نوع مقاله: مقاله پژوهشی

نویسندگان

1 دانش آموخته کارشناسی ارشد دانشگاه پیام نور تهران شرق

2 دانشیار گروه بیوتکنولوژی کشاورزی دانشگاه پیام نور تهران

3 دکتری بیماری شناسی گیاهی وزارت جهاد کشاورزی، معاونت زراعت

چکیده

با گسترش فعالیت قارچ‌های بیمارگر در گیاهان زراعی، انجام مطالعات دقیق را در بحث کنترل آفات و بیماری‌های گیاهی، مهم و ضروری به نظر می‌رسد. شانکر ساقه گوجه‌فرنگی که در اثر فعالیت قارچ Alternaria alternata f. sp. lycopersici ایجاد می‌شود‌، از مهم‌ترین بیماری‌های گوجه‌فرنگی در ایران است. این قارچ فیتوتوکسینی بنام AAL-toxins تولید می‌کند که بازدارنده بیوسنتز اسفنگولیپد در گیاه میزبان بوده و باعث شانکر ساقه می‌شود. مقاومت در برابر پاتوژن و عدم حساسیت به توکسین، توسط جایگاه ژنی ASC1 در گیاه میزبان کنترل می‌شود. پروتئین حاصل از بیان این ژن، قادر به سم زدایی AAL-Toxin است. این تحقیق با هدف ردیابی این ژن در34 ژنوتایپ مهم مورد استفاده در ایران انجام شد. پس از ساخت آغازگر مناسب برای ردیابی ژن دخیل در مقاومت گوجه فرنگی به بیماری شانکر ساقه و این ژن طی واکنش PCRدر ارقام مورد آزمایش ردیابی گردید. سپس محصول PCR توالی‌یابی شده و نتیجه سکوئنس نشان داد که باند ایجاد شده مربوط به ژن مورد نظر می-باشد که از بین ژنوتایپ‌های مورد آزمایش ارقام کال جیN3، اکسیر فلات،VF Early urbana ، اوان، هیبریدps515، CHفلات، متین، Bonny Bost، هیبرید ایون، دارای ژن ASC-1بودند و برای اولین بار در ایران با روش‌های مولکولی به عنوان ژنوتایپ‌های دارای ژن مقاوم به شانکر ساقه برای مطالعات بعدی معرفی شدند.

کلیدواژه‌ها

عنوان مقاله [English]

Molecular detection of tomato Resistance gene to stem canker disease caused by alternata Alternaria

نویسندگان [English]

  • Khadijeh Pirifard 1
  • Mohammad Ali Ebrahimi 2
  • Saeedeh Pirayesh 3

1 Payame Noor University

2 Payame Noor University

3 Ministry of Agriculture Jihad, Agriculture Dep. Tehran, I.R. of Iran

چکیده [English]

Abstract
The spread pathogenic fungi activity in crop plants, detailed studies on the control of pests and plant diseases, is considered essential. Tomato stem canker caused by Alternaria alternata f. sp. lycopersici created the most important diseases of tomato in Iran. This pathogen produces phytotoxin called AAL-toxins that is sphingolipid biosynthesis inhibitor in host plants, causing stem canker. Resistance against pathogens and lack of sensitivity to the toxin, by the gene in the host plant is controlled ASC1. The protein product of this gene, is able to detoxify AAL-Toxin.

Therefore, this study aimed to detect canker disease resistance gene in 34 major genotypes used in Iran. PCR products were sequenced the sequencer result showed that the gene is reproduced.

That the genotype of the cultivars Cal Jay N3, Elixir plateau, VF Early urbana, Evan, hybrid ps515, CH Plateau, Matin, Bonny Bost, hybrid ion, had ASC1 gene. Resistant genotypes to stem canker were identified by molecular methods for the first time in Iran for further study.

