به زرد یا کلروزه نمایان می­شوند (27). در بعضی از گونه های گیاهی همچون گونه های جنس Nicotiana، هویج (Daucus carota)، سیب (Malus domestica) و گل میمون (Linaria vulgaris) توالیهایی از DNA یافت شده است که بسیار شبیه به ژنهای موجود در T-DNA پلاسمید Ri می باشند و DNA  T- سلولی (cellular T-DNA) نامیده می شوند (20 و 21). تصور بر این است که این همولوگهای گیاهی در نتیجه انتقال افقی ژنها بین گیاهان و یک نیایA. rhizogenes  حاصل شده اند (14 و 21). توالی مشابه با ژن rolC در گیاه توتون، trolC نامیده می شود ‌(2) که از نظر برخی خصوصیات مورفولوژیکی تغییرات مشابه با ژن rolC را در گیاهان تراژن ایجاد می کند (20). این پژوهش در صدد است پارامترهای فیزیولوژیک و رشدی گیاهان تراژن توتون با ژنهای rolC و trolCرا مورد مطالعه قرار دهد. در این گیاهان، ژنهای مذکور تحت کنترل یک پروموتر القایی قرار گرفته اند که در حضور گلوکوکورتیکوئید دگزامتازون، پروموتر مورد رونویسی قرار گرفته و ژنها بیان می شوند. طبق بررسیهای به عمل آمده دگزامتازون به عنوان ماده ای بی تأثیر در رشد گیاهان محسوب می شود که کاربرد آن منجر به تغییرات فنوتیپی در گیاهان نمی گردد (20). لذا مشاهده هرگونه تغییری در گیاهان تراژن در واقع به دلیل بیان تراژنها در گیاه و نه به خاطر کاربرد دگزامتازون در محیط رشدی گیاه می باشد.  نتایج به دست آمده از پژوهش حاضر می تواند پاسخی به این سوال باشد که آیا همولوگهای گیاهی ژنهای آگروباکتریوم توانسته اند، بعد از انتقال افقی خود به گیاه میزبان، در طول زمان نقش عملکردی خود را همانند ژنهای باکتریایی حفظ نمایند یا خیر؟

مواد و روشها

به منظور بررسی جوانه زنی و رشد گیاهچه های توتون آزمایشی در سال 1395 در دانشکده علوم طبیعی دانشگاه تبریز و در شرایط کشت in vitro اجرا گردید. طرح آزمایشی به کار رفته به صورت کاملاً تصادفی با 3 تکرار بود. بذر گیاهچه های توتون مورد استفاده در این تحقیق که با ژنهای rolCو trolCترانسفورم شده بودند، در مؤسسه بیولوژی مولکولی گیاهی شهر استراسبورگ کشور فرانسه توسط خانم دکتر هانیه محجل شجا (نویسنده مسئول مقاله) در سال 2010 تولید شدند. در این گیاهان ژنهای مذکور تحت کنترل پروموتر القایی با گلوکورتیکوئید دگزامتازون بوده و تنها در حضور این ماده بیان این ژنها صورت می گرفت. غلظتهای استفاده شده دگزامتازون 0، 1، 3، 10 و 30 میکرومولار در محیط کشت بود. 50 عدد بذر استریل در 20 میلی لیترمحیط پایه جامد MS کشت داده شدند. استریلیزاسیون بذرها به این صورت بود که  به مدّت 2 دقیقه در اتانول 70 درصد و به مدّت 15 دقیقه در هیپوکلریت سدیم 10 درصد قرار گرفتند. سپس 3 مرتبه و هر بار به مدّت 10 دقیقه با آب مقطر استریل شستشو داده شدند و پس از خشک شدن بر روی کاغذ صافی به محیط کشت انتقال داده شدند. پتری دیشها در دمای 23 درجه سانتی گراد در شرایط 16 ساعت روشنایی و 8 ساعت تاریکی  قرار داده شدند. پس از طی سه هفته از اجرای آزمایش پارامترهای کمی رشد نظیر طول ریشه چه و طول اندام هوایی، وزن تر و خشک، درصد جوانه زنی و سرعت جوانه زنی اندازه گیری و صفات مورفولوژیک همچون نحوه رشد ظاهری ریشه در هر دو گروه از گیاهچه ها با هم مقایسه گردید. داده های حاصل با استفاده از نرم افزار Spss مورد تجزیه و تحلیل قرار گرفتند و مقایسه میانگینها با استفاده از آزمون دانکن در سطح احتمال 5 درصد صورت پذیرفت و برای رسم نمودارها نیز از نرم افزار Excel استفاده شد.

