نوع مقاله: مقاله پژوهشی

نویسندگان

1 پژوهشگاه ملی مهندسی ژنتیک و زیست فناوری

2 هیات علمی پژوهشگاه ملی مهندسی ژنتیک و زیست فناوری

3 هیات علمی پژوهشگاه ملی مهندسی ژنتیک و زیست فناوری

چکیده

امروزه مطالعات نشان داده است که گیاهان، با تولید پپتیدهای ضدقارچی به نام دفنسین ها، سبب ایجاد منافذی درغشاء سلولی قارچ مهاجم و در نتیجه خروج ترکیبات سلولی به بیرون ازغشاء، تغییر در پتانسیل غشاء و نهایتاً مرگ سلولی را منجر می شوند. هدف این تحقیق جداسازی، شناسایی و بررسی ساختار ژن Def1 تربچه خوراکی (Raphanus sativus) با کلون کردن و تعیین توالی آن است. برای این منظور پس از استخراج DNA ژنومی به روش CTAB، تکثیر این ژن با استفاده از آغازگرهای اختصاصی RDeff و RDefr انجام شد. قطعه تکثیر شده به طول تقریبی 356 جفت باز در ناقل pJET1.2 کلون شد. سازه به دست آمده با استفاده ازالگوهای هضم آنزیمی و PCR تأیید شد. همچنین cDNA این ژن، که به طول تقریبی 243 جفت باز بود، پس از استخراج RNA با استفاده ازآغازگرهای اختصاصی فوق سنتز گردید. قطعه تکثیرشده از cDNA پس از تأیید در ناقل pJET1.2 کلون و تعیین توالی گردید. مقایسه توالی DNA ژنومی و cDNA این ژن نشان داد که ژن Def1 گیاه تربچه حاوی یک اینترون به طول 11۳ جفت باز بوده و open reading frame آن یک پپتید به طول 80 اسید آمینه را کد می کند. مقایسه توالی پپتید بدست آمده از ژن Def1 از گیاه تربچه با توالی های ثبت شده مرتبط در بانک ژنی مشابهتی بین 90 تا 8/98 درصد را نشان داد.
شناسایی و همسانه سازی این ژن می تواند در آینده در راستای مدیریت کنترل و مبارزه با بیماری های قارچی مورد استفاده قرار گیرند.

کلیدواژه‌ها

موضوعات

عنوان مقاله [English]

Isolation, identification and study of defensin gene structure (Def1) in Raphanus sativus

نویسندگان [English]

  • Maryam Etebari 1
  • mostafa motallebi 2
  • Mohammad reza Zamani 3
  • Zahra Moghaddassi Jahromi 1

1 National Institute for Genetic Engineering & Biotechnology(NIGEB)

2 National Institute for Genetic Engineering and Biotechnology(NIGEB)

3 International Institute for Genetic Engineering & Biotechnology

چکیده [English]

Different studies have demonstrated that the plants, by producing antifungal peptides, such as defencins, cause the pores in the fungal plasma membrane which leads to efflux and influx of cellular components. These changes ultimately lead to fungal cell death.The purpose of this research was to isolate, identify, and study of defencin gene structure in Raphanus sativus by cloning and sequencing. The genomic DNA extraction from Raphanus sativus was achived by CTAB method. Amplification of this gene was performed using the specific primers (RDeff /RDefr). The amplified DNA fragment (356 bp) was cloned into pJET1.2 cloning vector and the constructs were confirmed via enzyme digestion and PCR patterns. Also, the cDNA of this gene, which was about 243 bp, was synthesized after extraction of RNA by specific primers. The amplified fragment of the cDNA was confirmed, cloned in the pJET1. 2 vector and sequenced. Comparison of genomic DNA and cDNA sequences showed that Def1gene contains one intron (113bp) and its open reading frame encodes a peptide with a length of 80 amino acids. Alignment of the amino acid sequence of Def1 shows 90 to 98.8% homology with other reported defensin sequences.
The identification and cloning of this gene could be used in future for fungal diseases management.