کلیدواژه‌ها [English]

  • Resistant varieties
  • Alternaria alternata
  • Stem canker
  • Tomato

رد­یابی مولکولی ژن مقاومت ژنوتیپهای گوجه فرنگی نسبت به بیماری شانکر ساقه ناشی از قارچ Alternata alternaria

خدیجه پیری فرد1، محمد علی ابراهیمی1* و سعیده پیرایش2

1 تهران، دانشگاه پیام نور، گروه بیوتکنولوژی کشاورزی

2 تهران، وزارت جهاد کشاورزی، معاونت زراعت

تاریخ دریافت: 2/5/95                  تاریخ پذیرش: 28/9/95

چکیده

با گسترش فعالیت قارچهای بیمارگر در گیاهان زراعی، انجام مطالعات دقیق را در بحث کنترل آفات و بیماریهای گیاهی، مهم و ضروری به نظر می­رسد. شانکر ساقه گوجه­فرنگی که در اثر فعالیت قارچAlternaria alternata f. sp. lycopersici ایجاد می­شود­، از مهم­ترین بیماریهای گوجه­فرنگی در ایران است. این قارچ فیتوتوکسینی بنام AAL-toxins تولید می­کند که بازدارنده بیوسنتز اسفنگولیپد در گیاه میزبان بوده و باعث شانکر ساقه می­شود. مقاومت در برابر پاتوژن و عدم حساسیت به توکسین، توسط جایگاه ژنی ASC1  در گیاه میزبان کنترل می­شود. پروتئین حاصل از بیان این ژن، قادر به سم زدایی AAL-Toxin است. این تحقیق با هدف ردیابی این ژن در34 ژنوتیپ مهم مورد استفاده در ایران انجام شد. پس از ساخت آغازگر مناسب برای ردیابی ژن دخیل در مقاومت گوجه فرنگی به بیماری شانکر ساقه و این ژن طی واکنش  PCRدر ارقام مورد آزمایش ردیابی گردید. سپس محصول PCR توالی­یابی شده و نتیجه سکوئنس نشان داد که باند ایجاد شده مربوط به ژن مورد نظر می­باشد که از بین ژنوتیپهای مورد آزمایش ارقام کال جیN3، اکسیر فلات،VF Early urbana ، اوان، هیبریدps515، CH فلات، متین، Bonny Bost، هیبرید ایون، دارای ژن ASC-1بودند و برای اولین بار در ایران با روشهای مولکولی به عنوان ژنوتیپهای دارای ژن مقاوم به شانکر ساقه برای مطالعات بعدی معرفی شدند.

واژه های کلیدی: ارقام مقاوم، Alternaria alternata ، شانکرساقه،گوجه فرنگی

* نویسنده مسئول، تلفن: 02122442041 ، پست الکترونیکی:ma_ebrahimi@pnu.ac.ir

مقدمه

 