نحوه محاسبه صفات  به شرح زیر می باشد:

معادله (1):GP = ( ) × 100

در این فرمول GP درصد جوانه زنی و Ni تعداد بذور جوانه زده در زمان شمارش  i ام و S تعداد کل بذور کشت شده می باشد (5).

معادله (2):  GR=

در این فرمول GR سرعت جوانه زنی نسبی (بر حسب تعداد بذر جوانه زده در روز)x1 تعداد درصد بذرهای جوانه زده در شمارش اول و Xn درصد بذور جوانه زده در زمان شمارشn  ام، Y1نعداد روز از ابتدای کاشت تا شمارش اول و Yn تعداد روز از ابتدای کشت تا زمان شمارش  nام است (17).

آزمایشات مولکولی:به منظور حصول اطمینان از بیان ژنهای rolC  و trolC(به ترتیب با شماره دسترسی FN667970 و FN667969) درگیاهچه های مورد پژوهش،  RNA کل از برگ گیاهچه­ها با استفاده از بافر تریزول استخراج شد و سپس به منظور حذف مولکولهای DNA ازRNA  استخراج شده، واکنش DNase توسّط کیت Qiagen انجام گرفت (1). پس از بررسی کمّی RNA با استفاده از دستگاه اسپکتروفتومتر، سنتز cDNA به وسیله کیت Superscript III (ساخت شرکت (Invitrogene انجام گرفت و در نهایت واکنش RT-PCR  با پرایمر ژنهای rolC و trolC و ژن خانه دار rRNA16s انجام گرفت و نتیجه بر روی ژل آگارز 1 درصد مورد بررسی قرار گرفت.

توالی پرایمرها:

rolCF: 5'ATGGCTGAAGACGACCTGTG3'

trolCF: 5'ATGGCTGAAGATAACCTATGTG3'

rolCR: 5'TTAGCCGATTGCAAACTTGC3'

trolCR: 5'CATGCCTGCAAACTTGCACT3'

rRNA16sF:5'GGAGCGGTGAAATGCGTAGAG3'

rRNA16sR: 5'TACGGCTACCTTGTTACGAC3'

نتایج

صفات مورفولوژیک و بیان تراژنها: برای حصول اطمینان از تراژن بودن بذرها و بیان ژنهای rolC و trolC در گیاهچه های تراژن، کشت بذرها در شرایط in vitro در تیمار های صفر و 3 میکرومولار دگزامتازون صورت گرفت و 10 روز بعد از کشت، RNA از برگ گیاهچه ها استخراج شده و پس از سنتز cDNA واکنش RT-PCR با پرایمر ژنهای rolC و trolC و ژن خانه دار rRNA16s انجام گرفت و نتیجه بر روی ژل آگارز 1 درصد مورد بررسی قرار گرفت (شکل 1).

 

 

شکل1- RT-PCR توسط پرایمرهای اختصاصی ژنهای rolC و trolC. لاینهای 1و 2 بیان ژنها را در گیاهچه های تراژن در تیمار با دگزامتازون  Mμ3 و لاینهای 3و 4 در شرایط کنترل یعنی دگزامتازون Mμ0 نمایش می دهد. تصویر ژل پایین مربوط به بیان ژن خانه دار rRNA16s می باشد.

