نوع مقاله: مقاله پژوهشی

نویسندگان

1 هیات علمی دانشگاه حکیم‌سبزواری ، دانشکده علوم پایه، گروه زیست شناسی

2 دانشجوی کارشناسی ارشد دانشگاه حکیم‌سبزواری ، دانشکده علوم پایه، گروه زیست شناسی

3 عضو هیات علمی دانشگاه حکیم سبزواری

چکیده

فاکتور IX بعنوان یک فاکتور انعقاد خون و وابسته به ویتامین K، برای عملکرد بیولوژیک خود نیاز به تغییرات پس از ترجمه از جمله گاماکربوکسیلاسیون دارد. گاماکربوکسیلاسیون توسط آنزیمی به نام گاماکربوکسیلاز کاتالیز می شود و پروپپتید پروتئین های وابسته به ویتامین K، اولین مکان شناسایی گاماکربوسیلاز می باشند. اسیدهای آمینه خاص در این توالی پروپپتیدی مسئول تفاوت تمایل آنزیم برای گاماکربوسیلاز هستند. هرچه میزان ثابت مهاری بیشتر شود تمایل آنزیم کم و پروتئین به طور کامل گاماکربوسیله می شود. مشخص شده است که در بین پروتئین های وابسته به ویتامین K، پروترومبین کمترین تمایل به آنزیم گاماکربوکسیلاز و در نتیجه بیشترین میزان گاماکربوسیلاسیون را دارد. لذا در این مطالعه سازه بیانی pMT-FIX-M واجد cDNA فاکتور IX جهش یافته در اسیدآمینه 13- (H به P) بر اساس پروپپتید پروترومبین ساخته شد. میزان بیان و فعالیت فاکتور IX نوترکیب جهش یافته و طبیعی در زمانهای مختلف بعد از ترانسفکشن توسط الایزا و انعقاد بررسی شد. نتایج نشان داد که غلظت و فعالیت فاکتور IX و در نتیجه گاماکربوکسیلاسیون فاکتور IX جهش یافته بیشتر از فاکتور IX طبیعی است.

کلیدواژه‌ها

موضوعات

عنوان مقاله [English]

Study of propeptide mutation effect on the human factor IX expression

نویسندگان [English]

  • Jafar Vatandoost 1
  • Shokoufeh Hasanabadi 2
  • Majid Momeni moghaddam 3

1 Hakim University

2 Hakim University

3 Hakim University

چکیده [English]

Factor IX as a vitamin K-dependent blood coagulation factor requires post-translational modifications such as gamma carboxylation for its biological function. Gamma carboxylation catalyzed by an enzyme called gamma carboxylase and propeptide of vitamin K dependent proteins is first recognition site of gamma carboxylase. Specific amino acids within these propeptide sequences are responsible for differences in affinity for the gamma carboxylase. Increases of Ki result in decrease of enzyme affinity but fully gamma carboxylation of protein. Since the gamma carboxylase enzyme have least affinity for prothrombin, in this study the pMT-FIX-M13 expression vector constructed contains mutant factor IX cDNA in amino acid -13 (H to P) on the basis of prothrombin propeptide. The expression and activity of the normal and mutant recombinant factor IX were investigated by ELISA and APTT after various times of transfection. The results showed that the concentrations and activity of factor IX and so gamma carboxylation in mutant factor IX is more than healthy factor IX.

کلیدواژه‌ها [English]

  • Coagulation factor IX
  • gamma carboxylase
  • propeptide
  • prothrombin

بررسی تأثیر جهش در ناحیه پروپپتید بر بیان فاکتور IX انسانی

شکوفه حسن آبادی، جعفر وطن‌دوست* و مجید مومنی مقدم 

سبزوار، دانشگاه حکیم‌سبزواری ، دانشکده علوم پایه، گروه زیست شناسی 

تاریخ دریافت: 5/10/94                تاریخ پذیرش: 17/5/95

چکیده

فاکتور IX به عنوان یک فاکتور انعقاد خون و وابسته به ویتامین K، برای عملکرد بیولوژیک خود نیاز به تغییرات پس از ترجمه از جمله گاماکربوکسیلاسیون دارد. گاماکربوکسیلاسیون توسط آنزیمی به نام گاماکربوکسیلاز کاتالیز می شود و پروپپتید پروتئینهای وابسته به ویتامین K، اولین مکان شناسایی گاماکربوسیلاز می باشند. اسیدهای آمینه خاص در این توالی پروپپتیدی مسئول تفاوت تمایل آنزیم برای گاماکربوسیلاز هستند. هرچه میزان ثابت مهاری بیشتر شود تمایل آنزیم کم و پروتئین به طور کامل گاماکربوسیله می شود. مشخص شده است که در بین پروتئینهای وابسته به ویتامین K، پروترومبین کمترین تمایل به آنزیم گاماکربوکسیلاز و در نتیجه بیشترین میزان گاماکربوسیلاسیون را دارد. لذا در این مطالعه سازه بیانی pMT-FIX-M واجد cDNA فاکتور IX جهش یافته در اسیدآمینه 13- (H به P) براساس پروپپتید پروترومبین ساخته شد. میزان بیان و فعالیت فاکتور IX نوترکیب جهش یافته و طبیعی در زمانهای مختلف بعد از ترانسفکشن توسط الایزا و انعقاد بررسی شد. نتایج نشان داد که غلظت و فعالیت فاکتور IX و در نتیجه گاماکربوکسیلاسیون فاکتور IX جهش یافته بیشتر از فاکتور IX طبیعی است.