با توجه به افزایش میزان کاشت گوجه­فرنگی در کشور، انجام مطالعات دقیق در بحث کنترل آفات و بیماریهای گیاهی مهم و ضروری است، از بیماریهای مهم گوجه­فرنگی بیماری شانکر ساقه گوجه فرنگی که اولین بار در کالیفرنیای آمریکای جنوبی گزارش شده است. عامل بیماری قارچ  Alternaria alternata f. sp. lycopersici می­باشد که علائم آن به صورت زخمهای روی ساقه و لکه­های بیضوی مایل به سیاه درطوقه، ساقه و شاخه­های گیاه در برگها و میوه­ها به صورت لکه­های نکروز دیده می­شود. بررسی (12) جدایه­های مختلف قارچ به وضوح نشان داد کهA. alternata   پاتوژن اولیه می­باشد و در این قارچ سمی به نام AAL-toxins  تولید می­شود که باز دارنده بیوسنتز اسفنگولیپد در گیاه میزبان  بوده و باعث شانکر ساقه و از بین رفتن گونه­های حساس گوجه فرنگی می­شود. فیتوتوکسین AAL-toxins اولین بار توسط بوتینی و همکاران در سال 1981 از قارچlycopersici  alternata f. sp.Alternaria  جدا شد. این توکسین دارای دو بخش TB و TAاست که بخش سمی TAآن به عنوان دو استر از یک آمینوفنیل ١٩ کربن و تریو کربوکسیلات شناخته شده و بخش TB شبیه به بخش سمی TAبوده و در یک گروه کربوکسیل روی آمینوفنیل متفاوت می­باشد. در واقع این توکسین جزء توکسینهای میزبان اختصاصی می­باشد ­(8). مطالعات انجام شده بر روی جمعیتهای در حال تفرق برای ردیابی ژنهای مقاومت به این بیماری نشان داده که بیماری شانکر ساقه گوجه­فرنگی در نسلهای در حال تفرق انجام شده است همچنین نشان داده که یک ژن غالب کنترل کننده این بیماری بوده که توسط دانشمندی به نام بارون با کمک مارکر MAS بنام ASC1 شناسایی و توالی­یابی شد به طوری که این ژن بر روی بازوی بلند کروموزوم 3 قرار دارد. مقاومت در برابر پاتوژن و عدم حساسیت به توکسین توسط جایگاه ژنی ASC1 کنترل می­شود ­(3 و 9). در سایر مطالعات انجام شده وراثت پذیری مقاومت به عامل بیماریزای A. alternataمورد بررسی قرار گرفته و مشخص شده که این بیماری روی ارقام خاصی از گوجه فرنگی خسارت­زا است و ژنوتیپهای مختلف دارای طیف وسیعی از واکنش نسبت به این بیماری می­باشد (1). تا آنجا در تحقیق مشابهی، وجود اختلاف معنی­دار بین ژنوتیپهای گوجه­فرنگی نسبت به بیماری شانکر ساقه گوجه­فرنگی مشخص شد که از نظر صفات بیماری برخی ژنوتیپها کاملاً مقاوم و برخی ژنوتیپها حساس­، تعدادی از ژنوتیپها مقاومت نسبی به بیماری دارند­ (16). همچنین درجه پاسخ متفاوت به A. alternata  با هجده رقم گوجه­فرنگی، برای ارزیابی احتمال دخالت فعالیت پروتئاز و پراکسیداز از نتایج قابل ملاحظه­ای ­(6) و نیز بررسی واکنش مقاومت و یا حساسیت شش رقم گوجه­فرنگی نسبت به بیماری شانکر ساقه با عامل A. alternata f. sp. Lycopersici  (8) مورد بررسی قرار گرفت. حال با توجه به اینکه این بررسیها عمدتاً با روشهای تست بیماریزایی انجام شده است ­(5 و 14) بررسی تنوع ژنتیکی عامل بیماری با استفاده از تکنیکهای مولکولی و مارکرهای مبتنی بر  PCRاز جمله RAPD (15) و بررسی رابطه فیلوژنتیکی عامل بیماری نیز با روشهای مبتنی بر  PCR نیز با RAPD (11 و 13) نشان داد. که شناسایی ارقام مقاوم با روشهای جدید مولکولی اغلب دارای دقت بالاتر و نیازمند زمان کمتری است، در این تحقیق تلاش می­شود شناسایی ارقام مقاوم در سطح34 رقم مهم گوجه فرنگی در ایران و به روش مولکولی انجام پذیرد. شناسایی توالی ژن دخیل در مقاومت گوجه فرنگی به بیماری شانکر ساقه اخیراً انجام شده است و برای اولین بار در این تحقیق از نگاه کاربردی از نتایج حاصل از پژوهش فوق در راستای شناسایی ارقام مقاوم در ایران استفاده شد. ژن  ASC1میزان مقاومت و حساسیت گیاه را نسبت توکسین تعیین می­کند. بیان ژن ASC1 باعث تولید پروتئینASC-1P  شده که با آنزیم سرآمید سنتاز در مسیر اسفنگولپید بوده که با حضور ASC1پروتئین باعث مقاومت گیاه می­شود. بررسی نتایج حاصل از تکثیر نشان داد که این پرایمر قدرت تمایز میان ارقام هموزیگوس غالب(Asc/Asc)  و ارقام هتروزیگوس (Asc/asc) با ارقام هموزیگوس مغلوب (asc/asc) را دارد. توالی مربوط به ژن ASC1 در بانک ژن ثبت شده است با توجه به یافته­های محققان و اینکه روش­های معمول برای  شناسایی و کنترل بیماری  زمان­بر و هزینه­بر است و بسته به نوع آب و هوا شرایط کشت و پرورش متفاوت بوده و احتمال مقاومت به قارچ کشها وجود دارد، مطمئن­ترین و موثرترین روش کنترل، شناسایی ارقام مقاوم و کاشت آنها است (9 و 17) که برای اولین بار در این تحقیق در ایران در ارقام مهم گوجه فرنگی از روشهای مولکولی به این منظور بهره گرفته شده است.

