نوع مقاله: مقاله پژوهشی

نویسندگان

1 هیات علمی/پژوهشکده فناوری های نوین زیستی دانشگاه زنجان

2 هیات علمی/ دانشگاه زنجان

3 دانشجوی دکترا ژنتیک و اصلاح دام دانشگاه کشاورزی و منابع طبیعی ساری

4 دانشجوی دکتری بیوانفورماتیک دانشگاه تهران

چکیده

ژن FTO یک عامل رونویسی را کد می کند که در بیان ژن های مرتبط با سنتز چربی دخالت دارد. در مطالعه حاضر ارتباط چند شکلی در نواحی اگزون چهار و اگزون نه ژن FTO با صفات لاشه مورد بررسی قرار گرفت. بدین منظور 97 راس بره نر آمیخته افشاری × برولامرینو با سن تقریبا یکسان مورد استفاده قرار گرفتند. از تمام دام‌ها نمونه خون جهت استخراج DNA و اندازه‌گیری‌ فراسنجه‌های خون گرفته شد. آغازگرهای لازم برای نواحی اگزون چهار و اگزون نه که به ترتیب، قطعاتی به طول bp518 و bp 468 را تکثیر می‌کردند، طراحی گردیدند. جهت بررسی چند شکلی در نواحی یاد شده، ابتدا نواحی مورد نظر توسط PCR تکثیر و سپس محصولات به دست آمده پس از واسرشته‌سازی با استفاده از تکنیک SSCP و بارگذاری بر روی ژل اکریل آمید 10 درصد مورد ارزیابی قرار گرفتند. پس از تعیین ژنوتیپ در ناحیه اگزون چهار، سه ژنوتیپ AA، AB و AC و در ناحیه اگزون نه نیز دو گروه ژنوتیپی DD و DE مشاهده شدند که بین ژنوتیپ‌های این نواحی از لحاظ صفات لاشه و فراسنجه‌های خونی تفاوت معنی‌داری مشاهده نشد. برخلاف مطالعات پیشین، در مورد گوسفند، در پژوهش حاضر ارتباطی بین نواحی مورد مطالعه در ژن FTO و صفات چربی، وزن تولد و پیش از کشتار مشاهده نشد. برای ارزیابی جامع‌تر ارتباط این ژن با صفات مربوط به چربی لاشه در گوسفند تحقیقات بیشتری که در آن بخش‌های دیگر این ژن مورد بررسی قرار گیرد، لازم به نظر می‌رسد.

کلیدواژه‌ها

موضوعات

عنوان مقاله [English]

Evaluation of the Association of Polymorphism in FTO Gene with Carcass Traits and Blood Parameters in Afshari× Booroola Merino cross lambs

نویسندگان [English]

  • vahid salmani 1
  • mohammad taher Harkinezhad 2
  • Dariush Salimi 4

4 University of Tehran

چکیده [English]

FTO gene is a transcription factor in genes associated with synthesize of lipids. In the present study, we investigated the relationship between polymorphism in fourth and ninth exons of FTO gene with carcass traits. To do that, 97 male cross lambs (Afshari × Booroola Merino) of almost the same age were used. Blood samples were taken from all animals for DNA extraction and blood parameters were measured. Primers pairs for fourth exon and ninth exon were designed based on DNA sequences available for cow; the lengths of the target DNA were 518 and 468 bp respectively. Polymorphism in this area was identified using amplification of target DNA by PCR. Conformational differences were studied by denaturation and monitoring of the PCR products using SSCP technique and loading on 10 % acrylamide gel. In the fourth exon, three genotypes namely AB, AA and AC and in the ninth exon area two genotypes, DD and DE were observed. There was no significance difference observed between these genotypes in terms of carcass traits and blood parameters. Although in other species except sheep there is a relationship between allel of this gene and fat and obesity traits but was not found any relationship in studied area of this gene with fat traits, birth weight and weight before slaughter in sheep. However, to have a better conclusion about this gene and it’s relation with fat content of carcass in sheep further study with large number of samples and on other parts of this gene is necessary.

کلیدواژه‌ها [English]

  • Afshari× Booroola Merino cross lambs
  • FTO
  • carcass traits
  • Polymorphism
  • SSCP

ارزیابی ارتباط چندشکلی ژن FTO با صفات لاشه و فراسنجه­های خونی در بره­های آمیخته افشاری-برولا مرینو

وحید سلمانی1، محمد طاهر هرکی­نژاد2*، معصومه صالح3، مرادپاشا اسکندری نسب2 و داریوش سلیمی4

1 زنجان، دانشگاه زنجان، پژوهشکده فناوریهای نوین زیستی

2 زنجان، دانشگاه زنجان، گروه علوم دامی

3 ساری، دانشگاه ساری، گروه ژنتیک و اصلاح دام

4 تهران، دانشگاه تهران، گروه بیوانفورماتیک

تاریخ دریافت: 17/5/95                تاریخ پذیرش: 1/10/95

چکیده

ژن FTO یک عامل رونویسی را کد می کند که در بیان ژنهای مرتبط با سنتز چربی دخالت دارد. در مطالعه حاضر ارتباط چند شکلی در نواحی اگزون چهار و اگزون نه ژن FTO با صفات لاشه مورد بررسی قرار گرفت. بدین منظور 97 راس بره نر آمیخته افشاری × برولامرینو با سن تقریباً یکسان مورد استفاده قرار گرفتند. از تمام دامها نمونه خون جهت استخراج DNA و اندازه­گیری­ فراسنجه­های خون گرفته شد. آغازگرهای لازم برای نواحی اگزون چهار و اگزون نه که به ترتیب، قطعاتی به طول  bp518 و bp 468 را تکثیر می­کردند، طراحی گردیدند. جهت بررسی چند شکلی در نواحی یاد شده، ابتدا نواحی مورد نظر توسط PCR تکثیر و سپس محصولات به دست آمده پس از واسرشته­سازی با استفاده از تکنیک SSCP و بارگذاری بر روی ژل اکریل آمید 10 درصد مورد ارزیابی قرار گرفتند. پس از تعیین ژنوتیپ در ناحیه اگزون چهار، سه ژنوتیپ AA، AB و AC و در ناحیه اگزون نه نیز دو گروه ژنوتیپی DD و DE مشاهده شدند که بین ژنوتیپهای این نواحی از لحاظ صفات لاشه و فراسنجه­های خونی تفاوت معنی­داری مشاهده نشد. برخلاف مطالعات پیشین، در مورد گوسفند، در پژوهش حاضر ارتباطی بین نواحی مورد مطالعه در ژن FTO و صفات چربی، وزن تولد و پیش از کشتار مشاهده نشد با توجه به اینکه این پژوهش بر اساس گزارشاتی در مورد سایر موجودات بر روی اگزون چهار انجام شد، برای ارزیابی جامع­تر ارتباط این ژن با صفات مربوط به چربی لاشه در گوسفند تحقیقات بیشتری که در آن بخشهای دیگر این ژن مورد بررسی قرار گیرد، لازم به نظر می­رسد.