واژه های کلیدی: فاکتورIX، گاما کربوکسیلاز، پروپپتید، پروترومبین

* نویسنده مسئول، تلفن: 05144013329 ، پست الکترونیکی: j.vatan@hsu.ac.ir

مقدمه

 

فاکتورIX انسانی یک فاکتور انعقاد خون است که نقص عملکردی یا فقدان ارثی آن باعث بیماری هموفیلی B (کریسمس) می شود (14). هرچند این بیماری روی مردان تأثیر می گذارد، اما زنان حامل آلل بیماری  با سطوح فعالیت فاکتور IX کاهش یافته نیز ممکن است برخی خونریزیها را تجربه کرده باشند (5). فاکتور IX بالغ گلیگوپروتئینی است تک زنجیره با طول 415 اسید آمینه و با وزن مولکولی حدود 57  کیلو دالتون که از پردازش پروتئین پیش ساز پری پرو فاکتور IX با 461 اسید آمینه حاصل می شود. این پروتئین پیش ساز دارای چندین ناحیه است که به ترتیب از انتهای آمینی به کربوکسی شامل ناحیه پری پپتید یا پپتید راهنما، ناحیه پروپپتید، ناحیه گلا (GLA)، نواحیهای شبه فاکتور رشد اپیدرمی (EGF)، ناحیه فعال سازی و ناحیه کاتالیتیکی است (2). توالی پری پپتید و پروپپتید با 46 اسید آمینه مشهور به پری پرولیدر‌می باشد که از اسید آمینه آرژنین واقع در موقعیت 1-  تا میتونین در موقعیت 46- را در برمی گیرد. بعد از حذف پری پرولیدر در سلولهای کبدی، فاکتور IX بالغ که به صورت زیموژن وارد جریان خون می‌شود، از اسید آمینه 1 (تیروزین) شروع و به اسید آمینه 415 خاتمه می‌یابد (19). زیموژن فاکتورIX در هنگام نیاز توسط فاکتور IXa یا VIIIa برش می خورد و به شکل دو زنجیره  فعال تبدیل می شود.

فاکتور IX همانند فاکتورهای انعقادیVII ، X، پروترومبین، پروتئین C، Z و S جزء پروتئینهای وابسته به ویتامین K (VKD) می باشند و برای عملکرد بیولوژیکی خود، نیاز به تغییرات پس از ترجمه از جمله گاماکربوکسیلاسیون دارند (18). پروپپتید در این پروتئینها در بر گیرنده توالی شناسایی آنزیم گاما کربوکسیلاز است و گاماکربوکسیلاز با اتصال به توالی پروپپتیدی 18 اسید آمینه ای روی پروتئینهای VKD، اسید گلوتامیکهای ویژه ناحیه گلا را به رزیدوهای گاما کربوکسی اسید گلوتامیک تبدیل می کند. پروپپتید نه تنها در اتصال سوبسترا به آنزیم واسطه است بلکه آنزیم را  فعال (12) و در بالا بردن کارآیی کربوکسیلاسیون نقش ایفاء می کنند (1). درواقع پروپپتید تغییرات فضایی خاصی را القاءء می کند تا فعالیت بیشتری را در جایگاه فعال کربوکسیلاز تثبیت کند. همچنین جهشهایی مانند جهش در اسیدآمینه 10- پروپپتید که باعث کاهش فعالیت آنزیم و در نتیجه کاهش فعالیت فاکتور IX می شوند می توانند منجر به مشکللات خونریزی دهنده و حساسیت به وارفارین شود (15).

آنالیز پروتئینهای پلاسمایی VKD  نشان می دهد که همگی مانند فاکتور IX  ابتدا به عنوان مولکولهای پیش ساز سنتز می شوند و شامل هر دوی توالی آب گریز پری و پروپپتید هستند. اگر چه توالی پری پپتید (سیگنال پپتید) در میان این پروتئینها متفاوت است، ولی همولوژی قابل توجهی در ناحیه پروپپتید دارند. پروپپتید تمام این پروتئینها شامل 2 جایگاه تشخیص می باشد (8)؛ یک جایگاه تشخیص گاما کربوکسیلاز برای کربوکسیلاسیون مستقیم این پروتئین ها در انتهای آمینی پروپپتید (10) و جایگاه تشخیص دوم که مربوط به پروپپتیداز است در انتهای کربوکسیلی قرار گرفته است. جایگاه شناسایی گاماکربوکسیلاز درون پروپپتید  بلافاصله مجاور سیگنال پپتید قرار گرفته است و این پروپپتید است که اتصال سوبسترا را به گاما کربوکسیلاز میانجی گری می کند. پروپپتید پروتئینهای VKD با وجود رزیدوهای حفاظت شده توالیهای مختلفی دارند که اتصال و فعالیت آنزیم را کنترل می کنند (8). فنیل آلانین  16-، آلانین 10-، آرژنین 4- و 1- تقربیاً غیر قابل تغییرهستند و رزیدوی 2- به طور کلی یک آرژنین یا لیزین است. آمینو اسید های آب گریز در رزیدو های 6- ، 7- و 17- نیز حفظ شده اند. سایر نواحی حفاظت نشده از جمله ناحیه 11- تا 15- می تواند بر تمایل سوبسترا به آنزیم اثر گذار باشد (17). درواقع اسیدهای آمینه خاص در توالی پروپپتیدی مسئول تفاوت تمایل برای گاما کربوکسیلاز هستند. پروپپتیدهایی که با میل و تمایل بالا به سوبسترا متصل می شوند در مقایسه با پروپپتیدهایی که با میل و تمایل کم یا متوسط متصل می شوند فعالیت گاما کربوکسیلازی کمتری دارند (3). به عبارت دیگر هرچه میزان ثابت مهاری (Inhibition constant / Ki) بالاتر برود تمایل برای آنزیم کم می شود و پروتئین به طور کامل گاماکربوکسیله می شود اما هرچه Ki کوچکتر شود تمایل برای آنزیم زیاد می شود و پروتئین به طور کامل گاماکربوکسیله نمی گردد (3). میزان Ki به ترتیب از کوچک به بزرگ عبارتند از فاکتور X، VII، پروتئین S، فاکتور X، پروتئین C، پروترومبین (جدول 1)(3).