کلیدواژه‌ها [English]

  • Raphanus sativus
  • Defensin
  • Def1 gene
  • gene isolation
  • cloning

جداسازی، شناسایی و بررسی ساختار ژن دفنسین (Def1)

تربچه خوراکی(Raphanus sativus)

مریم اعتباری، مصطفی مطلبی*، محمدرضا زمانی و زهرا مقدسی جهرمی

ایران، تهران، پژوهشگاه ملی مهندسی ژنتیک و زیست فناوری، بخش زیست فناوری گیاهی

تاریخ دریافت: 25/5/96                تاریخ پذیرش: 30/8/96

چکیده

امروزه مطالعات نشان داده است که گیاهان، با تولید پپتیدهای ضدقارچی به نام دفنسینها،  سبب ایجاد منافذی در غشای سلولی قارچ مهاجم و در نتیجه خروج ترکیبات سلولی به بیرون ازغشاء،  تغییر در پتانسیل غشاء و نهایتاً مرگ سلولی را منجر می شوند. هدف  این تحقیق جداسازی، شناسایی و بررسی ساختار ژن Def1 تربچه خوراکی (Raphanus sativus) با کلون کردن و تعیین توالی آن است. برای این منظور پس از استخراج DNA ژنومی به روش CTAB، تکثیر این ژن با استفاده از آغازگرهای اختصاصی RDeff و RDefrانجام شد. قطعه تکثیر شده به طول تقریبی 356 جفت باز در ناقل pJET1.2 کلون شد. سازه به دست آمده با استفاده ازالگوهای هضم آنزیمی و PCR تأیید شد. همچنین cDNA این ژن، که به طول تقریبی 243 جفت باز بود، پس از استخراج RNA با استفاده ازآغازگرهای اختصاصی فوق سنتز گردید. قطعه تکثیرشده از cDNA پس از تأیید در ناقل pJET1.2 کلون و تعیین توالی گردید. مقایسه توالی DNA ژنومی و cDNA این ژن نشان داد که ژن Def1 گیاه تربچه حاوی یک اینترون به طول 11۳ جفت باز بوده و open reading frame آن یک پپتید به طول 80 اسید آمینه را کد می کند. مقایسه توالی پپتید به دست آمده از ژن Def1 از گیاه تربچه با توالیهای ثبت شده مرتبط در بانک ژنی مشابهتی بین 90 تا 8/98 درصد را نشان داد.

شناسایی و همسانه سازی این ژن می تواند در آینده در راستای مدیریت کنترل و مبارزه با بیماریهای قارچی مورد استفاده قرار گیرند.

واژه های کلیدی: گیاه تربچه، پپتید دفنسین، Def1، جدا سازی ژن، همسانه سازی.

* نویسنده مسئول، تلفن: 02144787363  ،  پست الکترونیکی:  motalebi@nigeb.ac.ir

مقدمه

 

پپتید های ضد قارچی (Antifungal Peptides) نقش محافظت از گیاهان در برابر حملات قارچی را به عهده دارند. این پروتئینها در گیاهان، قارچها، باکتریها، حشرات و پستانداران شناسایی شده اند و در مقاومت دائمی و القایی در برابر حملات قارچی نقش ایفاء می کنند (13،20). به طور ویژه، دانه های گیاهان، غنی از پپتید های ضد قارچی می باشند به طوری که میزان این پروتئینها در دانه ها چندین برابر سایر قسمتهای گیاه می باشد (27). اهداف این پپتید های ضدقارچی، دیواره سلولی، غشای پلاسمایی و نهایتاً خروج ترکیبات درون سلولی قارچ می باشد (13). از مهم ترین پپتیدهای ضد قارچی می توان گروه پپتیدی دفنسین را نام برد.

