نوع مقاله: مقاله پژوهشی

نویسندگان

1 دانشجوی کارشناسی ارشد دانشگاه شاهد، دانشکده علوم کشاورزی

2 پژوهشگاه ملی مهندسی ژنتیک و زیست فناوری، پژوهشکده زیست فناوری صنعت و محیط زیست، گروه مهندسی زیست فرایند

3 عضو هیات علمی / دانشگاه شاهد

چکیده

کیتین، دومین بیوپلیمر فراوان در طبیعت بعد از سلولز و جزء اصلی کوتیکول حشرات و پوسته سخت پوستان است و دیواره سلولی بیشتر قارچها و بعضی از جلبکها و نیز نماتدها را تشکیل می‌دهد. مقادیر زیادی کیتین به شکل باقیمانده تجزیه ناپذیر بدن بسیاری از جانداران وارد طبیعت می‌شود که باعث آلودگی محیط زیست می‌گردد. می‌توان پس از تجزیه این پلی ساکارید با آنزیم کیتیناز از آن در جنبه‌های مختلف زندگی بهره جست. کیتینازها یکی از آنزیم هایی هستند که نقش تجزیه کیتین نامحلول را بر عهده دارند. برخی از باکتری ها کیتیناز را برای هضم کیتین تولید می‌کنند. در این تحقیق ژن کیتیناز ترموفیل با شماره دسترسی JQ675723 از جدایه باکتریایی Paenibacillus sp. A01 جداسازی و پس از همسانه‌سازی در pET26b به باکتری اشرشیا کلی برای تولید پروتئین نوترکیب منتقل شد. آنزیم هترولوگ تولیدی توسط ستون میل ترکیبی نیکل- سفاروز خالص گردید؛ آنزیم تولیدی نشان داد که در حضور کیتین کلوییدی و پس از افزودن 3 و5-دی نیترو سالیسلیک اسید در 530 نانومتر و در دمای C° 60 دارای فعالیت هیدرولازی است. دمای بالا، پتانسیل کاربردی شدن آن در صنعت را خاطر نشان می‌سازد. همچنین توالی نوکلئوتیدی به‌دست‌آمده برای ژن کتیناز به‌صورت تئوری مورد مطالعه قرار گرفت که تشابه زیادی را به کیتینازهای دسته‌بندی شده در خانواده 18 گلیکوزیل هیدرولازها نشان داد. بررسی توالی آمینواسیدی آنزیم کیتیناز به‌ترتیب از ناحیه آمینی به سمت ناحیه کربوکسیل وجود سه دُمین کاتالیتیکی گلیکوزیل هیدرولاز 18، شبه فیبرونکتین و متصل‌شونده به کیتین را مشخص نمود.

کلیدواژه‌ها

موضوعات

عنوان مقاله [English]

Recombinant Chitinase produced from a thermophilic Paenibacillus ehimensis

نویسندگان [English]

  • mahdi mortazavi 1 2
  • Saeed Aminzadeh 2
  • Alireza Ghanbari 3
  • naser farrokhi 2
  • Ali Asghar Karkhane 2
  • zohreh javaheri 2

1 shahed university

2 shahed university

3 Shahed University

چکیده [English]

Chitin is the second most abundant organic polymer in nature after cellulose and it is the main part of Insects cuticle and crustaceans and includes in cell wall of most fungus and some algae and nematodes. Huge amounts of chitin residual are being produced by organisms that enter to the nature as natural pollutants. However, this polysaccharide has immense application in different aspects of our daily life once becomes digested via chitinases. Chitinase is one of the enzymes that responsible for disintegrating chitin. Some of bacteria produce chitinase for digesting chitin. Here, a thermophilic chitinase gene (JQ675723) obtained from a Paenibacillus ehimensis isolate. The gene was cloned in pET26b and transformed into E. coli to heterologously produce the enzyme. The recombinant protein was isolated via affinity chromatography using Ni-NTA column. The enzyme demonstrated to have hydrolytic activity in the presence of chitin and by addition of 3, 5-dinitrosalicylic acid at 530 nm. Moreover high temperature showed industrial potential. Its nucleotide sequence had high similarity to Glycoside hydrolase family 18. Amino acid sequence from amino to carboxyl determined glycosyl hydrolase domain, fibronectin like domain and chitin binding domain.