 

جدول 1- همولوژی توالی ناحیه پروپپتید و میزان Ki در پروتئینهای وابسته به ویتامین k (17). پروترومبین بیشترین Ki و بنابراین کمترین تمایل به اتصال به آنزیم و بیشترین سرعت گاماکربوکسیلاسیون را دارد.

 

 

با توجه به اینکه Ki پروترومبین بیشتر از فاکتور IX می باشد لذا هدف از این تحقیق در این کار ایجاد جهشهای هدفمند در قسمت پروپپتید فاکتور IX براساس پروپپتید پروترومبین است تا شاهد کاهش میزان Ki و افزایش کربوکسیلاسیون در فاکتور IX باشد. از طرفی انتظار بر این است که افزایش کربوکسیلاسیون، میزان فاکتور IX فعال سنتز شده را افزایش دهد.

مواد و روشها

محیط کشت اشنایدر دروزوفیلایی و پنی سیلین/ استرپتومایسین از شرکت سیگما خریداری گردید. همه آنزیمهای مورد استفاده، کیت استخراج پلاسمید، کیت استخراج از ژل و مواد PCR از شرکت سیناژن خریداری شد. سلولهای دروزوفیلایی اشنایدر 2 (S2) از شرکت Invitrogen خریداری شد. 

از بانک اطلاعاتی NCBI  جهت دستیابی به توالی نوکلئوتیدی و پروتئینی  فاکتورهای انعقادی استفاده شد. رسم نمودارها و بررسی آماری مقادیر با استفاده از برنامه Excel انجام شد. برا ی بررسی توالیهای حاصل از تعیین توالی از برنامه های Blast و Chromas استفاده گردید. جهت طراحی پرایمرها از برنامه رایانه ای 3.4 Gene Runner  استفاده گردید (جدول 2) و به وسیله شرکت دنازیست سنتز شدند. از برنامه آنلاین  Restriction map viewer جهت بررسی نقشه هضم آنزیمی توالیها و به منظور ترسیم پلاسمیدها از برنامه Plasmid5 استفاده شد. برای بررسی آب گریزی از برنامه ExPASy-ProtScale استفاده شد.

 

جدول2- لیست پرایمر های استفاده شده برای تکثیر فاکتور IX واجد جهش

توالی پرایمر

نام پرایمر

5GGGGTACC CAAACAGCGCGTGAACATG3

KF1

5CCGCTCGAGAATCCATCTTTCATTAAGTGAGC3

XR2

5ACGCCAACAAAATTCTGAATC3

F2

5TTGTTGGCGTTTTCAGGATC3

RM13

 

همه آزمایشات در دو یا سه تکرار انجام شد و مقایسه میانگینها با استفاده از آنالیز واریانس (ANOVA) و آزمون دانکن در سطح 5 درصد انجام شد.

بررسی آب گریزی: برای بررسی میزان آب گریزی اسیدهای آمینه ناحیه پروپپتید از برنامه ExPASy-ProtScale استفاده شد.  ناحیه آب گریز نقش تعیین کننده ای در کارآیی پپتیدهای نشانه و انتقال پروتئین به سمت مسیر ترشحی دارد. از آنجایی که پروپپتید پروتئینهای انعقادی VKD باهم همولوژی دارند و در برخی نقاط حفاظت شده می باشند لذا به بررسی میزان آب گریزی پروپتپید تمام فاکتورهای انعقادی VKD مثل فاکتور X، VII، IX و پروترومبین پرداخته شد. در واقع آب گریزی این اسیدهای آمینه بر اساس معیار آب گریزی Kyte-Doolittle تعریف شده است. معیار Kyte-Doolittle به طور گسترده برای تشخیص نواحی آب گریز در پروتئینها استفاده می شود و نواحی با ارزش مثبت آب گریز می باشند.