دفنسینها، پپتیدهایی با وزن مولکولی کم حدودkDa  ۵ و غنی از سیستئین  می باشند که در هر دو گروه گیاهان تک لپه و دولپه ای وجود دارند. این پپتیدها برای قارچها سمی بوده (2 و 8) و در حفاظت از دانه در برابر قارچهای بیماری زا نقش مهمی ایفا می کنند (2). به طوری که قادر به مهار رشد چندین گونه قارچی نظیرAspergillus niger ، Neurospora crassa و Saccharomyces cerevisiae و همچنین مهار رشد عوامل بیماری زای گیاهی نظیر Alternaria brassicola ، A. solani ، Botrytis cinerea، Cladosporium colocasiae، C. sphaerospermum،
Colletotrichum lindemuthianum
، Diploidia maydis ، Fusarium culmorum ، F. graminearum و ... می باشند (24).سویه قارچ وهمچنین نوع پپتید دفنسین گیاهی از طرفی در کیفیت و میزان فعالیت مهاری و ازسوی دیگر در غلظت دفنسین مورد نیاز برای مهار مؤثر است (16). به طور مثال دفنسین گیاه Dahlia merckiiعلی رغم مهار رشد قارچ، هیچگونه تغییر مورفولوژیکی در قارچ ایجاد نمی کند در حالیکه برخی از آنها مانند دفنسین تربچه با ایجاد هیفهای تغییر شکل یافته در قارچها باعث مهار رشد آنها می شوند (15).

با توجه به موارد ذکر شده در مورد دفنسینها واهمیت آنها در ایجاد مقاومت علیه پاتوژنهای قارچی، هدف این تحقیق شناسایی، تکثیر، کلون و بررسی ساختار ژن Def1 گیاه تربچه خوراکی بوده که سرانجام  می توان از آن برای انتقال سازه مورد نظر به گیاهان زراعی استفاده کرد.

مواد و روشها

تهیه بذر، کشت و استخراج DNA: در این تحقیق از بذرهای گیاه تربچه (Raphanus sativus) که از بانک ژن گیاهی ملی ایران تهیه شد، استفاده گردید. بذرها در گلدان حاوی ورمیکولیت- پرلیت (با نسبت1:1) کشت و رشد داده شدند. استخراج DNA ژنومی، از برگهای جوان به روش عمومی CTAB انجام گرفت (6).

استخراج mRNA: استخراج mRNA از برگهای جوان گیاه تربچه با استفاده از روش ارائه شده کیت ((mRNA Isolation kit, Roche، صورت پذیرفت. در این روش علاوه بر به دست آمدن RNA مناسب و با کیفیت، کمترین آلودگی DNA را در بر داشت.

آغازگرها و شرایط انجام PCR اختصاصی: با استفاده از توالیهای ثبت شده ازواریته های مختلف گیاه تربچه در بانک داده ژنی NCBI (24،25)، به شماره ثبتهای RSU18557، RSU18556،  X97319 وX97318، آغازگررو به جلوی RDeff، که دارای جایگاه برش برای آنزیم XbaI در بالادست بود، با توالی 5´ GCTCTAGAATGGCTAAGTTTGCGTCCATCATC و آغازگر معکوس RDefr، که دارای جایگاه برش برای آنزیم SacI در بالادست بود، با توالی 5´GGAGCTCTTAACAAGGAAAGTAGCAGATACAC   جهت تکثیر و کلون کردن ژن Def1 طراحی و ساخته شد.

جهت تکثیر قطعه ژنی مورد نظر  از واکنشPCR  در حجم کلی 50 میکرولیتر با 20 نانو گرم  DNA ژنومی، 2/0 میکرو مول از هر پرایمر، 200 میکرو مول از هر dNTP و 2 واحد از آنزیم Pfu پلی مراز انجام گرفت. اجزای واکنش در دستگاه ترموسایکلر قرار گرفت تا طبق برنامه چرخه­های گرمایی تکثیر انجام پذیرد. چرخه­های دمایی واکنشهای تکثیر شامل یک چرخه آغازین واسرشت 5 دقیقه در دمای 95 درجه سانتی گراد، 35 چرخه شامل 1 دقیقه در 94 درجه، 1 دقیقه در 55 درجه،  2 دقیقه در 72 درجه و یک مرحله اتصال پایانی شامل 10 دقیقه در 72 درجه می باشد. محصول PCR به وسیله الکتروفورز در ژل آگارز 1 درصد مورد بررسی قرار گرفت. محصول PCR به وسیله کیت  High Pure DNA Purification KIT ( Roche) از روی ژل جداسازی و خالص سازی شد.

تهیه cDNA: برای تهیه زنجیره اول ( cDNA first strand cDNA )، از آنزیم نسخه برداری معکوس و پرایمرRDefr در دمای 42 درجه سانتی گراد استفاده گردید و در مرحله بعد با انجام PCR در شرایطی که قبلأ ذکر شد با استفاده از آنزیم Pfu پلی مراز ، cDNA دو زنجیره ای جهت انجام کلونینگ به دست آمد. 