مواد و روشها

کاشت ارقام گوجه فرنگی 5 رقم بذر اصلاح شدهL1  تا  L5 در جدول 4 از مؤسسه تحقیقاتی و اصلاح  نهال و بذر کرج، 21 رقم  بذر از L6  تا  L27  از شرکت فلات و  ماباقی بذرها و L22 از شرکت گل سم که از ارقام گوجه فرنگی رایج در کشور تهیه شد. کاشت 34 رقم مختلف گوجه­فرنگی در فضای آزاد با خاکpeat moss  در گلدان و ماه اردیبهشت در دمای بین 19 تا 29 درجه سانتی­گراد صورت گرفت. ارقام مورد آزمایش، در شرایط مناسب کاشته شده و طبق(شکل1) و (جدول1) کدگذاری گردید.

 

شکل1 - کاشت ارقام گوجه فرنگی

 

جدول 1- ارقام مورد استفاده در این تحقیق و کد مربوطه

کد

ارقام گوجه فرنگی

کد

ارقام گوجه فرنگی

1L

Walter

20L

هیبرید پی اس

2L

Early ur bana

21L

سوپر 2270

3L

Mana pd

22L

متین

4L

Pate early ch

23L

هیبریدفیزنزه

5L

Bonny Best

24L

هیبرکومودورو

6L

شف فلات

L25

پریمو فلات

7L

پتو86

26L

هیبریدپتوپراید2

8L

اکسیر فلات

27L

سی اچ فلات

9L

کینگ استون

28L

روژین

10L

کنیگ استار

29L

کال جی ان 3

11L

ارلی اوربانا وی اف

30L

هرمز

12L

کیمیا فلات

31L

هنگام

13L

وای فلات

32L

رها

14L

هیبریدایون

33L

زیومرد

15L

اوان

L34

کیان

16L

کارون فلات

 

 

17L

هیبرید سوپرست

 

 

L18

فلات111

 

 

19L

سوپر شف

 

 

استخراج DNA: پس از آماده سازی نمونه­ها، استخراجDNA  به روشCTAB  انجام گرفت (10) به منظور انجام فرآیند استخراج DNA بافت برگ گیاهچه­ها را با ازت مایع خرد نموده و سپس کد گذاری کرده و برای نگهداری به دمای 20- تا 80- منتقل گردید. بافر CTAB تهیه و pH= 8 تنظیم شد. نمونه‌های DNA  استخراج شده بر روی ژل آگارز 8/0 درصد بارگذاری گردید و بعد از انجام الکتروفورز و رنگ آمیزی با اتیدیوم بروماید اندازه باند هر  DNA خام استخراج شده با مقایسه غلظت مشخصی از نشانگر وزن مولکولی (Gen Ruler DNA Ladder Mix 10kb ) شرکت Fermentas تخمین زده شد. استخراج  DNA  برای هر رقم در 4 تکرار انجام  گرفت و سپس­DNA های تمیز و با غلظت مناسب برای  PCR از همه ارقام انتخاب شد.