تکثیر cDNA فاکتور IX واجد جهش با PCR و SOE-PCR: جهت ساخت  cDNAفاکتور  IX واجد جهش در ناحیه 13- پروپپتید از روش SOEing PCR و الگوی اولیه PMT-FIX  حاصل کار وطن دوست و همکاران (21) استفاده شد. در تمامی تکثیرها و ساخت قطعات نوترکیب، ابتدا تکثیر با آنزیمTaq  و پس از به دست آمدن شرایط بهینه، واکنش PCR با آنزیم Pfu انجام می شد. برای دستیابی به  فاکتورIX واجد جهش در ناحیه پروپپتید نیازمند دو قطعه بوده که قطعه A در برگیرنده توالی پری پرو فاکتورIX  (133جفت باز ) و قطعه B در برگیرنده ادامه توالی رمز کننده فاکتور IXانسانی (1292جفت باز) می باشد. قطعه A  با استفاده از جفت پرایمر KF1/M13 و قطعه B با استفاده از جفت پرایمر F2/XR2 تکثیر یافت. حجم مخلوط نهایی واکنش به  μL25 که شامل  Buffer A (1X )lµ5/2،(mM50( MgCl2 lµ5/1،(mM200) dNTP lµ5/1، lµ1 از هریک از پرایمر ها (10 pmol)، (ng PMT-FIX50) DNA lµ1 و lµ 5/0 آنزیم Pfu  پلیمراز (u 5/0) بود. نمونه ها برای تکثیر نهایی مطابق برنامه سیکل حرارتی، 4 دقیقه در 95 درجه سانتی گراد جهت واسرشت اولیه، 30 سیکل به صورت 3 دقیقه در 95 درجه، 30 ثانیه در 55 درجه، 1 یا 2 دقیقه به ترتیب برای قطعه A و B در 72 درجه و به منظور تکثیر نهایی 5 دقیقه در 72 درجه سانتی گراد قرار داده شد. محصول A و B به ترتیب بر روی ژل آگارز 1 درصد و 5/1 درصد در بافر TAE1X منتقل شدند.

PCR سوم در حضور دو الگوی A و B در دو مرحله انجام شد. در 5 چرخه اول به دلیل اینکه باید دو الگو همپوشان شوند دمای اتصال توالیهای مکمل این دو پرایمر (25 درجه سانتی گراد) به عنوان دمای اتصال در نظر گرفته شد و سپس در 30 چرخه بعدی PCR با اضافه کردن  پرایمرهای KF1/XR2 در دمای 60 درجه انجام گرفت. محصول حاصل بر روی ژل آگارز 1 درصد در بافرTAE1X  منتقل شد.

ساخت سازه pMT-hFIX.M13: برای ساخت سازه بیانی pMT-hFIX.M13، cDNA فاکتور IX باید با انتهاهای 5' Kpn I و 3' Xho I تکثیر گردد. بعد از تکثیر cDNA فاکتور IX جهش یافته با SOE-PCR، برش محصول SOE-PCR با آنزیمهای XhoI و KpnI، تخلیص از ژل و همچنین برش پلاسمید pMT-V5-His A با آنزیمهای XhoI و KpnI، عمل اتصال بین cDNA و پلاسمید pMT-V5-His A صورت گرفت که منجر به ساخت پلاسمید pMT-hFIX.M13 گردید. به دنبال ترانسفورم کردن باکتریهای مستعد Ecoli/DH5α به روش شوک حرارتی، کلنیهای مثبت با کلنی- PCR انتخاب شدند. پلاسمید حاوی فاکتور IX جهش یافته از کلنیهای مثبت استخراج و برای تأیید پلاسمید واکنش هضم آنزیمی برای آن انجام داده شد. همچنین برای تأیید کلونینگ و بررسی عدم وجود جهش در فاکتور IX کلون شده، این پلاسمید نوترکیب با استفاده از یک جفت پرایمر عمومی MT Forward و BGH-Reverse بر اساس روش سنگر توسط شرکت ژن فناوران تعیین توالی گردید.

کشت و تراآلایی سلولهای S2: کشت و تراآلایی سلولهای S2 طبق پروتکل شرکت Invitogen با کمی تغییرات انجام شد که قبلاً توسط وطن دوست و همکاران توضیح داده شده است (20 و 21).

ارزیابی بیان و فعالیت فاکتور IX نوترکیب: به منظور بررسی وجود فاکتور IX در محیط کشت سلولهای تراآلوده شده، محیط کشت سلولها در روزهای اول، دوم و سوم پس از افزودن ویتامین K1 (µg/ml5) (6 و 7) و القاء با سولفات مس (µg/ml500)، جمع آوری شد و پس از سانتریفیوژ، محلول رویی در 20- درجه سانتی گراد فریز گردید. آنتی ژن فاکتور IX نوترکیب انسانی بیان شده در محیط کشت سلولهای تراآلوده شده با روش ساندویچی الایزابر روی میکروپلیتها که با آنتی بادیهای پلی کلونال ضد فاکتور IX که در کیت الایزا مهیا شده بود آشکار شد. OD مشاهده شده نسبت مستقیم با غلظت فاکتور IX انسانی دارد و غلظت نمونه مجهول براساس نمونه استاندارد محاسبه می شود. براساس دستورالعمل کیت الایزا، نمودار استاندارد باید با استفاده از پلاسمای طبیعی سیتراته رسم گردد. برای رسم نمودار، پلاسمای طبیعی انسانی با رقتهای 50/1، 100/1، 200/1، 400/1 و 800/1 که به ترتیب نشان دهنده 100، 50، 25، 5/12و 25/6 درصد مقدار فاکتورIX در یک میلی لیتر پلاسمای طبیعی انسانی می باشد، تهیه شد. بر اساس میزان جذب مربوط به هر رقت از پلاسمای طبیعی انسانی در طول موج nm450 نمودار استاندارد الایزا رسم گردید.

