نوع مقاله: مقاله پژوهشی

نویسندگان

1 دانشگاه پیام نور تهران شرق

2 استادیار دانشگاه پیام نور مرکز شهرری (آزمایگاه بیوتکنولوژی)

3 ریاست دانشگاه واستاد بیوشیمی ( دانشگاه پیام نور تهران شرق)

چکیده

مقدمه: استئوآرتریت شایع ترین بیماری مفصلی فاقد درمان دارویی کامل است. مهم ترین عامل ناتوانی در سالمندان و شایع ترین بیماری دژنراتیو مفصلی در کشورهای در حال توسعه می باشد. اصلی ترین تظاهر آسیب شناسی آن درسطح بافتی، تخریب موضعی غضروف مفصلی است. آنزیم های ماتریکس متالو پروتئیناز (MMPS) خانواده بزرگ آنزیم های پروتئولایتیک وابسته به روی می باشند که در پیشرفت وگسترش بیماری های التهابی مثل استئوآرتریت شناخته شده است.
مواد وروش ها: در این مطالعه تجربی ، پانیسیک اسید روغن هسته انار از شرکت کارلاوان کرمان خریداری شد. سلولهای THP-1 از انستیتو پاستور تهیه وکشت داده شد و با غلظت های (8 تا100 میکروگرم بر میلی لیتر) و در فاصله زمانی (24،48،72ساعت)، سمیت سلولی پانیسیک اسید بر علیه سلولهای THP-1 تحریک شده با LPS، با استفاده از MTT( با طول موج 540) بررسی و جهت سنجش میزان اثر مهار کنندگی PA بر فعالیت ماتریکس متالو پروتئینازها، الایزا، وسترن بلات،مهاجرت سلولی و تهاجم انجام شد. داده ها با استفاده از آزمون های آماری T.student وANOVA تجزیه شد.
یافته ها : نتایج الایزا و وسترن بلات اثر مهارکنندگی پانیسیک اسید را بر روی بیان MMP-1 نشان داد. ولی بر میزان بیان MMP-3 تاثیری نداشت. همچنین بر اساس آزمون MTT میزان LC50 معادل 50 میکروگرم بر میلی لیتر گزارش شد.
نتیجه گیری: با توجه به تاثیر پانیسیک اسید بر میزان بیان برخی MMPSو اثرکم آن بر MMP-1، این ماده می تواند به عنوان یک کاندید بالقوه مطالعات بیشتر بر روی سایر MMP ها و جایگزینی داروهای شیمیایی معرفی گردد.

کلیدواژه‌ها

موضوعات

عنوان مقاله [English]

The effect of Punicic Acid (pomegranate seed oil) on metalloproteinase genes (MMP-1, 3) in THP-1 cells stimulated with LPS compared with steroidal and non-steroidal drugs.

نویسندگان [English]

  • Roya Vazirijavid 1
  • Hossein Maghsodi 2
  • Reza Hajihosseini 3

1 Payam e Noor University

2 Payam e Noor University

چکیده [English]

Introduction: Osteoarthritis is a common joint disease for which there are currently no disease-modifying drugs available. Osteoarthritis (OA) affects most of the elderly population, the main features of which are cartilage damage. Degradation of the cartilage extracellular matrix is a central feature of the disease and is widely thought to be mediated by proteinases that degrade structural components of the matrix. The matrix metalloproteinases (MMPs) are a family of human zinc endopeptidases that play significant roles in inflammatory diseases such as osteoarthritis.
Materials and methods: In this experiential laboratory study. punicic acid of pomegranate seed oil was purchased from Clarodan Kerman Co,. THP-1 cells (Pasteur Institute of Iran) were cultured and administered with concentration of 8 to 100 μg/ml (in 24h, 48h, and 72h). Cellular toxicity of punicic acid against THP-1 was estimated using the MTT assay and to measure the inhibitory effects of PA on Matrix metalloproteinase proteinase activity, ELISA and Western blot, migration and invasion tests were performed. Data were analyzed using T.student and ANOVA.
Results: Western blotting and ELISA showed inhibitory effect of punicic acid on the expression of MMP-1 but not in MMP-3. Punicic acid of pomegranate seed oil shows the most cellular toxicity effect at lc50=50 micrograms per milliliters and 72 hours after treatment.
Conclusion: According to effect of Punicic Acid on MMP-1 expression, this material can be used as a potential candidate for further studies on the other MMPS and its replacing the chemical drugs.

کلیدواژه‌ها [English]

  • Punicic Acid
  • MMP-1
  • 3
  • THP-1
  • Osteoarthritis

بررسی اثر پانیسیک اسید روغن هسته انار بربیان ژن متالو پروتئیناز یک و سه در سلولهای THP-1  تحریک شده با لیپوپلی ساکارید در مقایسه با ترکیبات دارویی استروئیدی و غیر استروئیدی