انجام فرآیند واکنش زنجیره­ای پلیمراز: برای تهیه 25 میکرولیتر مخلوط اجزای واکنش زنجیره‌ای پلیمراز به ترتیب از 5/2 میکرولیتر PCR buffer، 75/0 میکرولیتر کلریدمنیزیم، 7/0میکرولیتر dNTP، 2/1 میکرولیتر آغازگر رفت و برگشت، 3/0 میکرولیتر Taq DNA polymerase ، 2 میکرولیتر  DNA استفاده شد. جهت انجام این واکنش آغازگر اختصاصی ASC1 ساخت شرکت متابیون آلمان مورد استفاده قرار گرفت. توالی آغازگر مورد استفاده در واکنش زنجیره‌ای پلیمراز برایAsc1f عبارت است از:ATCACATCGCTGCTTCGGTTG و برایAsc1r عبارت است از : ATCCCAGTCCGTTCCTTCT. برنامه حرارتی واکنش زنجیره‌ای پلیمراز اجرا شده عبارت است از: چرخه نخست، دو دقیقه در دمای 95 درجه سانتی‌گراد، 35 چرخه بعدی شامل، 95 درجه سانتی‌گراد به مدت یک دقیقه، 56 درجه سانتی‌گراد به مدت یک دقیقه و 72 درجه سانتی‌گراد به مدت دو دقیقه و چرخه نهایی 72 درجه سانتی‌گراد به مدت دو دقیقه در دستگاه ترموسایکلرگرادیانت Bio rad مدل MycyclerTM انجام گرفت. این واکنش برای هر یک از نمونه­ها 5 بار تکرار شد ودر این تحقیق برای تعیین وزن باند از DNA Ladder  mix 10000  استفاده شده است. برای بررسی تکثیر قطعه ژن مورد نظر، از الکتروفورز محصول PCR  در ژل آگارز 2/1 درصد با بافر TBE استفاده گردید.

توالی­یابی(sequence) : پس از الکتروفورز محصول واکنش زنجیره‌ای پلیمراز و تکثیر قطعه ژن در برخی ارقام، جهت اطمینان از صحت کار، قطعه تکثیر شده تعیین توالی شد.

نتایج و بحث

استخراج DNA به روش CTAB انجام شد. الگوی الکتروفورزی استخراج DNA در ارقام مختلف گوجه فرنگی در ژل آگارز 8/0 درصد در شکل 2 آمده است. واکنش زنجیره‌ای پلیمراز طبق شرایط ذکر شده انجام و محصول واکنش زنجیره‌ای پلیمراز در ژل آگارز 2/1 درصد با بافر TBE الکتروفورز شد. برخی از ارقام قطعه ژنی به وزنbp  1200  تکثیر کردند. (شکل3) از بین ارقام مورد آزمایش، ارقام کال جیN3، اکسیر فلات،VF Early urbana، اوان، هیبریدps515، CH فلات، متین،Bonny Bost ، هیبرید ایون دارای قطعه ژنASC1 بودند که پروتئین حاصل از بیان آن، قادر به سم زدایی AAL-Toxin بوده و بررسیها نشان داده است که وجود این ژن در گیاه میزبان مانع بروز علائم بیماری شانکر ساقه می­شود. تک باند دیده شده در واکنش زنجیره‌ای پلیمراز، همراه با پرایمر مربوطه برای توالی­یابی به شرکت پیشگام ارسال شد.  نتیجه سکوئنس نشان داد که باند ایجاد شده همان ژن مورد نظر می­باشد. که نتیجه این توالی در پیوست نمایه شده است. این نتایج با مطالعات برخی از محققین همسو بود. کمترین میزان شاخص بیماری به رقمهای VF Early urbana و هیبریدps تعلق دارد (1). نتایج این تحقیق وجود ژن مقاومتASC1  را در این ارقام تأیید کرد. نتایج نشان دهنده وجود اختلاف معنی دار بین ژنوتیپها از نظر صفات بیماری (16) که این امر در نتایج این تحقیق تأیید شد.