روش استخراج پلاسمید و کلون کردن: استخراج پلاسمید به روش عمومی لیز قلیایی صورت پذیرفت (19). جهت کلون کردن ژن تکثیر شده کیت CloneJETTM-PCR cloning (Frementas) استفاده شد. برای این منظور پس از استخراج و تخلیص محصول Pfu-PCR با استفاده از کیت PCR Product Purification Kit (Roche)، واکنش ligation با حضور DNA خالص شده (فرم DNA ژنومی و cDNA) و ناقل pJET1.2 صورت پذیرفت و به سلولهای مستعد تازه تهیه شده باکتریDH5α  E. coli منتقل شدند. سلول های ترانسفورم شده روی محیط کشت جامد LB (حاوی 1% NaCl، 1% Bacto tryptone، 0.5% Yeast extract و 100 میکروگرم در هر میلی لیتر آمپی سیلین بود)  گسترش داده شدند. کلونیهای حاصله پس از تأیید، جهت حضور قطعه ژنی مورد نظر توسط الگوی PCR و هضم آنزیمی با استفاده از آنزیم XbaI بررسی شدند، سپس به منظور تعیین توالی قطعه ژنی مورد نظر با استفاده از آغازگرهای اختصاصی ناقل pJET1.2 برای شرکت SeqLab Gottingen  آلمان فرستاده شد.

تجزیه و تحلیل بیوانفورماتیک: با استفاده از برنامه نرم افزاری Blast مشابهت توالی ژن Def1 با اطلاعات موجود در بانک ژنی مورد بررسی قرار گرفت.  برنامه نرم افزاری CLUSTAL W جهت مقایسه توالی نوکلئوتیدی و اسید آمینه ای ژن Def1 با توالیهای ثبت شده در بانک ژنی به کار گرفته شده و با استفاده از برنامه SWISS-MODEL پیش بینی ساختمان سه بعدی catalytic core domain آنزیمDef1 صورت گرفت.

نتایج

با توجه به اهمیت فعالیت ضد قارچی پپتید دفنسین در مقابل طیف وسیعی از عوامل بیماری زای قارچی و همچنین نقش حفاظتی این پپتید در بذرهای مختلف به خصوص بذر تربچه هنگام جوانه زنی، در این تحقیق از DNA ژنومی گیاه تربچه جهت شناسایی و تکثیر ژن دفنسین(Def1)  استفاده شد. پس از طراحی آغازگرهای اختصاصی (RDeff/Rdefr) با استفاده از توالیهای مربوط به این ژن در بانک ژنی، واکنش PCR با استفاده از آنزیم Pfu پلی مراز، که دارای توانایی proofreading می باشد، انجام گرفت. طول DNA  تکثیر شده توسط این آغازگرها براساس توالی مربوط به ژن Def1 گیاه تربچه 370  جفت باز (با احتساب توالی مربوط به جایگاههای آنزیمی آغازگرها) می باشد. بررسی قطعه تکثیر شده فوق نشان دهنده  تکثیر DNA با طول مورد انتظار است (شکل 1).

     M             1

 

 

1000

 

500

300

شکل 1- تکثیر ژن Def1 از گیاه تربچه: ستون1= محصول PCR با استفاده از آغازگرهای  RDeff/Rdefr، M= مارکر 100bp ladder

جهت همسانه سازی این ژن، ابتدا استخراج و تخلیص محصول PCR انجام گرفت. مخلوط واکنش اتصال شامل DNA خالص شده و ناقل pJET1.2 به سلولهای مستعد تازه تهیه شده باکتری E. coli DH5α  منتقل و سپس DNAی سازه نوترکیب استخراج شد. صحت قطعه کلون شده توسط الگوی PCR و هضم آنزیمی (شکل 2) تأیید شده و برای تعیین توالی مورد استفاده قرار گرفت.  با بررسی نتایج به دست آمده از تعیین توالی مشخص گردید که طول قطعه تکثیر شده مربوط به ژن Def1 مورد نظر برابر 356 جفت باز (شکل 5)  می باشد.  سازه حاصل پس از تأیید نهایی به نام pJETME1  نام گذاری شد.