رویا وزیری جاوید1، حسین مقصودی2* و رضا حاجی حسینی2

1 ایران، تهران، دانشگاه پیام نور تهران شرق، گروه بیوشیمی

2 ایران، ری، دانشگاه پیام نور شهرری، گروه بیوتکنولوژی

تاریخ دریافت: 24/10/95              تاریخ پذیرش: 15/5/96

چکیده

استئوآرتریت شایع ترین بیماری مفصلی است که درمان دارویی کاملی ندارد. مهم ترین عامل ناتوانی در میان سالمندان و شایع ترین بیماری دژنراتیو مفصلی در کشورهای در حال توسعه می باشد. اصلی ترین تظاهر آسیب شناسی  آن درسطح بافتی، تخریب موضعی غضروف مفصلی است. آنزیمهای ماتریکس متالو پروتئیناز (MMPS) خانواده بزرگ آنزیمهای پروتئولایتیک وابسته به روی می باشند که در پیشرفت وگسترش بیماریهای التهابی مانند استئوآرتریت کاملاً شناخته شده می باشند. در این مطالعه تجربی ، پانیسیک اسید روغن هسته انار از شرکت کارلاوان کرمان خریداری شد. سلولهای THP-1 از انستیتو پاستور تهیه وکشت داده شد و با غلظتهای (8 تا100 میکروگرم بر میلی لیتر) و در فاصله زمانی (48،72 و 24 ساعت)، سمیت سلولی پانیسیک اسید بر علیه سلولهای  THP-1 تحریک شده با LPS، با استفاده از  MTT( با طول موج 540) بررسی و جهت سنجش میزان اثر مهار کنندگی PA بر فعالیت ماتریکس متالو پروتئینازها، الایزا، وسترن بلات، مهاجرت سلولی و تهاجم انجام شد. داده ها با استفاده از آزمونهای آماری T.student وANOVA  تجزیه و تحلیل شد.  نتایج الایزا و وسترن بلات اثر مهارکنندگی پانیسیک اسید را  بر روی بیان MMP-1 نشان داد. ولی بر میزان بیان MMP-3 تأثیری دیده نشد. همچنین بر اساس آزمون MTT میزان LC50 معادل 50 میکروگرم بر میلی لیتر گزارش شد. با توجه به تأثیر پانیسیک اسید بر میزان بیان برخی  MMPSو اثرکم آن بر MMP-1، این ماده می تواند به عنوان یک کاندید بالقوه برای مطالعات بیشتر بر روی سایر MMP ها و جایگزینی با داروهای شیمیایی معرفی گردد.

واژه های کلیدی: متالو پروتئیناز1 و3 ، THP-1، پانیسیک اسید، استئوارتریت

* نویسنده مسئول، تلفن : 02122458315 ، پست الکترونیکی: hosseinmaghsodi2000@gmail.com

مقدمه

 

استئوآرتریت شایع ترین بیماری مفصلی  )آرتروپاتی ( و یک عامل کاهش توانایی بدن در سنین بالا می باشد . میزان شیوع آن با شاخص سنی جمعیت و میزان چاقی ارتباط دارد. استئوآرتریت زانو با شیوع 33 درصد، شایع ترین مفصلی است که گرفتار می شود. شیوع آن در مفاصل انگشتان دست 5/29 درصد، مچ پا 20/8 درصد و هیپ 4/7 درصد است. در مطالعات دیگر شیوع آن در مردان و زنان 60 ساله به ترتیب 9/6 درصد و 18 درصد گزارش شده است (11). در کشور ایران استئوآرتریت بین کشگک و استخوان ران patellofemoraljoint)) شایع تر می باشد و علت آن وضع زندگی اجتماعی و فرهنگ جامعه است، زیرا اکثر افراد در موقع نشستن و غذا خوردن روی زمین به صورت دوزانو و چهارزانو می نشینند (18).

فرآیند بیماری به صورت کاهش ضخامت غضروف مفصلی، تخریب پیشرونده سطح غضروفی، سینوسیت محدود غیر فرسایشی و بازسازی مجدد استخوانی می باشد. استخوان سازی مجدد به صورت ایجاد استئوفیت در حاشیه غضروف مفصلی و اسکلروز ساب کندرال خود را نشان می دهد (13و20و29). خانواده (MMPs) ماتریکس متالوپروتئیناز، آندوپپتیدازهای وابسته به عناصر روی و کلسیم می باشند که توانایی پروتئولیز بسیاری از ترکیبات ماتریکس خارج سلولی (شامل کلاژزنازها، پروتئوگلیکانها و گلیکوپروتئینازها) را دارند و با این کار سبب تشدید سیکل پاسخهای التهابی می شوند (25و26).  ماتریکس متالوپروتئینازهاMMP ها یا متالوپروتئینازها ،پروتئینازهایی هستند که نقش مهمی در تخریب غضروف یا ECM بازی می کنند. این آنزیمها از سوپر خانواده متالوآنزیمهای دارای عناصر روی و دارای یک پپتید سیگنالی یا نشانه می باشند، که در ابتدا به صورت پروپپتید ترشح می شوند، دارای دومین کاتالیتیکی، واجد یک منطقه لولا مانند و همچنین یک هموپکسین در دومین C ترمینال هستند. همه MMPs ها دارای ساختار مشترکی در دومینهای خود هستند (10). بر اساس ویژگی سوبسترا، ساختار اولیه و موقعیت سلولی ،MMP  ها به گروههای عملکردی شامل ژلاتینازها، کلاژنازها، ترمولیزین ها و MMP های غشایی (MT-MMP) تقسیم می شوند. سایر خانواده های دخیل در تخریب غضروف شامل ADAM (پروتئینهای دیس اینتگرین و واجد دومین متالوپروتئیناز) و ADAMTS (ADAM هایی واجد موتیف شبیه ترومبواسپوندین ها) می باشند. از زمان کشف اولین MMPs در سال 1962 (16و27) تا به حال 23 خانواده متالوپروتئیناز انسانی شناخته شده اند که همگی متعلق به خانواده اندوپپتیدازهای وابسته به Ca وZn می باشند.

کلاژنازها ،MMP-1,13 واسطه های عمده در تخریب غضروف و هدف اصلی برای درمان OA می باشند. سایر MMP ها یعنی MMP های (2، 3، 8، 9، 11، 14، 16 و 28) به میزان بالایی در غضروف OA بیان می شوند. سه کلاژناز کلاسیک MMP-1 (8 و13) در غضروف انسانی شناسایی شده است و MMP-1 اولین متالوپروتئینازی بود که کشف شد (9). MMP-1 یک کلاژناز بینابینی و MMP-8 کلاژناز نوتروفیل است که در مناطق سطحی غضروف یافت می شود (7).

کنترل OA با استفاده از داروهای استروئیدی و داروهای ضد التهابی غیر استروئیدی (NSAIDs) و مسکنهایی است که درد را کنترل کرده وکیفیت زندگی را بهبود می بخشد ولی دارای عوارض گوناگونی نیز می باشد که مصرف آنها را محدود می کند (30). NSAID ها، به ویژه، به طور گسترده ای استفاده می شود اما مصرف طولانی مدت آنها با عوارض جانبی جدی مانند زخم دستگاه گوارش در ارتباط است (34). این تحقیق با توجه به لزوم درمانی مؤثر با عوارض جانبی کمتر جهت بهبود عملکرد وکیفیت زندگی بیماران دچار استئوآرتریت با استفاده از مواد مؤثره گیاهی شکل گرفته است.