واژه های کلیدی: گوسفند افشاری، ژن FTO، صفات لاشه، چندشکلی، SSCP

* نویسنده مسئول، تلفن: 02433052230 ، پست الکترونیکی: Taher.harkinezhad@znu.ac.ir

مقدمه

 

بر طبق گزارش FAO (Food and Agriculture Organization) تولید سالیانه گوشت گوسفند در ایران حدود 300 هزار تن است که این مقدار 1/2 درصد گوشت گوسفند کل جهان را دارا می باشد (9). با وجود این سطح تولید گوشت گوسفند، همچنان نیاز مصرف کنندگان داخلی تأمین نمی­شود. استان زنجان با داشتن نژاد افشاری که نژادی سنگین وزن است از پتانسیل مناسبی برای تولید گوشت برخوردار است و نقش مهمی را درتأمین گوشت قرمز منطقه می­تواند ایفاء کند. با این وجود نژاد مورد بحث علی رغم همه محاسن خود همانند اغلب نژادهای سنگین وزن ایران دارای دنبه­ای بزرگ بوده که با کاهش تقاضای مصرف کنندگان و افزایش ضریب تبدیل مواد غذایی در لاشه روبرو شده که در نتیجه باعث کاهش درآمد و صرفه اقتصادی می­شود. ژنهای زیادی از جمله DGAT1،
Leptin ، FABP4 و... میزان چربی لاشه در گوسفند را کنترل می­کنند (1، 3، 24 و 28).

FTO یک ژن با طول بیش از  kb400 و ده اگزون است که در گوسفند بر روی کروموزوم 14 (Accession number: NC_019471.1) و در گاو بر روی کروموزوم 18 قرار گرفته است (35) .آنزیم  FTO یک عضو از خانواده دی­اکسیژنازهای بدون آهن و وابسته به 2-اکسوگلوتارات است که هومولوگDNA  دمتیلاز AlkB و ABH (هومولوگ AlkB پستانداران) است که این ژنها در بازسازی نوکلئوتیدهای آلکیله شده در DNA وRNA نقش دارند (18). این ژن برای اولین بار از یک موش جهش یافته با انگشتان ترکیب شده کلون شد (23). بررسیها نشان داده است که ژن FTO در انسان با چاقی مرتبط است. در مطالعه­ای بر روی یک جمعیت از اروپای شرقی رابطه rs17817449 (G>C) ژن FTO با چاقی و شاخص توده بدن (DMI) مورد تأیید قرار گرفته است (17).

مطالعات ژنتیکی که روی موش و انسان انجام شده، وجود جهشهایی در FTO را نشان داده که با چاقی در ارتباط است (17، 18 و 19). از مطالعات آزمایشگاهی چنین بر می­آید که احتمالاً FTO به عنوان یک دمتیلاز DNA تک رشته­ای عمل می­کند. علاوه بر این خاموش کردن هومولوگ نوترکیب FTO در موش منجر به عقب ماندگی رشد، از دست دادن بافت چربی سفید و افزایش متابولیسم انرژی گردیده است. علی رغم بررسیهای زیاد عملکرد حقیقی ژن FTO هنوز  ناشناخته است. در پژوهشی نشان داده شده است که بیان ژن FTO در بافت چربی و ماهیچه بیان بالاتری نسبت به بافتهای دیگر داشته و همچنین بیان این ژن در خوکهای با چربی بالا نسبت به خوکهای با چربی پایین، بالاتر بوده است و پیشنهاد شده که FTO اثر مثبتی بر ذخیره چربی دارا می­باشد (8 و 13). نقش FTO در بافت آدیپوز سفید نیز در مطالعات دیگری گزارش شده است از جمله مطالعه­ای که بر روی موشهای تغذیه­شده با جیره­های دارای چربی بالا انجام گرفته است (27). مباحث فوق نشان می­دهد یک ارتباط مهم بین FTO و چاقی و چربی وجود دارد. با این حال تا کنون گزارشی مبنی بر ارتباط این ژن با میزان چربی در گوسفند گزارش نشده است. با توجه به گزارشهایی از جمله فونتانزی و همکاران (2009) (10) که جهشی (AM931150) را در ناحیه اگزون چهار خوک یافتند که با صفات چاقی ارتباط معنی داری داشته است در این تحقیق نیز این ناحیه و همچنین اگزون نه به عنوان ناحیه­ای که مطالعه­ای روی آن انجام نشده در گوسفند مورد بررسی قرار گرفت (12). جهت شناسایی جهشهای احتمالی در نواحی مورد مطالعه در این تحقیق از تکنیک PCR-SSCP استفاده شد به دلیل اینکه این تکنیک نسبت به روشهای دیگر تعیین جهش، ساده، سریع و کم­هزینه است و در مطالعات بسیاری مورد استفاده قرار گرفته است (5، 26 و 29).

نمونه­های موجود در این پژوهش از بره­های آمیخته افشاری × برولامرینو اخذ گردید که در سال 1386 با انتقال ژن چند قلوزایی از گوسفند نژاد برولامرینو به نژاد افشاری ایجاد شده است. هدف کلی از این مطالعه بررسی چندشکلی ژن FTO در گوسفند آمیخته افشاری-برولامرینو و تأثیر آن بر صفات مرتبط با چربی می­باشد.