از آزمایش APTT (Activated partial thromboplastine time) نیز برای بررسی فعالیت بیولوژیکی فاکتور IX در محیط کشت استفاده گردید. برای اندازه گیری میزان فعالیت انعقادی فاکتور IX از پلاسمایی استفاده می شود که واجد تمامی فاکتورهای لازم در این مسیر انعقادی بوده ولی فاقد فاکتور IX است. بنابراین زمان انعقاد این پلاسما در مقایسه با استاندارد طولانی بوده، ولی در صورت اضافه کردن نمونه مورد آزمایش به این پلاسما و وجود فاکتور IX در این نمونه مدت این زمان کاهش می یابد. در این روش از پلاسمای سیتراته افراد نرمال ( حدود 30 نفر) که با یکدیگر مخلوط گردیده بود به عنوان استاندارد استفاده گردید. فعالیت این فاکتور در پلاسمای این افراد که به نسبت 1 به 10 رقیق شده باشد  mU/ml 100 (100 درصد) در نظر گرفته می شود.

برای تعیین فعالیت بیولوژیک فاکتور IX بیان شده توسط سلولهای  تراآلوده شده100 میکرولیتر از محیط کشت جمع‌آوری شده از هر نمونه با100 میکرولیتر از پلاسمای فاقد فاکتور IX و 100 میکرولیتر از PTT فعال شده مخلوط و دقیقاً 3 دقیقه در درجه حرارت 37 درجه سانتی گراد قرار داده شد. سپس 100 میکرولیتر کلسیم کلرید mM 25 از قبل گرم شده در 37 درجه به آن اضافه و زمان انعقاد اندازه‌گیری گردید. فعالیت انعقادی هر نمونه بر اساس نمودار استاندارد تعیین شد (20 و 21). 

نتایج

بررسی آب گریزی:پس از اینکه به بررسی آب گریزی پروپپتید پروتئینهای انعقادی VKD بر اساس معیار آب گریزی Kyte-Doolittle پرداخته شد مشخص گردید که در برخی بنیانها مانند 1-، 4-، 6-، 10-، 11-، 12-، 16- و 17- میزان آب گریزی فاکتور IX با پروترومبین یکسان می باشد. در بین بنیانهای غیریکسان باقی مانده فقط بنیان 13- نظم خاصی را نشان می دهد (شکل 1).

 

 

شکل 1- مقایسه آب گریزی اسیدهای آمینه پروپپتید پروتئینهای انعقادی VKD بر اساس معیار آب گریزی Kyte-Doolittle. در برخی بنیانها میزان آب گریزی فاکتور IX با پروترومبین یکسان می باشد و در بین بنیانهای غیریکسان باقی مانده فقط بنیان 13- نظم خاصی را نشان می دهد.


تهیه و تکثیر cDNA فاکتور IX واجدجهشدرناحیهپروپپتید: با توجه به اینکه هدف ایجاد جهش در اسید امینه 13- پروپپتید فاکتور IX و تغییر اسید آمینه هیستیدین به پرولین بود لذا توالی رمز کننده فاکتور IX در دو قطعه همپوشان A و B با SOE-PCR تکثیر شد. قطعه A  در برگیرنده توالی پری پرو فاکتورIX  به طول bp 133 با استفاده از جفت پرایمر KF1 و M13 و قطعه B در برگیرنده ادامه توالی رمز کننده فاکتور IX انسانی به طول bp 1292 با جفت پرایمر 1292 F2 و XR2 از الگوی pMT-hFIX تکثیر شدند.  

دو محصول اولیه  Bو A توسط توالیهای مکمل که در انتهای پرایمرM13 و ابتدای پرایمر F2 است به یکدیگر متصل شدند لذا پس از انجام واکنش SOE قطعه 1419 جفت بازی حاصل از اتصال دو قطعه مورد انتظاراست که نتایج الکتروفورز محصولات حاکی از آن بود که قطعه مورد نظر ساخته شده است (شکل 2).

 

شکل2- الگوی الکتروفورزی محصولات PCR و SOE-PCR

ردیف1؛ قطعه A با 133 جفت باز، ردیف 2؛ قطعه B با 1292 جفت باز، ردیف 3؛ قطعه فاکتور IX جهش یافته با  1419 جفت باز، L- مارکر Kb1

ورود  cDNAفاکتور IX جهشیافته درون پلاسمید pMT/V5 – HisA: پس از تأیید کلنی صحیح با روش کلنی PCR، برای تأیید ساخت سازه pMT-hFIX.M13  و همسانه سازی فاکتور IX جهش یافته، هضم آنزیمی صورت گرفت. در هضم آنزیمی با Kpn1  و Xho1 انتطار می رفت فاکتور IX از پلاسمید خارج شده و قطعات حدود 1400 و 3500 جفت بازی مشاهده شود (شکل 3). پس از تأیید به روش هضم آنزیمی به منظور تأیید نهایی همسانه سازی، تعیین توالی پلاسمید نوترکیب  نیز نشان دهنده صحت کلونینگ، عدم وجود جهش در فاکتور IX و تغییر کدون اسیدآمینه 13- پروپپتید می باشد.

ارزیابی و بیان فاکتور IX نوترکیب: محیطهای کشت حاصل از ترانسفکشن سلولهای S2، در ساعتهای 24، 48 و 72 جمع آوری و برای آزمون انعقاد و الایزا مورد استفاده قرار گرفت. پس از بررسی و مقایسه فعالیت انعقادی فاکتور IX نوترکیب در محیط کشت سلولهای S2 ترانسفکت و القاء شده مشخص گردید که فعالیت فاکتور IX مترشحه از سلولهای ترانسفکت شده با PMT-FIX به ترتیب در سه بازه زمانی 24 ،48 و 72 ساعت 36، 62 و 119 mU/ml می باشد. در حالی که این مقادیر برای سلولهای ترانسفکت شده با PMT-FIX-M13 به ترتیب 55، 86 و 165می باشد (شکل 4).