پونیسیک اسید (PUA) که به عنوان اسید تریکوزانوئیک نیز شناخته شده است، یک اسید چرب کونژوگه تری انوئیک است که به طور طبیعی در غلظتهای بالا در دانه از عصاره انار (Punicaceae، انار) وجود دارد (22 و 24). پانیسیک اسید 64-83 درصد از روغن دانه انار (PSO) را تشکیل می دهد (32 و 35). پانیسیک اسید دارای خواص ضد دیابت و ضد چاقی و سندرم متابولیک (5و8) کاهنده چربی (4) ، فعالیت ضد التهابی (33و37) ، ضد سرطان (36) و فعالیت آنتی اکسیدانی (31) و همچنین اثرات کاهش فعالیت متالوپروتئینازها در استئوآرتریت می باشد (38).

 

مواد و روشها

پانیسیک اسید روغن هسته انار از شرکت کارلاوان کرمان که نماینده شرکت LCG آمریکا با خلوص 98 درصد است خریداری شده است. و تا زمان استفاده در دمای منفی 20 درجه نگهداری شد.

رده سلولی: به منظور انجام مطالعه تجربی حاضر،  رده سلولی THP-1 از انستیتو پاستور ایران تهیه شد و به آزمایشگاه تحقیقاتی دانشگاه پیام نور مرکز شهرری انتقال یافت. برای رشد این رده سلولی از محیط کشت  RPMI1640شرکت سیگما )غنی شده با سرم جنین گاوی  (Fetal Bovine Serum-FBS) 10در صد Bio idea) ایران) و آنتی بیوتیکهای پنی سیلین/ استرپتومایسین 100 میکروگرم بر میلی لیتر، سیناژن، استفاده شد. سلولها در محیط کشت سلولی داخل انکوباتور تحت شرایط دی اکسید کربن 5 درصد، رطوبت 95 درصد و دمای 37 درجه سانتی گراد قرارگرفتند.

آنالیز دز پاسخ: سلکوکسیب با غلظت 50 تا 100 نانومول ، دگزامتازون با غلظت 1 تا100 نانومول و پانیسیک اسید با غلظتهای 8 تا 100 میکروگرم بر میلی لیتر به محیط کشت سلولها اضافه شد و پس از ۲۴ ساعت انکوباسیون، سلولها مورد رنگ سنجی قرار گرفتند . از محیط کشت سلولها به منظور انجام تست الایزا نمونه برداری شد (جدول 2). مراحل فوق ۳ بار تکرار شدند.

سنجش سمیت سلولی بر اساس روش MTT: به منظور بررسی اثرات پانیسیک اسید روغن هسته انار، تعداد 105 سلول THP-1 در 12 پلیت قرار داده شد. بعد از 24 ساعت سلولها با غلظتهای متفاوت پانیسیک اسید روغن هسته انار (8،16،24،32،38،40،50،60،70،80،90،100 میکروگرم بر میلی لیتر) در فاصله زمانی 72 ساعت تیمارشدند. پس از این بازه زمانی تعداد سلولهای هر پلیت با استفاده از لام هموسایتومتر و رنگ تریپان بلو (Merck آلمان) در زیر میکروسکوپ نوری (Hm-Lux z آلمان) در قیاس با نمونه کنترل تیمار نشده مورد ارزیابی و شمارش قرار گرفت. جهت بررسی اثر کشندگی پانیسیک اسید روغن هسته انار برروی سلولهای THP-1 از آزمون ( MTT-Methyl Thiazol Tetrazzolium  ) استفاده شد. نمک تترازولیوم به واسطه فعالیت میتوکندریایی سلولهای زنده به بلورهای فورمازان که جذب متفاوتی دارند احیاء می شوند. به این منظور 105 سلول در هر پلیت کشت داده شد، پس از 24 ساعت غلظتهای متفاوتی از پانیسیک اسید و حلال متانول اضافه شد. پس از اتمام مراحل کشت، سلولها (1000تا2000 دور در دقیقه به مدت 5 دقیقه) سانتریفیوژ شدند. تا سلولهای معلق در کف پلیت رسوب کنند. سپس سلولها با PBS سرد شستشو داده و بر روی آنها محیط کشت حاوی MTT اضافه گردید و به مدت 2 تا 4 ساعت در انکوباتورCO2 در 37 درجه سانتی گراد قرار داده شد. در طی زمان انکوباسیون MTT توسط سیستم سوکسینات دهیدروژناز که یکی از آنزیمهای چرخه تنفسی میتوکندریهاست احیاء می شود. احیاء و شکسته شدن این حلقه موجب تولید کریستالهای آبی رنگ فورمازان می شود که در زیر میکروسکوپ به راحتی قابل تشخیص هستند. سپس نمونه ها با استفاده از دستگاه الایزا ( stafix-2100 آمریکا) خوانده شد.

تجزیه وتحلیل آماری داده ها با استفاده از نرم افزارSPSS نسخه 15 آنالیز یک طرفه ANOVA وآزمون T.Student وسطح معنی داری کمتراز  p<0/05 ازنظرآماری معنی دار درنظر گرفته شده است.

روش الایزا (ELISA): نمونه سرم جمع آوری شده و سلولها ( 10000 دور به مدت 5 دقیقه) سانتریفیوژ شدند. وجود پروتئین MMP-1 با توجه به دستورالعمل کارخانه سازنده برای MMP-1 سیستم ELISA (GE Healthcare, Tokyo, Japan) مورد سنجش قرار گرفت. چگالی نوری توسط میکروپلیت ریدر (مدل 37085، المان ) تعیین شد. یک منحنی استاندارد برای MMP-1 با استفاده از غلظت شناخته شده از سیتوکین بر اساس میزان جذب غلظتهای مختلف نمونه های وارد شده به دستگاه  رسم شد.