 

10kbp

 

شکل 2- الگوی الکتروفورزی استخراج DNA در ارقام مختلف گوجه فرنگی در ژل آگارز 8/0درصد

 
 

L5  L7     L11  L14   L15  L20  L22  L27  L29

 

 


1200bp

 

 

شکل 3- الگوی الکتروفورزی محصول PCR روی ژل آگارز2/1 درصد

پیوست یک

 

 

با توجه به تحقیقات براندواج­­ (2002) که بر اساس آن مقاومت به وسیله ژن غالب ASC-1 در برابر قارچ Alternaria alternata f.sp. lycopersiciایجاد می­شود می­توان مقاومت ارقام ذکر شده دارای این ژن را تأیید کرد از آنجا که توالی این ژن به تازگی در سایت­های معتبر درج گردیده است این یافته­ها به صورت کاربردی برای اولین بار در ایران گزارش می­گردد. فیتوتوکسینALL toxin ­ ، که عامل اصلی ایجاد علائم است در تعامل پاتوژن میزبان تولید می­شود و صفت مورد بررسی QTL دارای مقاومت عمودی است در سایر ارقام نیز قابل بررسی است. در حالی که اصلاح نباتات سنتی یک نقش محوری در توسعه ارقام مقاوم گوجه­فرنگی را ایفا کرده است. لذا با توجه به اینکه گیاه گوجه­فرنگی گونه­ای اقتصادی است و تولید آن به صورت مزرعه­ای و گلخانه­ای در کشور مرسوم است. ارقام مختلفی از این گونه در ایران کشت می­شود که برخی از آنها به دلیل پرمحصول بودن، زودرس بودن و یا کیفیت میوه بر ارقام دیگر ترجیح دارند همچنین با وجود اینکه اصلاح ژنتیکی بذر گیاهی توانسته است تا حدودی از طریق بهبود جوانه زنی در شرایط نامساعد،عملکرد را تحت تأثیر قرار دهد با این­حال ویژگیهای دیگر این ارقام از نظر تحمل کمبودهای تغذیه­ای و یا شرایط تنشی  نیز توسط محققان مورد بررسی قرار گرفته­ است تا از تولید گوجه فرنگی در مزرعه با تنشهای مختلف ممانعت شود. که هدف از این پژوهشها علاوه بر معرفی رقمی با تحمل بیشتر نسبت به کمبودها و تنشها و همچنین افزایش مقاومت آنها در برابر شرایط نامساعد محیطی به شمار می­رود (2 و 4) اما ردیابی مولکولی ژن ثابت کرد که این روش می­تواند یک ابزار بسیار مفید برای شناسایی مقاومت به سایر بیماریها در گوجه­فرنگی باشد. با توجه به اینکه برخی ارقام با خصوصیات زراعی مناسب، فاقد ژن مقاوم هستند، با دسترسی به این ژن و انتقال آن به ارقام حساس می­توان به ارقام مقاوم با صفات زراعی مناسب دست یافت. آزمونهای بیماریزایی متعددی قابل طرح است که می­تواند تآییدی بر تحقیقات انجام شده بوده و نتایج حاصل را به فضای گلخانه و مزرعه تعمیم دهد. با امید به اینکه این تحقیقات، راه­گشایی برای مطالعات جدید در شناسایی سریع و تولید ارقام مقاوم نسبت به بیماریهای مختلف باشد.