  M       1         2

 

 

 

3000

 

1000

 

500

شکل 2- تأیید سازه نوترکیب pJETME1 حاوی فرم ژنومی ژن Def1: ستون 1= الگوی PCR با استفاده از آغازگرهای RDeff/Rdefr ،  ستون 2= الگوی هضم آنزیمی با استفاده از آنزیم XbaI ،  =M مارکر 100 bp ladder

 

جهت تعیین جایگاه اینترون و اگزونهای ژن Def1 گیاه تربچه، از mRNA استخراج شده از بذرهای گیاه تربچه برای RT-PCR جهت سنتز cDNA استفاده گردید. لذا با استفاده از پرایمر RDefr  و آنزیم reverse transcriptase اولین رشته از cDNA سنتز گردید.  پس از آن cDNA دو رشته ایی با استفاده از آغازگرهای اختصاصی RDeff و RDefrو آنزیم Pfu  پلی مراز تهیه گردید.  نتایج به دست آمده حاکی از تکثیر cDNA به دست آمده به طول 243 جفت باز می باشد (شکل 3).  cDNA سنتز شده در ناقل pJET1.2  همسانه سازی گردید. سازه نوترکیب به دست آمده توسط الگوی PCR، هضم آنزیمی (شکل 4) و نهایتا تعیین توالی مورد تأیید قرارگرفته و به نام pJETME2 نام گذاری شد. 

مقایسه توالیهای ژنومی و cDNA ژن Def1 تربچه نشان دهنده وجود یک اینترون به طول 113 جفت باز می باشد. توالی اینترون از نوکلئوتیدهای 65 الی 177 در توالی ژن Def1 واقع شده است (شکل 5). از طرفی این مقایسه حاکی از کد شدن یک پلی پپتید به طول 80 اسید آمینه (شکل 5) و وزن مولکولی 7/8 کیلو دالتون است.

    M         1        2

 

 

1000

 

500

شکل 3- تکثیر cDNA ژن Def1 گیاه تربچه: ستون1= کنترل منفی، ستون 2= محصول PCR با استفاده از آغازگرهای RDeff/Rdefr ، M = مارکر 100bp ladder

 

  M      1       2

 

 

3000

1000

 

500

شکل 4- تأیید سازه نوترکیب pJETME2 حاوی cDNA ژن Def1:  ستون1= الگوی PCR با استفاده از آغازگرهای RDeff/Rdefr ،  ستون 2= الگوی هضم آنزیمی با استفاده از آنزیم XbaI، M = مارکر 100bp ladder

بررسی ساختار فضایی پپتید دفنسین تربچه نشان می دهد که پپتید فوق دارای 8 اسیدآمینه سیستئین در موقعیت اسیدآمینه های 33، 44، 50، 54، 65، 74، 76 و 80 بوده و منجر به شکل گیری 4 پیوند دی سولفیدی درون رشته ای می گردند که این پیوندها خود باعث افزایش پایداری در ساختار سه بعدی پپتید می شود. پیوندهای دی سولفیدی باعث شکل گیری موتیف CSαβ شده است. از دیگر ویژگیهای این پپتید وجود یک مارپیچ α و 3 صفحه β است (شکل6).

با استفاده از برنامه CLUSTAL W و مقایسه توالی اسیدآمینه پپتید دفنسین  فوق با توالیهای ثبت شده در بانک ژنی نشان داده شد که این پپتید با پپتید دفنسین گیاهان Brassica juncea، Orychophragmus violaceus،
 B. oleracea،Sinapis alba ، Arabidopsis halleri، Eutrema wasabi  و B. rapaبه ترتیب به میزان8/98 ،2/96 ، 28/ 93، 5/92، 2/91، 90 و 90 درصد شباهت دارد (شکل 7).