تست وسترن بلاتینگ: به محیط کشت حاوی 106 سلول THP-1 در ابتدا LPS به میزان 20ng/mL اضافه شد وسپس تحت درمان تجربی با پانیسیک اسید قرار گرفت. پس از درمان تجربی، کل سلولهای THP-1 لیز شده با استفاده از کیت استخراج پروتئین (Millipore, Billerica, MA, USA) و با توجه به دستورالعمل کارخانه سازنده تجزیه شدند. غلظت پروتئین با استفاده از یک پیرس BCA (کیت سنجش پروتئین )(حرارتی) تعیین شد. مقدار مساوی از پروتئین (30 میلی گرم) 10 درصد سدیم دودسیل سولفات پلی آکریل آمید ژل الکتروفورز (SDS-PAGE) جدا شده و به اضافه لومینسانس شیمیایی (ECL) به غشای نیتروسلولز (Amersham Biosciences, Piscataway, NJ, USA ) منتقل شدند. پس از مسدود کردن با 5 درصد BSA به مدت 2 ساعت، نابودی با آنتی بادی اولیه در 4 درجه به مدت 12 ساعت بررسی شد، آنتی بادی اولیه در برابر (IkBa و1: 400)، فسفات- IkBa  (P-IkBa) (1: 500)، MMP-1 (1: 400)، MMP-3 (1: 400) ، و سپس با آنتی بادی ثانویه ضد موش (1: 1000) به مدت 2 ساعت انکوبه شد. همه آنتی بادی از Santa Cruz (سانتا کروز، CA، USA) خریداری شده است. غشاها و فرآیندهای غشایی انجام گرفته سپس با آنتی بادی ثانویه مناسب برای 2 ساعت در دمای اتاق انکوبه شدند. ECL معرف (GE بهداشت و درمان) برای تشخیص پروتئین استفاده شده است. B-اکتین به عنوان کنترل داخلی استفاده شد. بیان نسبی هر یک از پروتئینهای تجزیه و تحلیل شده با کنترل مشخص شد. بر روی هر بلات نشان داده شده حداقل سه آزمایش مستقل مشابه انجام شد.

سنجش مهاجرت و تهاجم سلولی در شرایط آزمایشگاهی: مهاجرت سلولی در شرایط آزمایشگاهی با استفاده ازاتاقکهای ترانسول 6.5 میلی متر و با  منافذ 8 میکرومتر (Corning, NY, USA ) انجام شد. پانیسیک اسید به همراه 3000 سلول thp-1 در حفره های بالایی فیلتر قرار داده شد. محیط کشت بدون سرم با 1 میلی گرم / میلی لیتر LPS (Escherichia coli, strain 0128:B12, Sigma) به بخش پایین اتاقکها اضافه شد. به سلول اجازه مهاجرت به مدت 24 ساعت داده شد. پس از یک دوره کمون 24 ساعت در 37درجه سانتی گراد، سلولهایی که مهاجرت نکرده اند از سطح بالایی توسط سواب پنبه برداشته شد و فیلتر با کریستال ویوله رنگ آمیزی شد. سلولهایی که از طریق غشاء به سطح پایین تر مهاجرت کردند. در زیر میکروسکوپ (6100 بزرگنمایی) شمارش شدند. توانایی تهاجم همراه با استفاده از اتاقکهای تهاجم ماتریژل (BD Biosciences, Tokyo, Japan) با توجه به دستورالعمل کارخانه سازنده تعیین شده است. حفره های بالایی به تازگی با ماتریژل پوشش داده شدند و متوسط به اتاق پایین تر که در بالا توضیح داده شد، اضافه شده است. سلولهای THP-1 در محیط کشت حاوی 2 درصد FBS کشت معلق و به اتاقهای Transwell ماتریژل پیش انکوبه شد.  به سلولها برای مدت 24 ساعت اجازه تهاجم داده شد. سپس ژل و سلول سطح غشاء بالایی با سواب پنبه برداشته شد. سلولهایی که در پایین نفوذ کرده بود شمارش شد.

روش Real-Time واکنش زنجیره ای پلیمراز (qRTPCR): استخراج RNA با استفاده از  ترایزول و با توجه به پروتکل شرکت تولید کننده انجام شد. qRTPCR با استفاده از ABI PRISM 7900HT  و سوپراسکریپت TM III PlatinumH SYBRH و کیت یک مرحله ای  qRTPCR (Invitrogen, Carlsbad, CA, USA ) انجام شد. این واکنش در 94 درجه به مدت 2 دقیقه آغاز شده بود، و در دما 50 درجه برای 20 ثانیه به 20 ثانیه دناتوره شد سپس 72 درجه به مدت 45 ثانیه قرار گرفته و به پایان رسید. گلیسرآلدهید 3-فسفات دهیدروژناز (GAPDH) به عنوان کنترل داخلی برای تمام تجزیه و تحلیلها استفاده گردید. آغازگرپیشرو ومعکوس با استفاده از نرم افزار پرایمر اکسپرس (نسخه 2.0-PE Biosystems Applied) طراحی شد. توالی پرایمر های مورد استفاده در جدول 1 آورده شده است. چرخه آستانه (CT) برای کنترل درون زا GAPDH mRNA و سیگنالهای هدف، تعیین شد . وبه صورت نمودار رسم شد.

 

جدول 1- لیست پرایمرها (توالی نوکلوتیدی، نقطه ذوب پرایمرها

Tm

Reverse 5 ̀ to 3

Forward 5 ̀ to 3

Primer Name

Reverse

Forward

60.03

60.03

3´- CCACATCAGGCACTCCACAT -5

3-´ AGTGGCCCAGTGGTTGAAAA -5´

H.MMP-1

60.18

60.11

3´- GCTAAGCAGCAGCCCATTTG -5

3´- GATTGGAGGTGACGGGGAAG -5´

H.MMP-3

60.27

55.00

3´-TGGGTGTCGCTGTTGAAGTC-5´

3´- GCGCTCACTGTTCTCTCCCTC -5´

H. GAPDH

 