 

شکل 3- نتایج حاصل از برش آنزیمی سازه pMT-hFIX-M13 و ایجاد قطعاتی با طول تقریبی 1400و3500 جفت باز (ردیف 1)، L: مارکر Kb1

آزمون t گروههای مستقل نشان داد که بین گروههای PMT-FIX و PMT-FIX-Mدر 72 ساعت اختلاف معناداری وجود دارد (05/0>P).

پس از نرمال سازی برحسب یک میلیون سلول، غلظت فاکتور IX مترشحه از سلولهای ترانسفکت شده با PMT-FIX به ترتیب در سه بازه زمانی 24 ،48 و 72 ساعت 204،  367 و 438ng/ml/106cell  می باشد. در حالی که این مقادیر برای سلولهای ترانسفکت شده با PMT-FIX-M به ترتیب 327، 425 و 525 ng/ml/106cell  می باشد (شکل 5). آزمون t گروههای مستقل برای الایزا نشان داد که بین گروههای PMT-FIX و PMT-FIX-M در هر سه بازه زمانی 24، 48 و 72 ساعت اختلاف معناداری وجود دارد (05/0>P) (شکل 5).

 

 

شکل 4- مقایسه فعالیت انعقادی فاکتور IX در سلولهای ترانسفکت شده FIX-PMT با PMT-FIX-M بر حسب mu/ml . ستاره نشان دهنده معنی داری نمونه ها در مقایسه با کنترل با استفاده از آنالیز واریانس است (0/05> P)

شکل 5- نمودار غلظت فاکتور IX با الایزا در سلولهای ترانسفکت شده FIX-PMT یا PMT-FIX-M بر حسب ng/ml/106cell . ستاره نشان دهنده معنی داری نمونه ها در مقایسه با کنترل با استفاده از آنالیز واریانس است (0/05> P)


بحث

از آنجایی که پروپپتید اولین ناحیه شناسایی کربوکسیلاز می‍باشد و پروپپتیدهای مختلف گرایشهای متفاوتی برای کربوکسیلاز دارند لذا یکی از راهکارهای افزایش بیان فاکتور IX، تغییر اسید آمینه های ناحیه پروپپتید براساس پروپپتید فاکتورهایی است که تمایل کمتری به آنزیم کربوکسیلاز دارند. در این راستا خورشیدی و همکاران ثابت کردند که جایگزینی توالی سیگنال و پروپپتید پروتئینهایVKD  با آنهایی که واکنش بهتری با آنزیم گاما کربوکسیلاز دارند اثر زیادی بر بیان پروتئینهای نوترکیب دارد (11). Camire و همکاران نیز ثابت کردند زمانی که در فاکتور X از پروپپتید پروترومبین استفاده می شود فاکتور X نوترکیب تقریباً به طور کامل و 50 برابر بیشتر گاماکربوکسیله می شود، لذا این فرضیه داده شد که پروپری پروترومبین سوبسترای بهتری برای آنزیم گاما کربوکسیلاز می باشد. از آنجایی که بر اساس جدول 1 آنزیم گاماکربوکسیلاز بیشترین تمایل و کمترین Ki را برای فاکتور X و کمترین تمایل و بیشترین Ki را برای پروترومبین دارد لذا این فرضیه تأیید می شود  که پروپپتید پروترومبین  سوبسترای بهتری برای آنزیم گاماکربوکسیلاز می باشد (3).

از طرفی بنا بر مطالعات Higgins-Gruber میزا ن Kd در پروتئینهای VKD از کوچک به بزرگ به ترتیب شامل فاکتور X، IX و پروترومبین است و هرچه Kd بیشتر باشد، محصول بیشتری تولید می شود، لذا جایگزینی پروپپتید پروترومبین باعث تولید محصول بیشتری می شود (8).

در فاکتور IX  و پروتئین C انسانی با کمک جهش زایی اختصاصی در مکان متوجه شدند فرمهایی که فاقد رزیدوهای 1- تا 18- بودند، کربوکسیله نشدند(22). Vermeer و همکارانش نیز مشخص کرده بودند که اسیدهای آمینه 11- تا 18- نقش مهمی در گاماکربوکسیلاسیون دارد و فقدان این نواحی باعث عدم گاماکربوکسیلاسیون و درنتیجه عدم فعالیت فاکتور IX می شود (22). از طرفی  Czerwiecو همکارانش نشان دادند که پپتیدی که شامل اسیدهای آمینه 1+ تا 18+ (فاقد پروپپتید) باشد، سوبسترای ضعیفی برای آنزیم گاما کربوکسیلاز است وKm  معادل با 8/1 را نشان می دهد. Km پایین یعنی زمان بسیار کم و یا غلظت بسیار کمی از سوبسترا برای رسیدن به نصف اشباع یا نصف سرعت ماکزیمم لازم است (4). افزودن اسیدهای 1- تا 8- (قسمت به شدت باردار پیش ماده ) Km را تقریباً 3 برابر کاهش داد در حالی که افزودن اسیدهای آمینه 1- تا 14- که شامل اسیدهای آمینه آب گریز بین موقعیت 8- و 14- بودند، Km را 45 برابر کاهش داد. پس اسیدهای آمینه آب گریز که در ناحیه پروپپتید قرار دارند از عناصر ساختاری مهم در جایگاه شناسایی گاما کربوکسیلاسیون هستند (4). پس هم باردار بودن هم آب گریزی در عملکرد پروپپتید تأثیر می گذارد.