کلیدواژه‌ها [English]

  • Chitin
  • Chitinase
  • Thermophilic Bacterium
  • Paenibacillus ehimensis

تولید باکتریایی پروتئین نوترکیب کیتیناز از باکتری ترموفیل Paenibacillus sp A01 

مهدی مرتضوی1 و2، سعید امین­زاده1*،علیرضا قنبری2، ناصر فرخی3 ، علی اصغر کارخانه1 و زهره جواهری صفا1 

1 تهران، پژوهشگاه ملی مهندسی ژنتیک و زیست فناوری، پژوهشکده زیست فناوری صنعت و محیط زیست، گروه مهندسی زیست فرایند

2 تهران،دانشگاه شاهد، دانشکده علوم کشاورزی

3  تهران،دانشگاه شهید بهشتی، دانشکده مهندسی فناوریهای نوین، گروه بیوتکنولوژی

تاریخ دریافت: 21/2/94                تاریخ پذیرش: 12/12/94

چکیده 

کیتین، دومین بیوپلیمر فراوان در طبیعت بعد از سلولز و جزء اصلی کوتیکول حشرات و پوسته سخت پوستان است و دیواره سلولی بیشتر قارچها و بعضی از جلبکها و نیز نماتدها را تشکیل می­دهد. مقادیر زیادی کیتین به شکل باقیمانده تجزیه ناپذیر بدن بسیاری از جانداران وارد طبیعت می­شود که باعث آلودگی محیط زیست می­گردد. می­توان پس از تجزیه این پلی ساکارید با آنزیم کیتیناز از آن در جنبه­های مختلف زندگی بهره جست. کیتینازها یکی از آنزیم هایی هستند که نقش تجزیه کیتین نامحلول را بر عهده دارند. برخی از باکتری ها کیتیناز را برای هضم کیتین تولید می­کنند. در این تحقیق ژن کیتیناز ترموفیل با شماره دسترسی JQ675723 از جدایه باکتریایی Paenibacillus sp. A01 جداسازی و پس از همسانه­سازی در pET26b به باکتری   اشرشیا کلی برای تولید  پروتئین نوترکیب منتقل شد. آنزیم هترولوگ تولیدی توسط ستون میل ترکیبی نیکل- سفاروز خالص گردید؛ آنزیم تولیدی نشان داد که در حضور کیتین کلوییدی و پس از افزودن 3 و5-دی نیترو سالیسلیک اسید در 530 نانومتر و در دمای C° 60 دارای فعالیت هیدرولازی است. دمای بالا، پتانسیل کاربردی شدن آن در صنعت را خاطر نشان می­سازد. همچنین توالی نوکلئوتیدی به­دست­آمده برای ژن کتیناز به­صورت تئوری مورد مطالعه قرار گرفت که تشابه زیادی را به کیتینازهای دسته­بندی شده در خانواده 18 گلیکوزیل هیدرولازها  نشان داد. بررسی توالی آمینواسیدی آنزیم کیتیناز به­ترتیب از ناحیه آمینی به سمت ناحیه کربوکسیل وجود سه دُمین کاتالیتیکی گلیکوزیل هیدرولاز 18، شبه فیبرونکتین و متصل­شونده به کیتین را مشخص نمود.

واژه های کلیدی: باکتری ترموفیل، کیتین، کیتیناز،  Paenibacillus sp. A01

* نویسنده مسئول، تلفن: 44787412-021 ، پست الکترونیکی: aminzade@nigeb.ac.ir

مقدمه

 