نتایج

نتایج تست MTT: بر اساس آزمون  MTTنتایج جذب نوری (OD) بر حسب غلظتهای 8 و 16 و 24 و 32 و 38 و 40 و 50 و 60 و 70 و 80 و 90 و 100 میکروگرم بر میلی لیترپانیسیک اسید روغن هسته انار در مقایسه با میزان بقای سلولی به صورت رسم نمودار پس از 24 و 48 و 72 ساعت به دست آمد. لازم به توضیح است بازه انتخابی غلظت پانیسیک اسید بر مبنای اثرات ضد سرطانی آن در مقالات مختلف و همچنین مطالعات اولیه صورت گرفته در آزمایشگاه بوده است. نمودار ها بیانگر درصد بقای سلولهای THP-1 بعد از تیمار با پانیسیک اسید با غلظتهای متفاوت (8تا100 میکروگرم بر میلی لیتر) می باشد. همان طور که در این شکل 1 مشاهده می کنید بیشترین درصد بقای سلول THP-1  در غلظت 8 میکروگرم بر میلی لیتر در24 ساعت و کمترین درصد بقای سلول THP-1 در غلظت 100 میکروگرم بر میلی لیتروبعداز 72 ساعت به دست آمده است (جدول 2). نمودار یک نشان می دهد LC50=50  میکروگرم بر میلی لیتر ( غلظتی از پانیسیک اسید روغن هسته انار که در آن 50 درصد سلولها در محیط کشت از بین می روند) می باشد.

نتایج نشان می دهد که طی سه روز، درصد بقای سلولهای  THP-1 در غلظتهای مختلف هر چقدر غلظت پانیسیک اسید بیشتر شده است، پایین تر آمده است (جدول 2). همچنین آنالیز آماری مربوط به نتایج همه داده ها P<0/05 را نشان می دهد که سطح معنی داری در نظر گرفته می شود. به عبارت دیگر پانیسیک اسید باعث اثر سیتوتوکسیتی یا ضد سرطانی در سلولهای THP-1 می شود که کمترین درصد بقای سلول THP-1 در زمان 72 ساعت و با غلظت 100 میکروگرم بر میلی لیتر به ثبت رسیده است.

 

 

نمودار 1- اثرات پانیسیک اسید روغن هسته انار بر درصد بقای سلولهای THP-1 سلولها با غلظتهای متفاوت ازپانیسیک اسید با فاصله های زمانی 48،24و72ساعت تیمار و میزان بقای با استفاده از تست MTT مورد ارزیابی قرار گرفت. نتایج به صورت میانگین سه تکرار مستقل ± خطای استاندارد نمایش داده شده است.

 

جدول 2- درصد بقاء سلولهای THP-1 بر اساس تست تریپان بلو و رقت های سریالی تهیه شده از پانیسیک اسید روغن هسته انار

غلظتها براساس میکروگرم

8

16

24

32

36

40

50

60

70

80

90

100

سلول زنده (درصد)

95%

89%

86%

84%

80%

70%

51%

34%

15%

10%

2%

0%

درصد سلول مرده

5%

11%

14%

16%

20%

30%

49%

66%

85%

90%

98%

100%

جدول 3- درصد بقاء سلولهای THP-1 از 24 ساعت تیمار، در گروه کنترل (سلول بدون اسانس)،کنترل منفی (متانول به عنوان حلال روغن )،و در حضور کنترل مثبت (داروی دگزامتازون وسلوکسیب)

سلول تنها (بدون اسانس)

کنترل منفی(متانول به عنوان حلال)

کنترل مثبت(دگزامتازون)

کنترل مثبت(سلوکسیب)

نوع تست

100±4/5

97/1±1/9

15/3±1/5

14/5±1/5

تریپان بلو

100±4/6

97/7±2/1

15/1±1/2

14/1±1/2

MTT

 

     

ج

ب

الف

شکل 1- تصویر میکروسکوپی از THP-1 به وسیله دوربین Labomade ivu 3100 ومیکروسکوپ  OLYMPUS تهیه شده است. شکل الف :بزرگنمایی10X است دو روز بعداز کشت اولیه می باشد.شکل ب : چهار روز بعداز کشت اولیه با بزرگنمایی20X می باشد که سلولهای به صورت اشکال گرد با هسته تیره رنگ می باشد و به صورت تجمع دیده می شود در این عکس تقسیم میتوز کاملاً مشخص می باشد. شکل ج: با بزرگنمایی 20X وپس از اضافه کردن پانیسیک اسید به محیط کشت گرفته شده است که دفرمه شدن سلولها مشخص می باشد.

عکس در آزمایشگاه کشت سلولی مرکز بیوتکنولوژی دانشگاه پیام نور با میکروسکوپ الکترونی انجام پذیرفته است.

 

 

نمودار 2- تغییراتMMP-1  در مقایسه با دگزا متازون و سلوکسیب

همان طور که در ( نمودار2) نشان داده شده است پانیسیک اسید برروی بیان ژن MMP-1 تأثیر داشته و از نظر آماری معنی دار می باشد. P<0.005

 

 

نمودار 3- تغییرات MMP-3 در مقایسه با دگزا متازون و سلوکسیب

 

در این دو نمودار (2 و 3) نشان داده شده است که 7 گروه شامل یک گروه کنترل فقط سلول تنها ویک گروه سلول به علاوه LPS ودگزامتازون ویک گروه سلول و  LPSوسلوکسیب و سه گروه هم با دز متوسط که کمتر از LC50 بدست آمده است (MLC50) معادل 32 میکروگرم بر میلی لیتر و یکی LC50 معادل 50 میکروگرم بر میلی لیتر ویکی دز برابر (HD)که معادل 100میکرو گرم بر میلی لیتر از پانیسیک اسید روغن هسته انار استفاده شده است. همان طور که نشان داده شده است پانیسیک اسید برروی بیان ژن MMP-3  تأثیر نداشته و از نظر آماری بی معنی می باشد P>0.005 (عکس 1و2).