  1. حاجیان فر، ر.، و زربخش، ع. (1389) . واکنش ژنوتیپ های گوجه فرنگی به بیماری شانکر آلترناریائی ساقه. مجله نژادی نهال و بذر جلد437 - 449 .26
  2. حاجی بلند, ر(1393).­ تاثیر کمبود فسفر بر تحمل تنش خشکی در دو رقم گیاه گوجه فرنگی (Solanum lycopersum L.).  مجله زیست شناسی ایران. جلد27. صفحات 788-803.
  3. طاهری،س (1390)، بررسی تنوع ژنتیکی مقاومت به لکه موجی آلترناریا گوجه فرنگی در کلکسیون بانک ژن گیاهی ملی ایران، پایان نامه ارشد رشته مهندسی بیوتکنولوژی کشاورزی گروه بیوتکنولوژی دانشگاه پیام نور کرج.
  4. نیک­زاد­، خ.­­، و عمو­آقایی، ر(1392)­­.­ تاثیر پرایمینگ بر جوانه زنی دانه های گوجه فرنگی در دماهای زیربهینه. مجله زیست شناسی ایران. جلد26.صفحات 233-235.

 

5. Andrew M, Peever T, et al. (2009). An expanded multilocus phylogeny does not resolve morphological species within the small-spored Alternaria species complex. Mycologia, 101: 95-109.

6. Amjad  H , Akhtar K P, Saleem M Y, et al.  (2010). Correlative evidence for peroxidase involvement in disease resistance against Alternaria leaf blight of tomato. Acta Physiologiae Plantarum, 32: 1171-1176.

7. Aneja J , Agarwal A , & Agnihotri A. (2014). Inter and intra-specific diversity in Alternaria species infecting oilseed Brassicas in India. Journal of Oilseed Brassica, 5:102-117.

8. Aminian H, Zad  J, Sharifi Tehrani A, Okhovat S M, et al.(2004). A study of tomato stem canker in Busher province. Iranian Journal of Agriculture Sciences 35: 245-252 (in Persian).

9. ­Barone, A., & Frusciante, L. (2007). Molecular marker-assisted selection for resistance to pathogens in tomato. Marker-Assisted Selection, Current status and future perspectives in crops, livestock, forestry and fish, 153-164

10. Guo, L., Hyde, K., & Liew, E. (2000). Identification of endophytic fungi from Livistona chinensis based on morphology and rDNA sequences. New phytologist, 147(3), 617-630.

11. Meena P, Rani A, Meena R, Sharma P, Gupta R, et al. (2012). Aggressiveness, diversity and distribution of Alternaria brassicae isolates infecting oilseed Brassica in India. African J Microbiol Res, 6:5249-5258..

12. Margaret M T, Shi A, & Kim M. S. (2011). Identification of Alternaria alternata as a causal agent for leaf blight in Syringa species. The Plant Pathology Journal, 27: 120-127.

13. Miguel P A, Luna A , de la Cruz  S , González I , Martín  R , et al. (2012). PCR-based   assay for the detection of Alternaria species and correlation with HPLC determination of altenuene, alternariol and alternariol monomethyl ether production in tomato products. Food Control, 25: 45-52.

14. Naik M K , Chennappa G, Bhat K V, et al. (2014). RESEARCH ARTICLE MOLECULAR AND PATHOGENIC DIVERSITY OF ALTERNARIA SP. SOLATED FROM SESAMUM BY SCAR MARKER. International Journal of Current Research Vol. 6, Issue, 09:8335-8350

15. Reni C, Voorrips R E.  (2006). Tomato early blight (Alternaria solani): the pathogen, genetics, and breeding for resistance. Journal of general plant pathology, 72: 335-347.

16. Shahriari D, Kangarlo S, Lak F, Ghasemi M  A, et al.  ) 2009(.Study on stem canker disease in tomato genotypes. Abstracts of the First National Congress on Tomato Production and Processing Technology. 11-12 February, Iran, Mashhad. page 108 (in Persian).

17. Tiwari S, Kumar S and Gontia I.) 2011(. Biotechnological approaches for sesame (Sesamum indicum L.) and Niger (Guiotia abyssinica L.f. Cass). Asian Pacific Journal of Molecular Biology and Biotechnology. 19:29.