مواد و روشها

رکوردها و نمونه­های مختلف از تعداد 97 رأس بره نر آمیخته افشاری × برولامرینوس با سن (11 ماهگی) و همچنین شرایط یکسان از گله تحقیقاتی-آموزشی دانشگاه زنجان در سال 1394 جهت اجرای این تحقیق مورد استفاده قرار گرفت. داده­های جمع­آوری شده در این پژوهش به دو بخش قبل و بعد از کشتار تقسیم می­شوند. از گوسفندان مورد نظر خونگیری به عمل آمده و سپس از روش فنل کلروفرم جهت استخراج DNA استفاده شد. همچنین تعیین کمیت و کیفیت DNA توسط دستگاه نانودراپ انجام گرفت.

طراحی آغازگر: توالی ژنFTO  گوسفند در سایتهای بیولوژیکی موجود نمی­باشد. بنابراین برای طراحی آغازگر، از توالی موجود برای این ژن در پستاندارن دیگراستفاده گردید. به وسیله نرم افزار CLC Workbench آغاز گرهای مربوطه به صورت degenerate طراحی گردید. و BLAST برای بررسی اختصاصی بودن آغازگرها در گونه­ها مورد استفاده برای طراحی پرایمر استفاده شد. آغازگرها جهت سنتز به شرکت ماکروژن کره جنوبی ارسال گردید. مشخصات این آغازگرها در جدول (1) آورده شده­اند.

 

جدول 1- مشخصات آغازگرهای طراحی‌شده

دمای ذوب (TM)

ناحیه مورد تکثیر*

طول قطعه

توالی  آغازگر

نام آغازگر

C˚ 63

اگزون چهار و بخشی از اینترون چهار

bp518

F: AGGCCCTGAAGAGGAAAGYG

R: GCTGTTCCTGMGARGAAAC

FT4

C˚ 62

بخشی از اگزون نه

bp468

F: CCTCTGCCRTTTGAYCTC

R: GAAAGAGCAAAGTAGGTTAGG

FT9

F: آغازگر پیشرو و R: آغازگر پیرو. *: در متن عبارات FT4 و FT9 به ترتیب برای نواحی اگزون چهار (به همراه بخشی از اینترون چهار) و بخشی از اگزون نه به کار می­روند.


واکنش زنجیره­ای PCR: هر مخلوط واکنش (lµ 25) شامل 8 پیکو مول از هر آغازگر ، 100 نانوگرم DNA ژنومیک، IU 8/0 تک­پلیمراز (شرکت سیناژن)، lµ 1/0 تک بافرPCR، Mµ 200 از هر dNTP(شرکت سیناژن)،  mM2 MgCl2 و mM50 KCl می­باشد. چرخه­های دمایی برای آغازگر FT4، واسرشته­سازی اولیه به مدت پنج دقیقه و در دمای 95 درجه سانتی گراد، 30 سیکل به صورت یک دقیقه، یک دقیقه و 32 ثانیه به ترتیب در دماهای 95 درجه، 58 درجه و 72 درجه سانتی گراد با یک بسط نهایی در دمای 72 درجه به مدت پنج دقیقه انجام گردید. برای آغازگر FT9 شرایط همانند شرایط فوق بوده با این تفاوت که دمای اتصال برای این آغازگر 57 درجه سانتی گراد بود. سپس نمونه­ها جهت اطمینان از تکثیر باند مورد نظر بر روی ژل آگارز 5/1 درصد الکتروفورز شدند.

تکنیک SSCP: برای انجام روشSSCP 8 میکرولیتر از محصولات PCR با 8 میکرولیتر بافر بارگذاری مخلوط گردید. برای واسرشته کردن رشته ها ، نمونه ها به مدت 13 دقیقه در دمای 95 درجه سانتی گراد در دستگاه PCR قرار داده شدند. سپس بلافاصله نمونه ها در داخل یخ قرارگرفتند تا از اتصال مجدد رشته های مکمل جلوگیری شود. برای مشاهده ژنوتیپها از دستگاه الکتروفورز عمودی و از ژل اکریل آمید 10 درصد استفاده شد. برای این منظور 13 میکرولیتر از مخلوط محصول PCR و بافر بارگذاری در هر چاهک ریخته شد و با ولتاژ 150 به مدت 24 ساعت در دمای اتاق و با بافر ،TBE 1X الکتروفورز گردید. در نهایت برای مشاهده ژنوتیپها از روش رنگ آمیزی نیترات نقره استفاده شد.

روشهای آماری مورد استفاده در تجزیه و تحلیل داده­ها: در این تحقیق، احتمال برقراری تعادل هاردی- واینبرگ جمعیتهای مورد مطالعه بر اساس ژنوتیپهای به دست آمده با آزمون معمول مربع کای و توسط نرم­افزار Popgene آزمایش شد. تجزیه آماری داده­ها با استفاده از نرم­افزار SPSS 19 انجام شد. ابتدا کلیه داده­های به دست­آمده از صفات مربوطه و همچنین ژنوتیپهای تعیین شده در نرم­افزار اکسل وارد شد. با استفاده از نرم­افزار Server SQL داده­ها مرتب و جهت آنالیز در SPSS فراخوانی شد. به دلیل نامساوی بودن تعداد مشاهدات در زیر گروههای مختلف، آنالیز داده­ها با رویه GLM و میانگینها با آزمون دانکن مورد مقایسه قرار گرفتند. از وزن بره­ها به عنوان کوواریت در تجزیه و تحلیل داده­ها استفاده شد. که به دلیل معنی­دارنشدن از مدل حذف گردیدند. برای تجزیه آماری پارامترهای خونی و سایر صفات از مدلهای زیر استفاده شد.

معادله مدل آماری برای پارامترهای خونی: yij=m+Gi+eij

معادله  مدل آماری برای سایر صفات:

yijk=m+Gi+Kj+Dk+eijk

در این مدلها y صفت اندازه­گیری شده، G اثر ژنوتیپ، K اثر تیپ تولد، D اثر سن مادر و e خطای آزمایشی می­باشد.