 

 

عکس 1-  1= مارکر پروتئین55 کیلو دالتون، 2 – سلول + متانول + LPS، 3 – سلول + LPS +  دگزامتازون ، 4 = سلول + LPS+ پانیسیک اسید و5 – سلول و LPS وسلوکسیب

Protein molecular marker, SDS7, MW14.000-66.000 KD14.600/ 20/ 24/29/ 46/ 45/ 55 mKD

عکس بالا عکس ژل اصلی است به همراه نمونه های دیگرکه مربوط به این آزمایش می باشد

 

عکس 2- ژل MMP-3  به ترتیب ستون 1 پروتئن مولکولار مارکر و2- کنترل منفی ( سلول ومتانول و LPS ) و3 – سلول و پانیسیک اسیدوLPS و4 – کنترل مثبت (سلول وLPSودگزامتازون) و5 - کنترل مثبت (سلول وLPSوسلوکسیب)

Protein molecular marker, SDS7, MW14.000-66.000 KD .14.600/ 20/ 24/29/  46/ 45/ 55 mKD


بحث

در این بررسی با توجه به محدودیت تحقیقات قبلی و نیاز به بررسیهای بیشتر، به مطالعه اثر پانیسیک اسید روغن هسته انار برروی بیان ژن متالوپروتئینازهای یک و سه در سلولهایTHP-1 پرداخته شده است.  در این مطالعه ابتدا اثرات سایتوتوکسیک پانیسیک اسید روغن هسته انار بر حیات سلولهای THP-1 با استفاده از آزمون MTT مورد مطالعه قرار گرفت. آزمایشات MTT نشان داد که پانیسیک اسید روغن هسته انار قادر است رشد سلولها ی THP-1 را به خصوص در غلظتهای بالای 100 میکروگرم بر میلی لیتر مهار کند. همچنین LC50 پانیسیک اسید در حدود 50 میکروگرم بر میلی لیتر تعیین شد ( نمودار 1). سپس با استفاده از روش الایزا ووسترن بلاتینگ فعالیت پروتئینهای MMP-1,3 بررسی شد و همچنین با استفاده از روش مهاجرت وتهاجم سلولها اثر پانیسیک اسید روغن هسته انار بر روی سلولهای THP-1 بررسی شد.

استئوآرتریت شایع ترین شکل آرتریت و علت اصلی درد و ناتوانی در افراد مسن محسوب می شود و داروهای جانبی که جهت پیشگیری از درد وبهبود کیفیت زندگی به افراد دچار استئوارتریت داده می شود عوارض مختلفی را بر ارگانهای دیگر بدن دارد بنابراین در این مطالعه از داروهای گیاهی جهت کاهش عوامل التهابی استفاده گردید. ماتریکس متالوپروتئینازها (ماتریکسین ها) توسط سلولهای التهابی مانند ماکروفاژها، لنفوسیتها، نوتروفیلها و ائوزینوفیل ها و نیز توسط سلولهای ساختمانی مانند فیبروبلاستها، سلولهای اپی تلیال و اندوتلیال تولید می شوند. ماتریکسینها با از بین بردن پروتئینهای سطحی سلولها (عامل استحکام بین سلولها) باعث افزایش مهاجرت سلولهای اپیتلیال می شود (1و16). سایتوکینینها در سلولهای آسیب دید ه و هیپوکسی ویژگی بافتهای ملتهب مانند زخمها و تومورهاست که  منجر به القاء متالوپروتئینازها می شوند.

فعال شدن هیستأمینها یا سیتوکینهای پیش التهابی مثل انواع اینترلوکینها 1و IL-2 ،IL-6 ،IL-8 ،IL-12 عامل نکروزی تومور – (TNFα-β) اینترفرونهای آلفا و بتا وگاما (IFNα و  IFNγو IFNβ) و رادیکالهای آزاد مثل نیتریک اکساید، آغاز و با تحریک تولید انواع پروتئینازها، پراکسید هیدروژن، فسفولیپازها و... با هدف بیگانه خواری و شکستن بافتهای آسیب دیده می شود (12، 14، 15 و 23).

از بین شاخصهای التهابی مذکور بحث انواع پروتیئنازها به ویژه ماتریکس متالوپروتئینازها به عنوان خط مقدم و حلقۀ نهایی زنجیرۀ، (MMPS) طویل واکنش سلولهای دستگاه ایمنی و واسطه های التهابی و پاسخ آنها به پانیسیک اسید کاملاً جدید است وکمتر مطالعه ای روی آن صورت گرفته است. به همین جهت در این بررسی به مطالعه اثر پانیسیک اسید روغن هسته انار برروی بیان ژن متالوپروتئینازهای یک و سه پرداخته شده است.

مطالعات مختلفی راجع به اثرات انار برروی بیماریهای مختلف به خصوص سرطان(2) و برروی ماتریکس متالوپروتئینازها واستئوآرتریت انجام گرفته است از جمله تأثیر عصاره آبی پوسته انار بر تحریک تولید پروکلاژن نوع 1 و ممانعت از سنتزMMP-1 در فیبروبلاستهای پوستی مورد بررسی قرار گرفته شده بود که در این بررسی نیز اثرات پانیسیک اسید برروی بیان MMP-1 کاهش بیانی را نشان داد (6). در مطالعه ای دیگراثرات ضد التهابی ومحافظت از تجزیه کلاژن توسط پونیکالاجین و الاجیک اسید که از ترکیبات موجود در آب انار است را در مدل in vitro برروی سلولهای غضروف گاو بررسی کردند که هر دو پلی فنول انار با کاهش  MMP13  که توسط  1ß-IL  تحریک شده بود، از تجزیه کلاژن نوع دو ممانعت کردند ودر ادامه مطالعه دز بالای این ماده با اثر مثبت در موشهای مبتلا به آرتریت بررسی شد وهمین اثرات گزارش شد(21). اثر مکمل یاری آب انار  بر روی متالوپروتئینازهای ماتریکسی 2 و 9 نیز توسط مازنی وهمکارانش در سال 2014 بر روی  28 فرد سالم  18 تا 24 ساله مورد مطالعه قرار گرفت. شاخصهای استرس اکسیداتیو، hs-CRP ،  MMP2و  MMP 9 سرمی مورد بررسی قرار گرفت. میزان GPX ، SOD و آنتی اکسیدان تام سرمی در گروه مداخله بیشتر از گروه کنترل بود. میزان متالوپروتئینازهای ماتریکسی 2 و 9 ، سرولوپلاسمین و MDA سرمی نیز در گروه دریافت کننده آب انار به طور معنی داری کمتر از گروه کنترل بود.