همان گونه که در شکل مشخص است ژنهای مذکور در حضور دگزامتازون بیان شده (لاینهای 1 و 2) و  در صورت عدم حضور این ماده در محیط کشت بیان ژنها صورت نمی گیرد. بذر های کاشته شده در محیط کشت کنترل (μM0dex =) و یا حاوی غلظتهای فزاینده دگزامتازون  (μM30 ،10 ،3 ،1dex =) 10 روز پس از کشت شروع به جوانه زنی نمودند و در حدود 3 هفته پس از جوانه زنی در گیاهچه های تحت تیمار با دگزامتازون علائمی همچون کاهش اندازه طولی گیاهچه ها، کاهش اندازه برگها و نیز کلروزه شدن گیاهچه ها مشاهده شد. علاوه بر کاهش طول اندام هوایی، ریشه گیاهچه های تراژن نیز نسبت به گیاهچه های کنترل کوتاه تر بوده و ظاهری پیچ خورده و مقدار کمتری تار کشنده داشتند. گیاهچه های کنترل سبز رنگ باقی مانده، برگهایشان به تناسب بزرگتر و طول گیاهچه ها بیشتر از گیاهچه های بیان کننده تراژنها بودند (شکل2).

 

trolC

dex 0µM

trolC

dex 1µM

 

trolC

dex 3µM

 

trolC

dex 10µM

 

trolC

dex 30µM

 

rolC

dex 0µM

 

rolC

dex 1µM

 

rolC

dex 3µM

 

rolC

dex 10µM

 

rolC

dex 30µM

 

شکل 2- تغییرات رشدی در گیاهچه­های تراژن  trolC و rolCتحت تیمار با غلظتهای فزاینده دگزامتازون (dex) در مقایسه با گیاهان شاهد (dex=0μM).


پارامترهای فیزیولوژیک: نتایج حاصل از تجزیه واریانس داده ها نشان داد که اثر تیمار دگزامتازون بر صفات طول ریشه چه، طول اندام هوایی،‌ وزن تر و وزن خشک در سطح احتمال 1 درصد معنی دار، اما بر درصد و سرعت جوانه زنی تأثیر معنی داری نداشت (جدول1). نتایج مقایسه میانگینها در مورد تأثیر بیان ژنهای rolC و trolC بر صفات مرتبط با جوانه زنی و پارامترهای فیزیولوژیک نشان داد که درصد و سرعت جوانه زنی در ژنوتیپ rolC در تمام سطوح دگزامتازون نسبت به ژنوتیپ trolC اندکی بیشتر بود اما این اختلاف معنی دار نبود. (نمودار a,b1). همچنین حضور غلظتهای فزاینده دگزامتازون در محیط کشت تفاوت چندانی در پارامترهای درصد و سرعت جوانه زنی در هیچ کدام از ژنوتیپها در مقایسه با شرایط کنترل ایجاد نکرد. از این نتیجه می توان استنباط نمود که بیان ژنهای rolC و trolC تأثیری در مرحله جوانه زنی گیاه ندارد و احتمالاً مراحل رشد بعدی آن را تحت الشعاع قرار می دهد. به منظور بررسی تأثیر ژنهای مذکور بر پارامترهای فیزیولوژیک، رشد بذرها در محیط کشت تا حدود سه هفته بعد از کشت ادامه یافت و سپس اقدام به اندازه گیری طول ریشه چه و اندام هوایی و سنجش وزن تر و خشک شد. نتایج مقایسه میانگینها نشان داد که بیشترین مقدار طول اندام هوایی در گیاهچه های rolC و trolC مربوط به شرایط شاهد بوده و در گیاهچه های تحت تیمار با دگزامتازون طول اندام هوایی کاهش یافته است؛ ولی این کاهش طول تابع غلظتهای فزاینده دگزامتازون نبود. به عبارت دیگر در تمام غلظتهای مورد مطالعه دگزامتازون، کاهش طول اندام هوایی برای تمام گیاهچه ها تقریباً به یک میزان بود (نمودار c1).

 

جدول 1- تجزیه واریانس تأثیر سطوح مختلف تیمار بر صفات مورد مطالعه گیاهچه های توتون

میانگین مربعات

منابع تغییرات درجه آزادی

 

سرعت جوانه زنی

درصد جوانه زنی

وزن خشک

وزن تر

طول اندام هوایی

طول ریشه چه

052/0 ns

233/0ns

333/5   ns

423/3ns

002/0 ns

014/0ns

2

تکرار

009/0  ns

893/10  ns

311/8**

001/0 **

243/0**

211/3   **

9

تیمار

414/0

733/311

533/1

516/3

002/0

047/0

 

خطای آزمایش

ns و ** به ترتیب بیانگر عدم معنی دار و  معنی دار بودن اختلاف در سطح 1 درصد می باشند.