 

نتایج و بحث

پس از انجام PCR و انجام الکتروفورز، همان طور که انتظار می­رفت در واکنش انجام شده با آغازگر FT4 ، قطعه 581 و با آغازگر FT9 قطعه 468 تکثیر گردید (شکل 1 ). همان طور که در شکل (2) مشاهده می­کنید باندها با اندازه و الگوهای متفاوتی بر روی ژلها قابل مشاهده بود. با بررسی کامل ژلها در مورد ناحیه FT4 همه دامها در سه گروه ژنوتیپی AA ،AB  و AC قرار گرفتند (شکل 2 (الف)). در مورد ناحیه FT9 دامها در دو گروه ژنوتیپی، DD و DE قرار گرفتند(شکل 2 (ب)). نتایج حاصل از تحلیل آماری جمعیت مورد بررسی و هتروزیگوسیتی ژنوتیپها در جدول 2 آورده شده است.

 

 

 

(ب)

شکل 1- (الف) باندهای مربوط به تکثیر ژن FTO با استفاده از آغازگر FT9 بر روی ژل آگارز 5/1 درصد. M: نشانگر DNA با فواصل 100 جفت باز، نمونه­های 1، 2، 3 و 4:  باندهای تکثیر شده با این آغازگر به طول 468  جفت باز. (ب) باندهای مربوط به تکثیر ژن FTO با استفاده از آغازگر FT4 بر روی ژل آگارز 5/1 درصد. M: نشانگر DNA با فواصل 100 جفت باز، نمونه­های 1، 2، 3 و 4 باندهای تکثیر شده با این آغازگر به طول 518  جفت باز و NC: کنترل منفی (به جای DNA از آب استفاده گردید).

 

 

 

شکل 2- (الف) نتایج حاصل از انجام SCCP بر روی فرآورده­های PCR   ناحیه FT4. (ب) نتایج حاصل از انجام SCCP بر روی فرآورده­های PCR   ناحیه FT9

جدول 2- فراوانی ژنوتیپی و هتروزیگوسیتی مشاهده شده در بره­های آمیخته

ژن

نواحی ژن

تعداد نمونه

ژنوتیپ

فراوانی ژنوتیپی

مشاهده شده

مورد انتظار

2/E(O-E)

FTO

FT4

97

AA

33/0

32

77/44

71/2

AB

53/0

51

08/34

39/8

AC

13/0

14

35/9

3/2

FT9

97

DD

45/0

44

13/51

99/0

DE

54/0

53

72/38

26/5


اثرژنوتیپهایFTO (FT4وFT9) برصفاتمختلفبره­هایآمیخته: وزن تولد و وزن زنده: نتایج حاصل از تجزیه واریانس وزن تولد و وزن زنده در زمان کشتار در جدول 3 آمده است.

 

جدول 3- تجزیه واریانس صفات وزن تولد و وزن زنده در بره­های آمیخته

نواحی ژن

صفت

منبع تغییرات

درجه آزادی

P value

S.E

 

FT4

وزن تولد

ژنوتیپ

2

     ns    83/0

18/0

وزن زنده

ژنوتیپ

2

     ns    48/0

2/2

 

FT9

وزن تولد

ژنوتیپ

1

      ns    97/0

14/0

وزن زنده

ژنوتیپ

1

        ns  06/0

52/1

          ns : تفاوت غیر معنی­دار، (05/0 P<)

 

بر طبق این نتایج اثر هیچ یک از ژنوتیپها بر این دو صفت در هر دو ناحیه معنی­دار نشد. به عبارت دیگر اللهای این ناحیه از این ژن تأثیری بر وزن در گوسفند افشاری ندارند. در پژوهشی که بر روی گاوهای سیمنتال در کشور اسلواکی انجام شد، جهش در اگزون دو ژن FTO، با وزن قبل کشتار، وزن لاشه و وزن گوشت در ارتباط بوده است (30) اما در مقابل ژانگ و همکاران در پژوهشی که بر روی خوکهای بومی چین انجام دادند، ارتباط معنی­داری بین   (1191 A>G) SNP و افزایش وزن روزانه مشاهده نکردند (36). لازم به ذکر است که در اگزون 2 این ژن در گوسفند تا کنون تنها یک SNP گزارش شده است که آن هم معنی دار نمی­باشد لذا در پژوهش حاضر این ناحیه از ژن مورد بررسی قرار نگرفت.

صفات بیومتری بره­های آمیخته: تعدادی از صفات بیومتری ظرفیت دام برای تولید گوشت را  نشان می دهند. صفات بیومتری اندازه­گیری شده در این پژوهش شامل ارتفاع جدوگاه، دور سینه، طول پشت، فاصله دوپا می­باشد. نتایج حاصل از تجزیه واریانس صفات بیومتری مربوط به گروه ژنوتیپی FT4 و FT9 درجدول 4 آورده شده است. در همه صفات اثر ژنوتیپ، سن مادر و نوع تولد به عنوان اثر ثابت در نظر گرفته شد. همان گونه که در جدول (4) نشان داده شده است در مورد نواحی FT4 و FT9 اثر ژنوتیپ بر روی صفات بیومتری معنی­دار نبود. البته این موضوع با توجه به اینکه این ژنوتیپها ارتباطی با وزن نداشتند نیز قابل پیش بینی بود و این مشاهدات همدیگر را تأیید می کنند.

در هیچ تحقیقی ارتباط بین ژن FTO با صفات بیومتری در حیوانات اهلی مورد بررسی قرار نگرفته است ولی در پژوهشهای متعدد بر روی حیوانات مزرعه­ای و جوامع انسانی ارتباط این ژن با خوراک مصرفی، هموستاز انرژی و بازده انرژی مشخص شده است، مطالعات زیر این مطلب را تأیید می­کنند.