هادی پور جهرمی و همکاران (2007) در یک مطالعه تجربی ،جهت بررسی اثر عصاره انار بر استئوآرتریت، از تزریق داخل مفصلی منویدواستات در مفصل تیبیوفمورال موش سوری وتجویز عصاره خوراکی میوه انار استفاده کرد، یافته ها، حاکی از ممانعت عصاره انار از آسیب کندروسیتی و تغییرات در پروتئوگلیکان به صورت وابسته به دز بود. صرف نظراز اثرات ضد التهابی، عصاره انار (احتمالاً به علت حضور پلی فنلها) قادر به مهار MMPs در کندروسیتها می باشد (3و17).  قوچانی و همکاران(2016) طی یک مداخله بالینی، اثرات آب انار را در وضعیت آنتی اکسیدانی، متالوپروتئیناز ها و علایم بالینی استئوآرتریت زانو بررسی کردند. نتایج مداخله حاکی از کاهش امتیاز پرسشنامه WOMAC، امتیاز سفتی مفصل و عملکرد فیزیکی بود. مقادیر سرمی MMP13 در گروه مکمل یاری شده کاهش و سطوح GPX افزایش یافت (28). رژیم غذایی شامل پانیسیک اسید همچنین باعث سرکوب NF-کاپا و کاهش بیان TNF-α، و تنظیم مثبت PPARα و بیان ژن پاسخ دهنده گیرنده گاما در عضله اسکلتی و بافت چربی می شود (19). بررسی کلی تحقیقات انجام شده در زمینه پانیسیک اسید و استئوآرتریت احتیاج به مطالعات بیشتر وبرروی سلولهای مختلف دارد با توجه به اثرات ضد التهابی اسیدهای چرب کونژوگه شده در این مطالعه تصمیم بر آن شد که اثر پانیسیک اسید را که اسید چرب کونژگه با اثرات قوی می باشد بر روی متالوپروتئینازهای یک وسه در بیماری استئوآرتریت بررسی گردد.

نتیجه گیری

در این تحقیق پانیسیک اسید اثر مهاری بر روی MMP-3 نداشت ( باتوجه به اینکه MMP-3 یک استرومیلیناز است در ماتریکس متالوپروتئناز تأثیری ندارد) ولی تاحدودی اثر برروی MMP-1 را نشان داد در ادامه بررسیهای بیشتر باید انجام گیرد تا اثر پانیسیک اسید روغن هسته انار برروی سایر متالو پرتئینازها صورت گیرد که اثرات قوی تری داشته و بتوان جایگزین داروهای مورد استفاده در استئوآرتریت ( دگزامتازون و سلوکسیب) قرار داد. این مطالعه به صورت invivo صورت گرفته است.

تقدیر و تشکر

تمام هزینه های این پژوهش توسط نویسنده مسئول تأمین شده است. نویسندگان مراتب سپاس و قدردانی خود را از ریاست محترم دانشگاه پیام نور واحد شهر ری به خاطر فراهم آوردن محیط آزمایشگاه برای انجام این تحقیق اعلام می دارند.

1- مجید متولی باشی، فاطمه کوه کن، زهره حجتی، 1392، نقش سلولهای بنیادی سرطانی در افزایش ریسک ابتلا به متاستاز وکاهش میزان بقای افراد مبتلا به سرطان پستان،مجله پژوهش های سلولی و مولکولی( مجله زیست شناسی ایران)،26-3-365-366

2- مجید تفریحی، روح الله نخعی سیستانی،1395، اثرعصاره استونی دانه اناربر بیان پروتئینهایB-catenin وE-cadherin در سلولهای سرطانی PC-3 ، مجله پژوهش های سلولی ومولکولی ( مجله زیست شناسی ایران) ، 29-1-48-55-56

3- Ahmed AF. Effect of sensorimotor training on balance in elderly patients with knee osteoarthritis. Journal of Advanced Research. 2011;2(4):305-11.

4- Anusree SS, Nisha VM, Priyanka A, Raghu KG. 2015. Insulin resistance byTNF-α is associated with mitochondrial dysfunction in 3T3-L1 adipocytesand is ameliorated by punicic acid, a PPARγ agonist. Mol Cell Endocrinol413:120–8.

5- Anusree SS, Priyanka A, Nisha VM, Das AA, Raghu KG. 2014. An in vitrostudy reveals the nutraceutical potential of punicic acid relevant to diabetesvia enhanced GLUT4 expression and adiponectin secretion. Food Funct5(10):2590–601.

6- Aslam MN, Lansky EP, and Varani J. Pomegranate as a cosmeceutical source: Pomegranate fractions promote proliferation and procollagen synthesis and inhibit matrix metalloproteinase-1 production in human skin cells. J Ethnopharmacol.2006; 103: 311–318.

7- Balbin, M., et al., Identification and enzymatic characterization of two diverging murine counterparts of human interstitial collagenase (MMP-1) expressed at sites of embryo implantation. J Biol Chem, 2001. 276(13): p. 10253-62.

8- Bassaganya-Riera J. 2011. Method of using punicic acid to enhance immuneresponse and prevent metabolic disorders. US patent No. 20110250231 A1

9- Bauer, E.A., A.Z. Eisen, and J.J. Jeffrey, Immunologic relationship of a purified human skin collagenase to other human and animal collagenases. Biochim Biophys Acta, 1970. 206(1): p. 152-60.

10- Chu, Q.S., et al., A phase II and pharmacological study of the matrix metalloproteinase inhibitor (MMPI) COL-3 in patients with advanced  soft tissue sarcomas. Invest New Drugs, 2007. 25(4): p. 359-67.

11- DeChellis DM, Cortazzo MH. Regenerative medicine in the field of pain medicine: Prolotherapy, platelet-rich plasma therapy, and stem cell therapy—Theory and evidence. Techniques in Regional Anesthesia and Pain Management 2011; 15 (2): 74-80.

12- Eli, Carmeli; Miri Moas, Shannon Lennon and Scott K Powers (2005). “High intensity exercise increasesexpression of matrix metallo proteinasses in fast skeletal muscle fibers”. Exp Physiol. 90.4: 613-619.