 

b

a

نمودار1- مقایسه میانگین درصد جوانه زنی (a)، سرعت جوانه زنی (b)، طول اندام هوایی (c)، طول ریشه چه (d)، وزن تر(e) و وزن خشک (f) در گیاهان تراریخت توتون بر اساس آزمون دانکن در سطح احتمال 5  درصد


در مورد صفت طول ریشه چه نیز - مشابه با صفت طول اندام هوایی - ریشه گیاهچه های شاهد در مقایسه با گیاهان تحت تیمار بیشترین اندازه را دارا بودند و ریشه گیاهچه های تحت تیمار با غلظتهای مختلف دگزامتازون کوتاه تر از گیاهچه های شاهد و از نظر اندازه با یکدیگر تفاوت چندانی  نداشتند (نمودارd 1). نتایج به دست آمده برای صفات وزن تر و خشک نیز با پارامترهای طول ریشه چه و اندام هوایی همخوانی داشت. یعنی در شرایط شاهد بیشترین وزن تر و خشک مشاهده شد و در شرایط تیمار با دگزامتازون، وزن تر و خشک گیاهچه ها تقریباً تا یک دوم کاهش یافت. همچنین افزایش غلظتهای دگزامتازون در محیط کشت تفاوتی در پارامترهای مذکور در هیچ کدام از ژنوتیپها ایجاد نکرد (نمودار e,f1). تأثیر یکسان غلظتهای فزاینده القاگر در محیط کشت مؤید این مطلب است که زمانی که شروع بیان تراژنها صورت می گیرد تأثیرات خود را بر ویژگیهای مورفولوژیک و فیزیولوژیک گیاهچه ها گذاشته و افزودن بیشتر القاگر در محیط منجر به تظاهرات فنوتیپی بیشتر نخواهد شد.