نتایج براساس نمودار مقایسه ای میزان آب گریزیKyte-Doolittle (شکل 1) نشان می دهد که نواحی 11-، 12-، 15-، 16- و 17- در فاکتور IX و پروترومبین از نظر آب گریزی مشابه می باشند.از سه اسید آمینه باقی مانده یعنی 13-، 14- و 18- براساس نمودار آب گریزی پروتئینهای VKD در اسید آمینه 14- و 18- هم نظم خاصی وجود ندارد. از طرفیHuber و همکارانش در سال 1990 قبلاً نشان داده بودند که اسید آمینه 14- نقشی در کربوکسیلاسیون ندارد (9). همچنین نتایج آب گریزی نشان می دهد که هرچه میزان Ki بیشتر می شود میزان آب گریزی در اسید آمینه 13- پروتئینهای انعقادی بیشتر می شود. لذا انتظار بر این است که اگر اسیدآمینه هیستیدین در فاکتور IX با اسیدآمینه پرولین پروترومبین در جایگاه 13- جایگزین شود احتمال افزایش Ki، کاهش تمایل آنزیم گاماکربوکسیلاز به پروپپتید و افزایش کربوکسیلاسیون فاکتور IX وجود دارد.  

Vermeer و همکارانش نیز در 1990 نشان دادند که بار نیز در ناحیه پروپپتید تأثیر گذار می باشد اظهار داشتند که به طور قابل توجه ای 3 تا 5 رزیدو قبل از موقعیت 10- به مانند رزیدوی 9- و 8-  زنجیره جانبی قطبی و باردار می باشد (22). پس این احتمال وجود دارد که علاوه بر آب گریزی و نوع اسیدهای آمینه میزان بار چند اسیدآمینه کناری نیز در این ناحیه تأثیر گذار باشد. از طرفی به دلیل اینکه برآیند بار ناحیه 10- تا 16- در فاکتور IX ، 2- می باشد و لذا بار این ناحیه با پروترومبین متفاوت است احتمالاً اسیدهای آمینه باردار مجاور نیز مؤثر باشند. از طرفی Stanley و همکارانش در سال 1999 نشان داده اند که اگر در پروترومبین اسیدآمینه P→H تبدیل شود تأثیر چندانی در کربوکسیلاسیون ندارد این در تأیید نتایج این تحقیق اثبات می کند که اسیدهای آمینه دیگر نیز تأثیر گذارند (16).

نتایج ارزیابی فعالیت انعقادی و غلطت فاکتور IX جهش یافته به ترتیب 5/1 و 2/1 برابر بیشتر از فاکتور IX سالم است. این بدان معناست که تغییر اسیدآمینه 13-(H→P) با افزایش میزان آب گریزی از 2/3- به 6/1- (13) باعث افزایش Ki فاکتور IX، کاهش تمایل آنزیم به سوبسترا و افزایش گاماکربوکسیلاسیون شده است که منجر به افزایش میزان انعقاد و فعالیت فاکتور IX می گردد. از طرفی با افزایش Ki، مصرف سوبسترا در واحد زمان بیشتر صورت می گیرد لذا Kd نیز افزایش می یابد و باعث تولید بیشتر محصول می گردد که با نتایج الایزا مطابق است. نتایج با بررسی برآیند بار اسیدهای آمینه در ناحیه 10- تا 16- در فاکتور IX و پروترومبین نشان می دهد که برآیند بار به ترتیب 2- و صفر است. لذا هرچند تغییر اسیدآمینه 13- باعث افزایش فعالیت انعقادی و بیان فاکتور IX از طریق افزایش گاماکربوکسیلاسیون گردیده است، احتمالاً اسیدهای آمینه باردار مجاور نیز در بیان بیشتر تأثیر گذار بوده اند.

نتیجه گیری کلی

از آنجایی که تغییر اسیدآمینه 13- در پروپپتید فاکتور IX براساس پروپپتید پروترومبین باعث افزایش میزان فعالیت و بیان فاکتور IX در سلولهای حشرات شده است، لذا این نتیجه گرفته می شود که چون پروپپتید پروترومبین کمترین تمایل را به آنزیم گاماکربوکسیلاز دارد سوبسترای بهتری برای آنزیم گاماکربوسیلاز می باشد و تغییر پروپتتید فاکتور IX احتمالاً باعث افزایش میزان Ki آن شده و آن را به سوبسترای بهتری برای آنزیم گاماکربوسیلاز تبدیل کرده است که این به نوبه خود باعث گاماکربوسیلاسیون بیشتر فاکتور IX شده است. افزایش فعالیت و بیان فاکتور IX هم تأیید کننده این موضوع می باشد زیرا زمانی فاکتور IX فعال در سلول تولید می شود که فاکتور IX گاماکربوکسیله باشد.

هر چند روشهای جدید ژن درمانی هموفیلی امیدوار کننده است (23) اما در روش جایگیزین درمانی، بررسی روشهایی که منجر به تولید بیشتر با هزینه کمتر فاکتور IX نوترکیب شود یک ضرورت است. از آنجا که 70-80 درصد ازبیماران هموفیلی B در کشورهای در حال توسعه زندگی می کنند و با توجه به هزینه های بالای فاکتور IX نوترکیب و یا مشتق از پلاسما از درمان بازمانده اند به طوری که تا سال 2014 تنها 28000 از 140000 بیمار هموفیلی B در جهان به وسیله جایگزین درمانی فاکتور IX درمان شده اند (24). افزایش فعالیت و بیان فاکتور IX تولیدی در این مطالعه می تواند به بهبود روشهای تولیدی و کاهش هزینه تولید کمک مؤثری کند.