13- Felson DT, Lawrence RC, Dieppe PA, Hirsch R, Helmick CG, Jordan JM, et al. Osteoarthritis: new insights. Part 1:

14- Ferlito, S. (2000). “Physiological, Metabolic, Neuroendocrine and pharmacological regulation of NitricOxide in humans”. Minerva-Cardioangiol. 48(6): 169-76.

15- Graham, D. A.; E. J.W. Rush (2004). “Exercise Training tmprores dortic endo thelum dependentvasorelaxa and derminants of nitric oxide: bioavailability in spontaneously hypertensive rate”. J Applphysiol. 96. 2088-2096.

16- Gross, J. and C.M. Lapiere, Collagenolytic activity in amphibian tissues: a tissue culture assay. Proc Natl Acad Sci U S A, 1962. 48: p. 1014-22.

17- Hadipour M, Mozaffari R،2009 Chondroprotective effects of pomegranate juice on monoiodoacetate-induced osteoarthritis of the knee joint of mice .DOI: 10.1002/ptr.2880

18- Harandi A. [Textbook of orthopedics and fractures]. Tehran:Tehran University of Medical Sciences; 1382. [Persian]

19- Hontecillas R, O’Shea M, Einerhand A, Diguardo M, Bassaganya-Riera J. 2009. Activation of PPAR gamma and alpha by punicic acid ameliorates glucose tolerance and suppresses obesity-related inflammation. J Am College Nut 28:184–95.

20- Huang TL, Chang CC, Lee CH, Chen SC, Lai CH, Tsai CL. Intra-articular injections of sodium hyaluronate (Hyalgan (R)) in osteoarthritis of the knee. a randomized, controlled, double-blind, multicenter trial in the Asian population. BMC Musculoskelet Disord 2011; 12: 221. PubMed PMID: 21978211. Pubmed Central PMCID: 3203101.

21- Jing Y, Ciqin Z, Gaofeng Y, Duo L. 2012. Effects of geographical origin onthe conjugated linolenic acid of Trichosanthes kirilowii Maxim seed oil. JAm Oil Chem Soc 89:401–7.

22- Kyralan M, Goeluekcue M, Tokgoez H. 2009. Oil and conjugated linolenicacid contents of seeds from important pomegranate cultivars (Punicagranatum L.) grown in Turkey. J Am Oil Chem Soc 86:985–90.

23- Laurel T. Mackinon (1999). Advances in Exercise immunology. ISBN: 964-452-162-5.

24- Melo ILP, Carvalho EBT, Mancini-Filho J. 2014. Pomegranate seed oil(Punica granatum L.): a source of PA (conjugated α-linolenic acid). J HumanNut Food Sci 2:1024–34.

25- Mossova, I, Kotra LP, Fridman, R, Mobashery S. Matrix Metalloproteinases: structure, evolution and diversification. FASEB J 1998; 12: 1075-95.

26- Nagase H, Woessner JF. Matrix metalloproteinases. J Biol Chem 1999; 274: 21491-4.

27- Nagase, H., R. Visse, and G. Murphy, Structure and function of matrix metalloproteinases and TIMPs. Cardiovasc Res, 2006. 69(3): p. 562-73

28- Nasrin Ghoochani,a Majid Karandish,a*et.al. The effect of pomegranate juice on clinical signs,matrix metalloproteinases and antioxidant status in patients with knee osteoarthritis

29- Petersson IF, Boegard T, Saxne T, Silman AJ, Svensson B. Radiographic osteoarthritis of the knee classified by the Ahlback and Kellgren & Lawrence systems for the tibiofemoral joint in people aged 35-54 years with chronic knee pain. Ann Rheum Dis 1997; 56 (8): 493-6. PubMed PMID: 9306873. Pubmed Central PMCID: 1752423.

30- Roubille, C., Martel -Pelletier, J. & Pelletier, J. P. 2013. Osteoarthritis treatments: where do we stand at the moment? Medicographia, 35, 172-180.

31- Saha SS, Ghosh M. 2010. Ameliorative role of conjugated linolenic acidisomers against oxidative DNA damage induced by sodium arsenite in ratmodel. Food Chem Toxicol 48:3398–405.

32- Soetjipto H, Pradipta M, Timotius KH. 2010. Fatty acids composition of redand purple pomegranate (Punica granatum L) seed oil. Indonesian J CancerChemoprevention 1:74–7.

33- Spilmont M, Leotoing L, Davicco MJ, Lebecque P, Mercier S,Miot-Noirault E, Pilet P, Rios L, Wittrant Y, Coxam V. 2013.Pomegranate seed oil prevents bone loss in a mice model of osteoporosis,through osteoblastic stimulation, osteoclastic inhibition and decreasedinflammatory status. J Nut Biochem 24:1840–8.

34- Trelle, S., Reichenbach, S., Wandel, S., Hildebrand, P., Tschannen, B., Villiger, P. M., Egger, M. & Juni, P. 2011. Cardiovascular safety of non-steroidal anti-inflammatory drugs: network meta-analysis. BMJ, 342, c7086.

35- Verardo V, Garcia-Salas P, Baldi E, Antonio SC, Alberto FG, Maria FC.2014. Pomegranate seeds as a source of nutraceutical oil naturally rich inbioactive lipids. Food Res Int, http://dx.doi.org/10.1016/j.foodres,2014.04.04.

36- Wang L, Li W, Lin M, Garcia M, Mulholland D, Lilly M, Green MM. 2014.Luteolin, ellagic acid and punicic acid are natural products that inhibitprostate cancer metastasis. Carcinogenesis 35(10):2321–30.

37- Wang W, Wang H, Wang J, Ye S, Xiao S. 2013. Induction of apoptosis bypunicic acid in bladder carcinoma T24 cells. J Dalian Polytechnic Univ32:82–5.

38- Yun H.J., Yoo W.H., Han M.K., Lee Y.R., Kim J.S., Lee S.I. Epigallocatechin-3-gallate suppresses TNF-alpha-induced production of MMP-1 and −3 in rheumatoid arthritis synovial fibroblasts. Rheumatol. Int. 2008;29:23–29. [PubMed]