 

 

جدول 4- تجزیه واریانس صفات بیومتری نواحی FT4 و FT9

نواحی ژن

صفات بیومتری

منبع تغییرات

درجه آزادی

P value

S.E 

 

 

FT4

ارتفاع جدوگاه

ژنوتیپ

2

ns27/0

73/0

دور سینه

ژنوتیپ

2

ns 85/0

8/1

پشت

ژنوتیپ

2

ns86/0

83/0

فاصله دو پا

ژنوتیپ

2

ns95/0

58/0

FT9

ارتفاع جدوگاه

ژنوتیپ

1

ns 43/0

6/0

دور سینه

ژنوتیپ

1

ns      15/0

44/1

طول پشت

ژنوتیپ

1

ns      91/0

64/0

فاصله دو پا

ژنوتیپ

1

ns      68/0

47/0

ns : تفاوت غیر معنی­دار، (05/0 P<)

 

در تحقیقی که توسط فان و همکاران (2009) بر روی خوک انجام شد، نشان داده شده است که SNP  (p.Ala. 198.Ala) در ژن FTO با مصرف خوراک ارتباط دارد (7). ارتباط SNP در اینترون یک و اگزون سه در ژن FTO با افزایش وزن روزانه در خوکهای آمیخته برکشایر × یورکشایر ثابت شده است. در پژوهشی بر روی موش نشان داده شده است که افزایش بیان ژن FTO باعث افزایش مصرف خوراک می­شود (6). بر طبق تحقیقات انجام شده در اروپا، ارتباط جهشهای این ژن با مصرف غذا به اثبات رسیده است (4 و 31). بنابراین انتظار می­رود این ژن با رشد حیوانات و در نتیجه صفات بیومتری در ارتباط باشد. آنچه در اینجا به دست آمده است نشان می­دهد چنین ارتباطی در نواحی بررسی شده با صفات اندازه گیری شده وجود ندارد. اما برای پاسخ گفتن مناسب در مورد این موضوع ضروری است که سایر قسمتهای این ژن در گوسفند مورد بررسی قرار گیرد.

پارامترهای خونی بره­های آمیخته: نتایج حاصل از تجزیه واریانس پارامترهای خونی مربوط به گروه ژنوتیپی نواحی FT4 وFT9 در جدول (5) آورده شده­اند. در هیچ یک از نواحی مورد بررسی ارتباط معنی داری بین ژنوتیپها  مشاهده نشد.

 

 

جدول 5- تجزیه واریانس پارامترهای خونی نواحی FT4 و FT9

نواحی ژن

پارامترهای خونی

منبع تغییرات

درجه آزادی

p value

S.E

FT4

تری گلیسرید

ژنوتیپ

2

ns37/0

52/1

کلسترول

ژنوتیپ

2

ns     24/0

53/2

HDL

ژنوتیپ

2

ns     62/0

2/1

LDL

ژنوتیپ

2

ns     17/0

05/3

VLDL

ژنوتیپ

2

ns37/0

3/0

FT9

تری گلیسرید

ژنوتیپ

1

ns    89/0

22/1

کلسترول

ژنوتیپ

1

ns     89/0

99/1

HDL

ژنوتیپ

1

ns     93/0

95/0

LDL

ژنوتیپ

1

ns     91/0

26/1

VLDL

ژنوتیپ

1

ns     89/0

24/0

                   ns : تفاوت غیر معنی­دار، (05/0 P<)

 

با توجه به این که ژن FTO یک فاکتور رونویسی در ژنهای مرتبط با سنتز چربی می­باشد و پروتئین کد شده توسط این ژن یک اگزوگلوتارات وابسته به دمیتلاز است که در فرآیند دمتیلاسیون در داخل هسته سلول نقش دارد، این ژن با تأثیر بر بیان ژنهای درگیر در سنتز چربی، می­تواند بر پارامترهای خونی مؤثر باشد. به طور مثال در تحقیقی که بر روی 4897 نفر مبتلا به دیابت نوع دو در اسکاتلند انجام شده است نشان داده شده که ژنوتیپهای ژن FTO مربوط به SNP (rs9939609) با پارامترهای خونی ارتباط دارند. الل A با LDL، HDL ، تری­گلسیرید بالا، شاخص آتروژنیک پلاسما (مقدار چربی ذخیره شده در دیواره سرخرگ) و شاخص توده بدن مرتبط است (15). اما به هر حال، در تحقیق دیگری که بر روی کودکان چاق در آلمان انجام شده است ارتباط معنی داری بین SNP (rs9939609) با پارامترهای خونی مشاهده نشده است (22). کرینگ و همکاران (2008) نیز با بررسی چاقی در 728 مرد جوان در دانمارک ارتباط ژنوتیپ AA با کاهش سطح HDL را گزارش کردند، ولی آنها با دیگر متابولیتهای مانند سطح کلسترول، تری­گلیسیرید، اسیدهای چرب آزاد ارتباط معنی داری مشاهده نکردند (20). همان طور که در بالا مشاهده می شود نتایج گزارش شده ضد و نقیض است و این موضوع می تواند به دلیل ارتباط این ژن با مکانیسمهای اپی ژنتیک باشد و چون تغییرات اپی ژنتیکی تحت تأثیر محیط هستند در نتیجه از محیطی به محیط دیگر تأثیر اللهای این ژن می تواند متفاوت باشد. به هر حال برای نشان دادن بهتر ارتباط این ژن با پروفیل چربی خون در حیوانات مزرعه  تحقیقات بیشتری لازم است انجام گیرد.

اثرژنوتیپهایFTOبرصفاتمختلفلاشه: نتایج حاصل از تجزیه واریانس اثر ژنوتیپهای نواحی FT4 و FT9  بر روی وزن لاشه، ضخامت چربی و ضخامت عضله لاشه در جدول (6) و برای صفات تفکیک لاشه در جدول (7) آورده شده است. با توجه به جداول ذیل تفاوت معنی­داری بین ژنوتیپها و صفات لاشه  مشاهده نشد.