 

ATG GCT AAG TTT GCG TCC ATC ATC GCA CTT CTT TTT GCT GCT CTT

M   A   K   F   A   S   I   I   A   L   L   F   A   A   L

GTT CTT TTT GCT GCT TTC G gtgagtagtgacctgcttatcacatgctgcgca

V   L   F   A   A   F   E

tgaaaaatttagatttgtagtttttttttagttttcatattaatttgatatctaacctt

 

gtgagatctatgtatttacag AA GCA CCA ACA ATG GTG GAA GCA CAC AA

                         A   P   T   M   V   E   A   Q   K

G TTG TGC GAA AGG CCA AGT GGG ACA TGG TCA GGA GTC TGT GGA A

  L   C   E   R   P   S   G   T   W   S   G   V   C   G   N

AC AAT AAC GCA TGC AAA AAT CAG TGC ATT AAC  CTT GAG AAA GCA

   N   N   A   C   K   N   Q   C   I   N    L   E   K   A

CGA CAT GGA TCT TGC AAC TAT  GTC TTC CCA GCT CAC AAG TGT AT

R   H   G   S   C   N   Y    V   F   P   A   H   K   C   I

C TGC TAC TTT CCT TGT TAA

    C   Y   F   P   C   *

 

 

 

 

 

 

 

 

 

 

 

 

 


شکل 5- توالی ژن Def1گیاه تربچهو توالی اسید‌آمینه ای  پروتئین آن: توالی اگزونی با حروف بزرگ و توالی اینترونی با حروف کوچک و  توالی اسید آمینه ای signal peptide با زیرخط نشان داده شدند.

 

 

 

 

 

 

 

 

 

 

 

 

 

 

شکل 6- ساختار فضایی پپتید Def1 گیاه تربچه: 1= نمایانگر مارپیچ α وصفحات β.  2=نمایش اسیدآمینه های سیستئین در پپتید. 3= نمایش پیوندهای دی سولفیدی درون رشته ای در پپتید Def1.

 

شکل 7- A) درصد مشابهت توالی اسید آمینه ای پپتید Def1 گیاه تربچه، با توالی اسید آمینه ای ژنهای مشابه در بانک ژنی

B) دندروگرام حاصل از آنالیز توالیهای اسید آمینه ای دفنسین گیاهانBrassica sativus، B. juncea، Orychophragmus violaceus ،
 
B. oleracea، B. rapa، Sinapis alba، Arabidopsis halleri و Eutrema wasabi

 


بحث

با توجه به اهمیت دفنسینها و توانایی بالقوه آنها در مهار رشد عوامل بیماری زایی قارچی (14)، این پپتیدها می‍توانند به عنوان کاندیداهای مناسبی برای تولید گیاهان تراریخت مقاوم به قارچها مورد استفاده قرار گیرند. دفنسینها متعلق به خانواده پپتیدی غنی از سیستئین و با وزن مولکولی پایین می باشند و به صورت عمده روی غشاهای سلولی اثر می گذارند. وجود این گروه از پروتئینها در پستانداران، حشرات و گیاهان گزارش شده است(4، 12، 26). از ویژگیهای این گروه از پروتئینها سمیت علیه قارچها (2 و 8) و در نتیجه حفاظت از بذر گیاهان در برابر قارچهای بیماری زا می باشد (2).

از آنجایی که گزارشات نشان از فعالیت ضد قارچی بالایی در گیاه تربچه دارد(22، 24)، وهمچنین با توجه به اهمیت ژنهای دفنسین، ژن Def1 در دو فرم ژنومی و cDNA شناسایی، همانند سازی، کلون و تعیین توالی گردید. ساختار ژنی دفنسینها از دو اگزون که اگزون اول یک سیگنال پپتید واگزون دوم دمین اصلی دفنسین را شامل می‍شود تشکیل شده است (3، 5 و 18). مطالعات حاکی از وجود یک اینترون کوتاه به طول 113 نوکلئوتید در ساختار این ژن با طولی برابر 356 نوکلئوتید می باشد.  مقایسه پپتیدی این ژن با ژن دفنسین گیاه B. juncea  (21) 8/98 درصد مشابهت  و با ژن دفنسین گیاه B. rapa (17) 90 درصد شباهت را نشان می دهد.