بحث و نتیجه گیری

Nicotiana tabacum به عنوان یک گیاه مدل بسیار مناسب در مطالعه عوامل تأثیرگذار بر ترانسفورماسیون ژنتیکی محسوب می شود که استعداد بالایی در جذب ژنهای خارجی به روشهای گوناگون ترانسفورماسیون را دارا می‍باشد (7). Agrobacterium rhizogenes نیز به عنوان یکی از مهم ترین جنسهای باکتریایی تلقی می گردد که به دلیل ویژگی منحصر به فرد آن در انتقال طبیعی بخشی از ژنوم خود به داخل ژنوم گیاهان آسیب دیده و زخمی کاربرد وسیعی در انتقال ژن به گیاهان و حتی فراتر از آن به سلولهای جانوری ایفاء می کند (17). حضور برخی از توالیهای ژنوم این باکتری در اعضای مختلفی از خانواده های گیاهی همچون خانواده Solanaceae، Crassulaceae و Asteraceace به اثبات رسیده است که می تواند نشانه ای از انتقال افقی باستانی این ژنها بین اجداد باکتری و گیاهان مذکور باشد (9).  تا کنون مطالعات بسیاری در مورد علل وجود این توالیهای باکتریایی در ژنوم گیاهان و امکان فعالیت آنها – به عبارت ساده تر امکان رونویسی و تولید پروتینهای فعال از این توالیها- در گیاهان صورت گرفته که در تعدادی از آنها وجود جهشهای متعدد در این توالیها بعد از ورود به ژنوم گیاه به اثبات رسیده (4)؛ اما تعدادی نیز از سالم ماندن توالی و فعال بودن پروتئین کد شده از آن حکایت دارند (30). توالیهای همولوگ ژنهای rolآگروباکتریوم ریزوژنز در ژنوم گیاهان
Nicotiana glauca و Nicotiana tabacum نیز حضور دارند که به ترتیب ژنهای Ngrol (NgrolB، NgrolC، NgORF13 و NgORF14) و trol (trolC، torf 13 -1و torf 13 -2)  نامیده می شوند (3؛ 13؛ 14؛ 19). اخیرا طبق مطالعات صورت گرفته مشخص گردیده که توالی ژن trolC در ژنوم گیاهان توتون مشابه با همولوگ باکتریایی آن یعنی ژن rolC بوده و در آن جهشی صورت نپذیرفته است (22). بنابراین بررسی عملکرد آن از دیدگاههای گوناگون مورفولوژیکی، فیزیولوژیکی، تکوینی، بیوشیمیایی و مولکولی مورد علاقه پژوهشگران قرار گرفته و در پژوهش فعلی نیز به منظور مقایسه عملکرد ژن باکتریایی rolC با ژن گیاهی trolC، تعدادی از پارامترهای رشدی نظیر طول ریشه چه، طول اندام هوایی، وزن تر، وزن خشک، درصد و سرعت جوانه زنی در دو گروه از گیاهچه های تراژن توتون ( rolC و trolC) مورد سنجش قرار گرفتند. طبق نتایج به دست آمده مشخص شد که در موارد متعدد این ژنها تأثیر مشابهی بر گیاهان گذاشته و باعث کاهش پارامترهای رشدی گیاه می گردند . در این راستا یافته های Gardner و همکاران نشان دادند که بیان ژن rolC موجب کاهش قد گیاه می شود که دلیل این امر به علت کاهش در فاصله میانگره ها است (15). در پژوهشهای صورت گرفته توسط Fladung و Ballvora مشخص شد که گیاهان تراژن سیب زمینی 35S-rolC (ژنrolCتحت کنترل پروموتر قوی 35S ویروس CaMV) غالبیت رأسی کاهش یافته دارند و افزایش تعداد اندام هوایی نابجا، رنگ سبز پریده برگها و سطح کاهش یافته برگ در آنها مشاهده شد (12). ایجاد حالت چروک خورده در برگ گیاهان تراژن توتون نیز با گزارش Casanova و همکاران همخوانی داشت (8). طبق گزارش
Ben-Hayyim، در گیاهچه های توتون تراژن rolA طول اندام هوایی و و وزن ریشه کاهش یافت (6).  Lee و همکاران در پژوهش مربوط به گیاهان برنج تراژن rolA عنوان کردند که ریشه ها تحت تأثیر این ژن حالت پیچ خورده پیدا می کنند (18). نتایج پژوهش محجل شجا و همکاران نشان داد که در گیاهان تراژن rolC وtrolC ، جذب مشابه قند از محیط کشت، تشابه شکل برگ گیاهان تراژن بصورت باریک و نیزه ای شکل و تشابه در زمان گلدهی و تسریع آن در گیاهان تراژن وجود دارد (1 و 22). طبق گزارش پژوهشگران متعدد، بیان ژن rolC تحت کنترل پروموتر طبیعی خود یا یک پروموتر قوی همچون پروموتر35S  CaMV، موجب کاهش میزان کلروفیل در مزوفیل برگ گیاهان تراژن گردیده و به تبع آن موجب کاهش فتوسنتز می شود (12 و 29). در یک جمع بندی کلی از یافته های پژوهش فعلی و اطلاعات به دست آمده از تحقیقات قبلی می توان این چنین نتیجه گیری نمود که همولوگ گیاهی ژن rolC باکتریایی یعنی ژن trolC توانسته است در طول زمان و تکامل گیاه توتون ویژگیهای عملکردی خود را حفظ نماید و مشابه با ژن باکتریایی باعث ایجاد تغییرات مورفولوژیک و فیزیولوژیک در گیاهان تراژن گردد. ادامه مطالعات در سطح بیوشیمیایی، تشریحی- تکوینی و مولکولی گیاهان تراژن می تواند اطلاعات جامع تری در مورد مکانیسم عملکرد این ژنها فرارویمان قرار دهد.

تشکر و قدردانی

بدین وسیله از پژوهشکده بیوتکنولوژی حیان مستقر در دانشکده علوم طبیعی دانشگاه تبریز که انجام قسمتی از این پژوهش توسط امکانات موجود در آنجا میسر گردید، تشکر و قدردانی می گردد.