چربی لاشه یک صفت کمی می­باشد و تحت تأثیر ژنهایی مانند FAS، DGAT1، LPLو بسیاری از ژنهای دیگر قرار می­گیرد (25 و 32) همچنین هورمونهای زیادی مانند لپتین، گلوکوکورتیکوئیدها، انسولین و فاکتور رشد شبه انسولین بر روی چربیها مؤثرهستند (16 و 21)، هر عاملی که بر بیان ژنهای درگیر در سنتز چربیها و ژنهای کد کننده هورمونهای مؤثر بر چربی اثر بگذارد، می­تواند چربی لاشه در حیوانات مزرعه­ای را تحت تأثیر قرار دهد. برخلاف این بررسی در تحقیق وی و همکاران (2011) بر روی ارتباط ژن FTO با صفات کیفی گوشت در گاوهای بومی چینی یک SNP ( C1071T) بر روی اگزون پنج این گاوها گزارش شده است و ژنوتیپ CT دارای میانگین بالاتری برای ضخامت چربی پشت نسبت به زنوتیپهای CC و TT بوده است (34). در گوسفند تا کنون SNP در این اگزون گزارش نشده است.  همچنین فونتانزی و همکاران (2008 و 2009) نشان دادند که در خوک جهش در ژن FTO (SNP c.594C>G) با ضخامت چربی پشت، چربی مرمری و درصد کل چربی در ماهیچه در ارتباط است (11 و 12). اسکوک و همکاران (2011) نیز نشان دادند که SNP (T>C)  واقع در اگزون دو ژن FTO با چربی لاشه در ارتباط است (30). در مقابل ژانگ و همکاران (2009) نشان دادند که SNP 1191 A>G در ژن FTO با چربی داخل ماهیچه­ای (ماربلینگ) در ارتباط است، ولی با چربی پشت و افزایش وزن روزانه در ارتباط نیست (37). البته در پژوهش دیگری ارتباط چندشکلی ژن تیروگلوبولین با ضخامت چربی پشت در نژاد مورد مطالعه گزارش شده است (2). با توجه به این که  چاقی یکی از مهم ترین عواملی است که بر روی سلامت انسان اثر می­گذارد، تحقیقات زیادی  بر روی ژن FTO  انجام شده است. در اکثر این پژوهشها، جهشها در نواحی مختلف این ژن با صفات چاقی مانند شاخص توده بدن، محیط کمر، وزن و چربی احشایی در اتباط بوده است (14، 15، 19، 20 و 36).

 

جدول 6- تجزیه واریانس صفات اندازه­گیری شده در کشتارگاه برای بره­های آمیخته

نواحی ژن

صفت

منبع تغییرات

درجه آزادی

F value

S.E

FT4

ضخامت چربی لاشه

ژنوتیپ

2

ns 65/0

1/0

ضخامت عضله لاشه

ژنوتیپ

2

ns 68/0

09/0

وزن لاشه

ژنوتیپ

2

ns16/0

006/1

FT9

ضخامت چربی لاشه

ژنوتیپ

1

ns  43/0

095/0

ضخامت عضله لاشه

ژنوتیپ

1

ns36/0

075/0

 

وزن لاشه

ژنوتیپ

1

 ns13/0

74/0

                  ns : تفاوت غیر معنی­دار، (05/0 P<)

جدول 7- نتایج تجزیه واریانس تفکیک لاشه نواحی FT4 و FT9

نواحی ژن

صفت

منبع تغییرات

درجه آزادی

p value

S.E

FT4

ران

ژنوتیپ

2

ns  14/0

32/0

سردست

ژنوتیپ

2

ns 09/0

24/0

گردن

ژنوتیپ

2

ns    12/0

11/0

قلوه­گاه

ژنوتیپ

2

ns  22/0

21/0

راسته

ژنوتیپ

2

ns  74/0

19/0

دنبه

ژنوتیپ

2

ns   49/0

14/0

ضایعات

ژنوتیپ

2

ns   2/0

07/0

FT9

ران

ژنوتیپ

1

ns 054/0

24/0

سردست

ژنوتیپ

1

ns   16/0

19/0

گردن

ژنوتیپ

1

ns   87/0

08/0

قلوه­گاه

ژنوتیپ

1

ns    12/0

17/0

راسته

ژنوتیپ

1

ns   45/0

15/0

دنبه

ژنوتیپ

1

ns    41/0

1/0

ضایعات

ژنوتیپ

1

ns     61/0

06/0

           ns : تفاوت غیر معنی­دار، (05/0 P<)

 

با توجه به تحقیقات ذکر شده و نقش ژن FTO در سنتز بافت چربی، هر گونه جهش بر روی توالی DNA این ژن، ممکن است بر فعالیت این ژن مؤثر باشد و در نتیجه  سنتز بافت چربی را تحت تأثیر قرار دهد. بنابراین انرژی دریافت شده توسط دام ممکن است در جهت سنتز دیگر ترکیبات لاشه مانند پروتئین مورد استفاده قرار ­گیرد. وی و همکاران (2010) در بررسی که بر روی پنج نژاد گاو بومی چینی انجام دادند، سه ژنوتیپ در SNP (C1071T) بر روی اگزون پنج گاو به روش SSCP-PCR ، شناسایی نموده و گزارش کردند که دامهای با ژنوتیپ CC یا CT ماهیچه راسته بیشتری از ژنوتیپ TT داشتند (34).  تیواری و همکاران (2012) اظهار داشتند که بیان ژن FTO در کبد و ماهیچه اسکلتی جوجه­های گوشتی در هفته هشتم نسبت به هفته چهارم بیشتر است و همچنین پیشنهاد کردند که این ژن با متابولیسم انرژی در جوجه­های گوشتی مرتبط است (33). در تحقیقات مختلفی که در کشورهای پیشرفته بر روی جوامع انسانی انجام شده نشان می­دهد که جهشهای مختلف در ژن FTO با صفاتی مانند توده بدن، محیط بازو، کمر و ران در ارتباط است (20). برخلاف تحقیق حاضر این پژوهشها نشان می­دهد که این ژن می­تواند با صفاتی مانند وزن ران، سردست، راسته، دنبه، ضایعات و دیگر صفات لاشه در ارتباط باشد.

نتیجه­گیری کلی

الکتروفورز محصولات تک رشته ای PCR بر روی ژل اکریل آمید، درناحیه تکثیر شده با آغازگر FT4 سه الگوی باندی و با آغازگر FT9 دو الگوی باندی را نشان دادند. آنالیز کلیه صفات اندازه­گیری شده نشان داد بر خلاف گزارشات مربوط به این ژن در سایر  موجودات چند شکلی در محصولات آغازگر های FT4 و FT9 ژن FTO با هیچ یک از صفات اندازه­گیری شده در این نژاد از گوسفند در ارتباط نمی­باشد. البته در این مورد لازم است سایر اگزونها نیز مورد بررسی قرار گیرد و نیز داده های مربوط به بیان ژن و نیز اطلاعات اپی ژنتیکی نیز بررسی گردد تا در مورد این ژن در گوسفند و به ویژه در این نژاد بتوان اظهار نظر بهتری داشت. با توجه به پژوهشهای صورت گرفته در رابطه با این ژن که نشان­دهنده ارتباط ژن FTO با صفات چاقی در انسان و صفات لاشه در حیوانات مزرعه­ای غیر از گوسفند است.  برای مشخص شدن بهتر ارتباط این ژن با صفات لاشه و پارامترهای خونی در گوسفند لازم است تحقیقات بیشتری در مورد سایر قسمتهای این ژن با تعداد نمونه بیشتر انجام گیرد.