با مقایسه تفاوتهای موجود بین اسیدآمینه های پپتید دفنسین گیاه تربچه با پپتید دفنسین از گیاه B. juncea  مشاهده شد که تنها در یک اسیدآمینه در قسمت پپتید نشانه با هم تفاوت دارند و با پپتید دفنسین از گیاه O. violaceus علاوه بر دو اسیدآمینه در پپتید نشانه، دارای تفاوت در یک اسیدآمینه در قسمت پپتید بالغ  نیز می باشد به طوری که به جای اسیدآمینه گلوتامیک اسید در پپتید دفنسین تربچه، اسیدآمینه گلوتامین قرار گرفته است. با بررسی بقیه پپتیدها مشاهده شد که تغییرات بیشتری در قسمت پپتید بالغ مشاهده می شود  و تغییرات به گونه ای است که یک نوع اسیدآمینه از یک گروه به یک گروه دیگر تغییر یافته است. به عنوان مثال اسیدامینه غیر قطبی به نوع قطبی با بار مثبت تبدیل شده است. باید توجه داشت که تغییر اسید آمینه در قسمت پپتید بالغ می تواند بر نوع عملکرد و همچنین میزان فعالیت پپتید اثرگذار باشد. به عبارتی، تغییر اسید آمینه  در یک گروه اسیدآمینه ای و یا تغییر آن از یک گروه به گروه دیگر اسیدآمینه حائز اهمیت است(به عنوان مثال اسیدآمینه اسیدی به اسیدآمینه بازی تبدیل شود).

بررسی مقالات منتشر شده نشان دهنده انتقال برخی از ژنهای دفنسین گیاهی به گیاهان زراعی می باشد که این امر منجر به فعالیت ضد قارچی بسیار قوی شده  و مقاومت قابل توجهی را در برابر چندین بیماری قارچی ایجاد می نمایند  (9،10،28). از طرفی گزارشات حاکی از خسارات بسیار زیادی در برخی از گیاهان زراعی نظیر گندم، کلزا، چغندرقند و نیشکر می باشد(1،11،26،27) که این گیاهان در معرض برخی از عوامل بیماری زای قارچی قرار می‍گیرند. جهت جلوگیری از خسارات احتمالی وارده بر گیاهان می توان از ژنهای دفنسین استفاد نمود. در مطالعه قبلی این گروه ژن دفنسین گیاه شنبلیله به نامTfgd2 شناسایی و مطالعه شده است (7). در این تحقیق ژن Def1 از گیاه تربچه مورد مطالعه، شناسایی و کلون قرار گرفته که این ژنها در آینده می توانند برای انتقال به گیاهان زراعی ایران با استفاده از ناقلهای بیانی گیاهی مناسب، مورد بررسی و بهره برداری قرار گیرند.