1- حسین گردونپر، هانیه محجل شجا و محمد علی حسینپور فیضی. 1394. بررسی مولکولی القا کلروز توسط ژنهای rolC و trolC در گیاه توتون. مجله پژوهشهای سلولی مولکولی. شماره 4. صفحه 579-587

2- نسرین ایوبی، بهمن حسینی و محمد فتاحی.1396. اثر القایی کیتوزان و کلشی‌سین بر تولید رزمارینیک اسید در ریشه مویین زرین گیاه ((Dracocephalum kotschyi Boiss. مجله پژوهشهای سلولی مولکولی. شماره 1. صفحه 23-32

 

3- Aoki S., Kawaoka A., Sekine M., Ichikawa T., Fujita T., Shinmyo A., Syono K., (1994). The sequence of cellular T-DNA in   the genome of Nicotiana glauca that is homologous to ORFs 13 and 14 of the Ri plasmid and the analysis of the expression of the cellular genes in genetic tumors of hybrids between N. glauca and N. langsdorffii,Mol. Gen. Genet. 243, 706–710.

4- Aoki, S. and Syono, K. (1999c) Horizontal gene transfer and mutation: Ngrol genes in the genome of  Nicotiana glauca. Proc. Natl. Acad. Sci. U.S.A. 96: 13229–13234.

5- Bajji, M., J. M. Kinet., S. Lutts. (2002). Osmotic and ionic effects of NaCl on germination, early seedling growth, and ion    content of Atriplex halimus (Chenopodiaceae). Canadian Journal of Botany 80, 297-304.

6- Ben-Hayyim, G., Martin-Tanguy, J., Tepfer, D., (1996). Changing root and shoot architecture with the rolA gene from Agrobacterium rhizogenes: Interactions with gibberellie acid and polyamine metabolism. PHYSIOLOGIA PLANTARUM 96: 237-243.

7- Broothaerts, Wim; Mitchell, Heidi J.; Weir, Brian; Kaines, Sarah; Smith, Leon M.A.; Yang, Wei; Mayer, Jorge E. ( 2005); Roa-Rodriguez, Carolina and Jefferson, Richard A. Gene transfer to plants by diverse species of bacteria. Nature, February, vol. 433, p.629-633.

8- Casanova E, Trillas MI, Moysset L & Vainstein A. (2005). Influence of rol genes in floriculture. Biotechnology Advances. 23 (1): 3-39.

9- Christey MC & Braun RH. (2005). Production of hairy root cultures and transgenic plants by Agrobacterium rhizogenes-mediated transformation. Methods in Molecular Biology. 286: 47-60.

10- Dandecar, A.M., De Buck, S., Depicker, A., et al., (2008). Agrobacterium: From Biology to Biotechnology, Tzfira, T. and Citovsky, V., Eds. New York: Springer.

11- Fladung M, Ballvora A (1992). Further characterization of rolC transgenic tetraploid potato clones, and influence of daylength and level of rolC expression on yield parameters. Plant Breed 109:18-27.

12- Fladung, M., Ballvora, A. and Schmülling, T. (1993). Constitutive or light regulated expression of the rolC gene in transgenic potato plants has different effects on yield attributes and tuber carbohydrate composition. Plant Molecular Biology, 23, 749-757.

13- Frundt C., Meyer A.D., Ichikawa T., Meins F., (1998) .A tobacco homologue of the Ri-plasmid orf 13 gene causes cell proliferation in carrot root disks, Mol. Gen. Genet. 259,559–568.

 14- Furner, I. J., Huffman, G. A., Amasino, R. M., Garfinkel, D. J., Gordon, M. P., Nester, E. W., (1986). An Agrobacterium transformation in the evolution of the genus Nicotiana. Nature. 319: 422–427.

15- Gardner, N., Melberg, T., George, M.,  Smith, A. G. (2006). Differential expression of rolC results in unique plant phenotypes. J. AMER. SOC. HORT. SCI. 131(1): 82-88.