1- سلیمانپور، ا. حجتی، ز. و نصر اصفهانی، م. ح. 1393. شناسایی موتاسیون در اگزون­های 13 و 23 و بخشی از اینترون 12 از ژن jhdm2a در انسان و ارتباط آن با ناباروری مردان. مجله­ی پژوهش­های سلولی و مولکولی. ص 242 تا 251. 27: 2.

2- نظام­آبادی، م. هرکی­نژاد، ط. شهیر، م. ح. خرمتایی، ر. اسکندری­نسب، م. پ. دانش­مقدم، ل. رستم­خانی، ر. 1394. ارتباط پلی­مورفیسم 5UTR ژن تیروگلوبولین با خصوصیات لاشه در بره­های آمیخته افشاری× برولا مرینو. مجله­ی پژوهش­های سلولی و مولکولی. ص 420 تا 429. 28: 3.

 

3- AlaNoshahr,F.Rafat.A.2014.  Polymorphism of DGAT1 Gene and Its Relationshi with Carcass Weight and Dressing Percentage in Moghani Sheep Breed. Iranian Journal of Applied Animal Science 4(2), 331-334

4- Cecil, J. E. Tavendale, R. Watt, P. Hetherington, M. M. and Palmer, C. N. A. 2008. An Obesity-Associated FTO Gene Variant and Increased Energy Intake in Children. The new england Journal of Medicine. 359: 2558-2566.

5- Chu M. X., Xiao1, C. T. Fu Y., Fang L. and Ye S. C. 2007. PCR-SSCP Polymorphism of Inhibin βA Gene in Some Sheep Breeds. Journal of Animal Science. Vol. 20, No. 7 : 1023 – 1029

6- Church, C. Moir, L. McMurray, F. Girard, C. Banks, G. T. Teboul, L. Wells, S. Bruning, J. C. Nolan, P. M. Ashcroft, F. M. and Cox, R. D. 2010. Overexpression of Fto leads to increased food intake and results in obesity. Journal of Nature Genetics. 42: 1086–1092.

7- Fan, B. Du, Z. Q. and Rothschild, M. F. 2008. The fat mass and obesity-associated (FTO) gene is associated with intramuscular fat content and growth rate in the pig. Journal of Animal biotechnology. 20: 58-70.

8- Fan, B. Lkhagvador, S. Cai, W. Young, J. Smith, R. M. Dekkers, C. M.  Huff-Lonergan, E.  Lonergan, S. M. and Rothschild, M. F. 2009. Identification of genetic markers associated with residual feed intake and meat quality traits in the pig. Journal of Meat Science. 84: 645–650.

9- FAO.org. Food Outlook 2014, biannual report on global food markets.

10- Fontanesi, L. Scotti, E. Buttazzoni, L. Dall’Olio, S. Bagnato, A. Pietro, D. Fiego, L. Davoli, R. and Russo, V. 2009. Confirmed association between a single nucleotide polymorphism in the FTO gene and obesity-related traits in heavy pigs. Journal of Springer Science + Business Media. 37: 461–466.

11- Fontanesi, L. Scotti, E. Buttazzoni, L. Davoli, R. and Russo, V. 2008. The porcine fat mass and obesity associated (FTO) gene is associated with fat deposition in Italian Duroc pigs. Journal of Animal Genetics. 10: 1365-2052.

12- Fontanesi, L. Scotti, E. Buttazzoni, L. Davoli, R. and Russo, V. 2009. The porcine fat mass and obesity associated (FTO) gene is associated with fat deposition in Italian Duroc pig. Journal of Animal Genetics. 40: 90–93.

13- Fu, Y. Li, L and Ren, S. 2013. Effect of FTO Expression and Polymorphism on Fat Deposition in Suzhong Pigs. Journal of Animal Science. Vol. 26, No. 10 : 1365-1373.

14- González-Sánchez, J. L. Zabena, C. Martínez-Larrad, M. T. Martínez-Calatrava, M. J. Pérez-Barba, M. and Serrano-Ríos, M. 2009. Variant rs9939609 in the FTO gene is associated with obesity in an adult population from Spain. Journal of Clinical Endocrinology. 70: 390-393.

15- Haupt, A. Thamer, C. Machann, J. Kirchhoff, K. Stefan, N. Tschritter, O. Machicao, F. Schick, F. Häring, H and Fritsche, A. 2008. Impact of Variation in the FTO Gene on Whole Body Fat Distribution, Ectopic Fat, and Weight Loss. Journal of Obesity. 16: 1969–1972.

16- Holzenberger, M. Hamard, G. Zaoui, R. Leneuve, P. Ducos, B. Beccavin, C. Perin, L. and LeBouc, Y. 2001. Experimental IGF-I receptor deficiency generates a sexually dimorphic pattern of organ-specific growth deficits in mice, affecting fat tissue in particular. Journal of Endocrinology. 142: 4469-4478.

17- Hubacek, J. A. Bohuslavova, R. Kuthanova, L. Kubinova, R. Peasey, A. Pikhart, H. Marmot, M. G. and Bobak, M. 2008. The FTO Gene and Obesity in a Large Eastern European Population Sample: The HAPIEE Study. Journal of Obesity.16: 2764–2766.

18- Jiaa, G.Yanga, C. Yanga, S. Jiana, X. Yia, C. Zhoub, Z. and Hea, C. 2008. Oxidative demethylation of 3-methylthymine and 3-methyluracil in single-stranded DNA and RNA by mouse and human FTO. Journal of Federation of European Biochemical Societies. 582: 3313–3319.