1.    Bandyopadhyay P, Clark K, Stevenson B, Rivier J, Olivera B, et al. 2006. Biochemical characterization of Drosophilaγ‐glutamyl carboxylase and its role in fly development. Insect mol biol 15:147-56.

2.    Bowen DJ. 2002. Haemophilia A and haemophilia B: molecular insights. Mol Pathol 55:127-44.

3.    Camire RM, Larson PJ, Stafford DW, High KA. 2000. Enhanced γ-carboxylation of recombinant factor X using a chimeric construct containing the prothrombin propeptide. Biochemistry 39:14322-9.

4.    Czerwiec E, Kalume DE, Roepstorff P, Hambe B, Furie B, et al. 2006. Novel γ‐carboxyglutamic acid‐containing peptides from the venom of Conus textile. FEBS Journal 273:2779-88.

5.    Goodeve A. 2015. Hemophilia B: molecular pathogenesis and mutation analysis. Journal of Thrombosis and Haemostasis 13:1184-95.

6.    Haddad Mashadrizeh A.A  ZA, Hosseini S. J, Sabouni. F. 2009. In silico investigation and synchronous application of introns 1 and 2 of human beta-globin to increase the expression of human coagulation Factor IX. . Iranian Journal of Biology 21:918.

7.    Haddad Mashadrizeh A.A.  ZA, Sabouni F , and Hemmat J.   . 2008. Analysis of the Non-Coding Region of the Human Factor VIII Gene in Comparison with Selected Regions of the Intron 1 of Human Factor IX Iranian journal of Biology 21:549.

8.    Higgins-Gruber SL, Mutucumarana VP, Lin P-J, Jorgenson JW, Stafford DW, Straight DL. 2010. Effect of vitamin K-dependent protein precursor propeptide, vitamin K hydroquinone, and glutamate substrate binding on the structure and function of γ-glutamyl carboxylase. J Biol Chem 285:31502-8.

9.    Huber P, Schmitz T, Griffin J, Jacobs M, Walsh C, et al. 1990. Identification of amino acids in the gamma-carboxylation recognition site on the propeptide of prothrombin. J Biol Chem 265:12467-73.

10.  Jorgensen MJ, Cantor AB, Furie BC, Brown CL, Shoemaker CB, Furie B. 1987. Recognition site directing vitamin K-dependent γ-carboxylation resides on the propeptide of factor IX. Cell 48:185-91.

11.  Khorshidi S, Zomorodipour A, Behmanesh M, Vatandoost J, Bos MH. 2015. Functional expression of the human coagulation factor IX using heterologous signal peptide and propeptide sequences in mammalian cell line. Biotechnol lett 37:1773-81.

12.  Knobloch JE, Suttie J. 1987. Vitamin K-dependent carboxylase. Control of enzyme activity by the" propeptide" region of factor X. J Biol Chem 262:15334-7.

13.  Kyte J, Doolittle RF. 1982. A simple method for displaying the hydropathic character of a protein. Journal of molecular biology 157:105-32.

14.  Orlova N, Kovnir S, Vorobiev I, Gabibov A. 2012. Coagulation factor IX for hemophilia B therapy. Acta naturae 4:62.

15.  Sekhri A, Lisinschi A, Furqan M, Palaniswamy C, Mukhi N, et al. 2014. The Conundrum of" Warfarin Hypersensitivity": Prolonged Partial Thromboplastin Time From Factor IX Propeptide Mutation. American journal of therapeutics.

16.  Stanley TB, Humphries J, High KA, Stafford DW. 1999. Amino acids responsible for reduced affinities of vitamin K-dependent propeptides for the carboxylase. Biochemistry 38:15681-7.

17.  Stanley TB, Jin D-Y, Lin P-J, Stafford DW. 1999. The propeptides of the vitamin K-dependent proteins possess different affinities for the vitamin K-dependent carboxylase. J Biol Chem 274:16940-4.

18.  Tie J-K, Zheng M-Y, Pope RM, Straight DL, Stafford DW. 2006. Identification of the N-linked glycosylation sites of vitamin K-dependent carboxylase and effect of glycosylation on carboxylase function. Biochemistry 45:14755-63.

19.  Tuddenham EDG, Cooper DN. 1994. Factor IX and haemophili B. In The Molecular Genetics of Haemostasis and its Inherited Disorders. Oxford University Press; New York, USA:87-111.

20.  Vatandoost J, Zomorodipour A. 2015. Optimization of transfection and stable expression of human factor IX in Drosophila S2 cells. Journal of cellular and molecular research 27:598-610.

21.  Vatandoost J, Zomorodipour A, Sadeghizadeh M, Aliyari R, Bos MH, Ataei F. 2012. Expression of biologically active human clotting factor IX in Drosophila S2 cells: γ‐carboxylation of a human vitamin K‐dependent protein by the insect enzyme. Biotechnol Progr 28:45-51.

22.  Vermeer C. 1990. Gamma-carboxyglutamate-containing proteins and the vitamin K-dependent carboxylase. Biochem J 266:625.

23.  Zhang R, Wang Q, Zhang L, Chen S. 2015. Optimized human factor IX expression cassettes for hepatic-directed gene therapy of hemophilia B. Frontiers of medicine 9:90-9.

24.  Zhao J, Xu W, Ross JW, Walters EM, Butler SP, et al. 2015. Engineering protein processing of the mammary gland to produce abundant hemophilia B therapy in milk. Scientific reports 5.