16- Joshua PV, Salomi Suneetha DR, Arundhati A & Seshagiri Rao G. (2009). Studies on Presence and Response of Agrobacterium rol genes in three varieties of Nicotiana. Asian Journal of plant science. 8: 54-58.

17- Kunik, T., Tzfira, T., Kapulnik, Y., Gafni, Y., Dingwall, C. and Citovsky, V. (2001). Genetic transformation of HeLa cells by Agrobacterium. Proc. Natl. Acad. Sci. U.S.A. 98: 1871–1876.

18- Lee, S., Blackhall, N. W., Power J. B., Cocking E. C., Tepfer, D. and Davey M. R, (2001). Genetic and morphological transformation of rice with the rolA gene from the Ri TL-DNA of Agrobacterium rhizogenes.Plant Science 161, 917–925.

19- Mahmood, S., Iram, S. & Athar, H. R., (2003). Intra- specific variability in sesame (sesamum indicum) for various quantitive and qualitive attributes under differential salt regimes. Journal of Research (Science), Bahauddin Zakariya University, Multan, Pakistan, 14(2): 177-186.

20-  Matveeva, T.V., Bogomaz, D.I., Pavlova, O.A., et al., Horizontal gene transfer from Agrobacterium to the plant Linaria in nature, MPMI (in press).

  21-  Meyer, A. D., Ichikawa, T., Meins, F., (1995). Horizontal gene transfer: regulated expression of tobacco homologue of the Agrobacterium rhizogenes rolC gene. Mol. Gen. Genet. 249: 265–273.

 22- Mohajjel_Shoja, H., Clement, B., Perot, J., (2011). Biological activity of the Agrobacterium rhizogenes_derived trolC gene of Nicotiana tabacum and its functional relation to other plant genes, MPMI, vol. 24, pp. 44–53.

23-  Moon, H. S. et al. (2009). Microsatellite-based analysis of tobacco (Nicotiana tabacum L.) genetic resources. Crop Science, v. 49, n. 06, p. 2149-2159.

24- Nilsson O., Moritz T., Imbault N., Sandberg G., Olsson O., (1993). Hormonal characterization of transgenic tobacco plants expressing the rolC gene of Agrobacterium rhizogenes TL-DNA. Plant Physiol 102: 363–371.

 25- Oono, Y., Kanaya, K., Uchimiya, H., (1990). Early flowering in transgenic tobacco plants possessing the rolC gene of Agrobacterium rhizogenes Ri plasmid. Jpn. J. Genet. 65: 7– 16.

26- Petit., A., Delhaye, S., Tenipc, J., Morel, G., (1970). Recherches sur les guanidines des tissus de crown gall. Mi.se en evidence d'une relation hiochimique spccifique entre les souches dAgrobatterium tumefaciens el les tumeurs qu'elles induisenl,  Physiol, Veg. 8: 205.

27- Rushton PJ, Bokowiec MT, Han S, Zhang H, Brannock JF, Chen X, et al. (2008). Tobacco transcription factors: novel insights into transcriptional regulation in the Solanaceae. Plant Physiol. 147:280–95.

28- Sierro N, Battey JN, Ouadi S, Bakaher N, Bovet L, Willig A, et al. (2014). The tobacco genome sequence and its comparison with those of tomato and potato. Nat Commun. 5:3833.

29- Spena, A., Schmülling, T., Koncz, C., Schell, J. S., (1987). Independent and synergistic activity of rolA, B and C loci in stimulating  abnormal growth in plants. EMBO J 6:3891–3899.

30- Suzuki, K.; Tanaka, N.; Kamada, H.; Yamashita, I. 2001. Mikimopine synthase (mis) gene on pRi1724. Gene 263:49–58.

31- Tepfer, D., (1984). Transformation of several species of higher plants by Agrobacterium rhizogenes: sexual transmission of the transformed phenotype and genotype. Cell 47:959–967.

32- White, F. F., Taylor, B. H., Huffmann, G. A., Gordon, M. P., Nester, E. W., (1985). Molecular and genetic analysis of the transferred DNA regions of the root inducing plasmid of Agrobacterium rhizogenes. Journal of Bacteriology 164: 33-44.