  1. Beckers, G.J.M., Spoel, S.H., 2006. “Fine-Tuning Plant Defence Signalling: Salicylate veRsus Jasmonate”, Plant biology; 8(01) 1-10.
  2. Broekaert, W.F., Rev., 1995. “Plant defensins: novel antimicrobial peptides as components of the host defense system”, Plant physiology, 16 297-304.
  3. Chen, J., 2004. “Cloning and Functional Expression of a Mungbean Defensin VrD1 in Pichia pastoris”, Journal of Agricultural and Food Chemistry; 52(8) 2256-2261.
  4. Daneshmand, F., 2014 “Identification and purification of an antimicrobial peptide from Ziziphus jujuba”, Journal of cellular and molecular researches: 27(2) 211-223.
  5. De Beer, A., Vivier, M., 2008. “Vv-AMP1, a ripening induced peptide from Vitis vinifera shows strong antifungal activity”, BMC Plant Biology; 8(1) 75-83
  6. Doyle, J. J., Doyle, J.L., 1987. “A rapid DNA isolation procedure for small quantities of fresh leaf tissue”, Phytochem.Bull.; 19 11-15.
  7. Etebari, M., Motallebi, M., Zamani, M.R., Moghaddassi Jahromi, Z., 2016. “Structural Analysis of def2 Gene from Trigonella foenum-graecum by Characterization of Its Genomic and cDNA”, Journal of Agricultural Biotechnology: 7(01) 79-86.
  8. Evans, I.J., Greenland, A.J., 1998. “Transgenic approaches to disease protection: applications of antifungal proteins” Pesticide Science; 54(4) 353-359.
  9. Gao, A.G., 2000.Fungal pathogen protection in potato by expression of aplant defensin peptide”, Nature Biotechnology; 18(12) 1307-1310.
  10. Kanzaki, M., 2002. “Overexpression of the wasabi defensin gene confers enhanced resistance to blast fungus (Magnaporthe grisea) in transgenic rice”, TAG Theoretical and Applied Genetics; 105(6) 809-814.
  11. Monteiro, S., 2003. “Environmental conditions during vegetative growth determine the major proteins that accumulate in mature grapes”, Journal of Agricultural and Food Chemistry; 51(14) 4046-4053.
  12. Mortazavi, S. M., Saffar, B., Mirakhorli, N., Mobini Dehkordi, M., 2016 “Design, synthesis,       cloning, expression and evaluation of the antibacterial effect of wheat defensin (Triticum aestivum) in E. coli host” Journal of cellular and molecular researches:29(1) 114-125.
  13. Ng, T.B., 2004. “Antifungal proteins and peptides of leguminous and non-leguminous origins”, Peptides; 25(7) 1215-1222.
  14. Olli, S., Kirti, P.B., 2006. “Cloning, Characterization and Antifungal Activity of Defensin Tfgd1 from Trigonella foenum-graecum L.”, J. Biochem Mol Biology; 39(3) 278-283.
  15. Osborn, R.W., 1995. “Isolation and characterization of plant defensins from seeds of Asteraceae, Fabaceae, Hippocastanaceae and Saxifragaceae”, FEBS Letters; 368(2) 257-262.
  16. Park, H.C., 2002. “Characterization of a stamen-specific cDNA encoding a novel plant defensin in Chinese cabbage”, Plant Molecular Biology; 50(1) 57-68.
  17. Park, Y.S., Cho, T.J., 2003. “Isolation and characterization of methyl jasmonate‐inducible genes in chinese cabbage’, Korean Journal of Biological Sciences, 7(4) 337-343.
  18. Pelegrini, P.B., 2008. “Novel insights on the mechanism of action of alpha-amylase inhibitors from the plant defensin family”, Proteins: Structure, Function, and Bioinformatics; 73(3) 719-729.
  19. Sambrook, J., Russell, D.W., 2001. “Molecular cloning’, Cold Spring Harbor: New York.
  20. Selitrennikoff, C.P., 2001. “Antifungal Proteins”, Applied and environmental microbiology; 67(7) 2883-2894.
  21. Swathi, A.T., Kirti, P.B.,  2005. “Cloning and sequencing of a genomic clone of defensin from Brassica junces”, Direct submission to NCBI, AN: ABB59549.
  22. Terras, F., 1995. “Small cysteine-rich antifungalproteins from radish: their role in host defense”, Plant Cell; 7(5) 573-588.
  23. Terras, F.R., 1992. “Analysis of two novel classes of plant antifungal proteins from radish (Raphanus sativus L.) Seeds”, Journal of Biological Chemistry; 267(22) 15301-15309.
  24. Terras, F.R.G., Eggermont, K., Kovaleva, V., Raikhel, N.V., Osborn, R.W., Kester, A., Rees, S.B., Torrekens, S., Van Leuven, F., Vanderleyden, J., Cammue, B.P.A., Broekaert, F.W., 1995. “Small cysteine – rich antifungal proteins from radish: their role in host defense”, Plant Cell; 7 568-573.
  25. Terras, F.R.G., Goderis, I.J., Penninckx, I.J., Osborn, R.W., Broekaert, F.W., 1996. “Raphanus sativus mRNA for antifungal protein3”, Direct submission to NCBI, AN: X97319.
  26. Theis, T., Stahl, U., 2004. “Antifungal proteins: targets, mechanisms andprospective applications”, Cellular and Molecular Life Sciences; 61(4) 437-455.
  27. Wang, H., Ng, T.B., 2001. “Isolation of a Novel Deoxy ribonuclease with Antifungal Activity from Asparagus officinalis seeds”, Biochemical and Biophysical Research Communications; 289(1) 120-124.
  28. Zhu, Y., Agbayani, R.,  Moore, P.,  2007. “Ectopic expression of Dahlia merckii defensin Damp 1 improves papaya resistance to Phytophthora palmivora by reducing pathogen vigor”, Planta; 226(1) 87-97.