19- Kaakinen, M. Läärä, E. Pouta, A. Hartikainen, A. Laitinen, J. Tammelin, T. H. Herzig, K. Sovio, U. Bennett, A. J. Peltoneny, L. McCarthy, M. I. Elliott, P. De Stavola, B. and Järvelin, M. 2010. Life-Course Analysis of a Fat Mass and Obesity-Associated (FTO) Gene Variant and Body Mass Index in the Northern Finland Birth Cohort 1966 Using Structural Equation Modeling. American Journal of Epidemiology. 172: 653–665.

20- Kring, S. I. I. Holst, C. Zimmermann, E. Jess, T. Berentzen, T. Toubro, S. Hansen, T. Astrup, A. Pedersen, O. Sørensen, T. I. A.  2008. FTO Gene Associated Fatness in Relation to Body FatDistribution and Metabolic Traits throughout a Broad Range of Fatness. Journal of PLoS ONE. 3: 1-7.

21- Macfarlane, D. P. Forbes, S. and Walker, B. R. 2008. Glucocorticoids and fatty acid metabolism in humans: fuelling fat redistribution in the metabolic syndrome. Journal of Endocrinology. 197: 189–204.

22- Müller, T. D. Hinney, A. Scherag, A. Nguyen, T. T. Schreiner, F. Schäfer, H. Hebebrand, J. Roth, C. L. and Reinehr, T. 2008. Fat mass and obesity associated' gene (FTO): no significant association of variant rs9939609 with weight loss in a lifestyle intervention and lipid metabolism markers in German obese children and adolescents. Journal of BMC Medical Genetics. 9: 85-91.

23- Peters T, Ausmeier K, Ruther U (1999) Cloning of Fatso (Fto), a novel gene deleted by the Fused toes (Ft) mouse mutation. Mamm Genome 10: 983–986.

24- Q.L. Xu, G.W. Tang, Q.L. Zhang, Y.K. Huang, Y.X. Liu, K. Quan, K.Y. Zhu, C.X. Zhang.2011. The FABP4 gene polymorphism is associated with meat tenderness in three Chinese native sheep breeds. Czech J. Anim. Sci., 56, (1): 1–6

25- Ranganathan, G. Unal, R. Pokrovskaya, I. Yao-Borengasser, A. Phanavanh, B. Lecka-Czernik, B. Rasouli, N and Kern, P. A. 2006. The lipogenic enzymes DGAT1, FAS, and LPL in adipose tissue: effects of obesity, insulin resistance, and TZD treatment. Journal of Lipid Research. 47: 2444-2450.

26- Ranjbari M., Hashemi A., Mardani K., and Darvishzadeh R. 2012. Allelic Polymorphism of Makoei Sheep Calpastatin Gene Identified by Polymerase Chain Reaction and Single Strand Conformation Polymorphism. Journal of Agriculture Science Technology. Vol. 14: 533-538.

27- Ronkainen J, Tuija J. Huusko, Raija Soininen, Eleonora Mondini, Francesca Cinti, Kari A. Ma¨kela¨et al. 2015. Fat mass- and obesity-associated gene Fto affects the dietary response in mouse white adipose tissue. Journal of Scientific Reports. 5:9233.

28- Shojaei,m.  Mohammad Abadi*,mr.  Asadi Fozi,m. Dayani,o. Khezri,a and Masoumeh,a.2010. Association of growth trait and Leptin gene polymorphism in Kermani sheep. Journal of Cell and Molecular Research 2 (1), 67-73

29- Simsek S., Ozcetin C., and Balkaya I. 2012. Detection of polymorphism in AgB1 gene from sheep, cattle and human isolates of echinococcus granulosus by SSCP. Journal of Veterinary Parasitology 184 (2012) 352– 355.

30- Skok, D. J. Kunej, T. Rencelj, A. Razpet, A. Dovc, P. Žgur, S. Petric, N. Planinc, M. Malovrh, S. Kovac, M. and Horvat, S. 2011. Use of SNP Markers Within the Fat Mass and Obesity-associated (FTO) Gene to Verify Pedigrees and Determine Haplotypes in Paternal Half-sib Families of Slovenian Simmental Cattle. Journal of Agriculturae Conspectus Scientificus. 4: 333-336.

31- Speakman, J. R. Rance, K. A. and Johnstone, A. M. Polymorphisms of the FTO Gene Are Associated With Variation in Energy Intake, but not Energy Expenditure. Journal of Obesity. 8: 1961-1965.

32- Tantia, M. Vijh, R. Mishra, B. Mishra, B. Kumar, S. T. and Sodhi, M. 2006. DGAT1 and ABCG2 polymorphism in Indian cattle (Bos indicus) and buffalo (Bubalus bubalis) breeds. Journal of BMC Veterinary Research. 2: 1-5.

33- Tiwari, A. Krzysik-Walker, S. M. and Ramachandran, R. 2012. Cloning and characterization of chicken fat mass and obesity associated (Fto) gene: fasting affects Fto expression. Journal of Domestic Animal Endocrinology. 42: 1-10.

34- Wei, S. Zan, L. Javed Ahmed Ujan, J. A. Wang, H. Yang, Y and Adoligbe, C. 2011. Novel polymorphism of the bovine fat mass and obesity-associated (FTO) gene are related to backfat thickness and longissimus muscle area in five Chinese native cattle breeds. African Journal of Biotechnology. 10(15): 2820-2824.

35- Zhang, B. Zhang, Y. Zhang, L. Wang, J. Li, Z. and Chen, H. 2011. Allelic Polymorphism Detected in the Bovine FTO Gene. Journal of Molecular Biotechnology. 49: 257–262.

36- Zhang, G. Karns, R. Nina Smolej Narancic, N. S. Guangyun Sun, G. Cheng, H. Sasa Missoni, S. Durakovic, Z. Rudan, P. Chakraborty, R. Deka, R. 2010. Common SNPs in FTO Gene Are Associated with Obesity Related Anthropometric Traits in an Island Population from the Eastern Adriatic Coast of Croatia. Journal of PLoS ONE. 5: 1-9.

37- Zhang, L. Miao, X. Hua, X. Jiang, X. Lu, Y. and Xu, N. 2009. Polymorphism in 5 ` Regulatory Region of the Porcine Fat Mass and Obesity Associated (FTO) Gene is Associated with Intramuscular Fat Content in a Jinhua x Pietrain F(2) Reference Population. Journal of Animal and Veterinary Advances. 11: 2329-2334.