کیتین فراوانترین بیوپلیمر در محیط دریایی و ترکیب اصلی اسکلت خارجی بندپایان، دیواره سلولی قارچ­ها، و جلبک­هاست. مشتقات کیتین، زیست سازگار، زیست تخریب­پذیر هستند (4). کیتینازها (EC: 3.2.1.14) پیوند میان کربن­های شماره 1 و 4 بین دو ملکول پشت­سر هم N- استیل­گلوکز­آمین (GlcNAc) در زنجیرهای کیتین را که اندازه آن­ها بین 20 کیلودالتون تا حدود 90 کیلودالتون متغیر است؛ هیدرولیزمی­کنند (16). کیتینازهای ترشحی را می­توان در موجوداتی که در ساختمان خود، واجد کیتین - (حشرات، سخت­پوستان و قارچ­ها) و  یا فاقد کیتین  هستند (گیاهان و باکتری­ها) یافت. کیتینازها را می­توان  براساس نوع سوبسترا به اگزو- و اندو کیتیناز­ها تقسیم نمود (13) که تجزیه مؤثر کیتین به عملکرد هر دوی این آنزیم­ها نیاز دارد که منجر به آزادسازی واحدهای N– استیل– گلوکزآمین می­شود (21). اندوکیتینازها به کاتالیز کیتین و تقسیم آن به مولتی­مونومرهای با وزن مولکولی کم دنباله­های گلوکوزآمین از قبیل کیتوتریوز، کیتوبیوز و دی­استیل کیتوبیوز می­پردازند (9). در عوض اگزوکیتینازها بر دو نوع کیتوبیوزیداز (موثر مؤثر درجدا سازی واحدهای دی- استیل کیتوبیوز از انتهای غیراحیایی میکرو­فیبر­های کیتین) و β-N-استیل گلوکزآمینیداز تقسیم میشوند؛ که محصول الیگومری حاصل از اندوکیتیناز و کیتوبیوزیداز را به مونومر­های N-استیل گلوکزآمین تجزیه می­کند (16). این آنزیم در بعضی از گونه­های باکتریایی از جمله گونه­های موجود در جنس آئروموناس، سراشیا، میکسوباکتر، ویبریو، استرپتومایسس و باسیلوس به فراوانی یافت می­شود (15). به دلیل کاربردهای وسیع صنعتی، کشاورزی و پزشکی، آنزیم کیتیناز توجه زیادی را به خود معطوف کرده است و جداسازی این آنزیم­ها از موجودات ذره­بینی کاربردهای گسترده­ای در بیوکنترل قارچ­ها و نماتودهای آفت محصولات کشاورزی یافته است (1و5).

کیتیناز­های باکتریایی از نظر ساختمانی از چندین دُمین مختلف تشکیل شده­اند که شامل دُمین اتصال به کیتین CBD)) در انتهای کربوکسیلی، دُمین مشابه با فیبرونکتین نوع 3 (FnIII) و دُمین مشابه کادهرین می­باشد. دُمین CBDنقش اتصال آنزیم به سوبسترا را ایفا می­نماید که باعث افزایش کارآیی آنزیم می­گردد، ولی در  فقدان حضور این دُمین نیز، آنزیم قادر به تخریب کیتین می­باشد، نقش دو دُمین دیگر هنوز روشن نشده است (14). کیتینازها بر اساس توالی اسید آمینه­ای در سه خانواده 18 ، 19 و 20 گلیکوزیل هیدرولازها قرار می­گیرند. خانواده 18 کیتینازها درویروس­ها، باکتری ها، قارچ ها، حیوانات و برخی از گیاهان عالی و خانواده 19 کیتینازها درگیاهان و  استرپتومایسس یافت می­شوند. خانواده 20 شامل N- استیل گلوکزآمینیدازهای مشتق از باکتری­ها، برخی از قارچ­ها و انسان­ها است (16و19).­ مطالعات کریستالوگرافی اشعه X ‌ نشان داده است که آنزیم های کیتیناز خانواده 18 دارای ساختار سبد مانند (α/β)8 (17) و خانواده 19 از لحاظ مارپیچ آلفا بسیار غنی و دو قسمتی می باشند. کیتینازهای خانواده 18 در هیدرولیز اتصال گلیکوزیدی بتا 1 و 4، قطعات الیگوساکاریدی آنومر بتا را تولید می­نمایند (2)، در صورتی که کیتینازهای  خانواده 19 دارای مکانیزم معکوس  بوده و آنومرهای آلفا را ایجاد می­کنند (20).

آنزیم کیتیناز به­عنوان قارچ­کش زیستی و حشره­کش زیستی  بسیار مورد توجه است. کیتیناز­ها در تولید SCP  برای حیوانات و تغذیه موجودات آبزی،  جداسازی پروتوپلاست قارچ­ها، آماده­سازی کیتو-الیگوساکاریدهای بیواکتیو و مهار پاتوژن­های گیاهی کاربرد دارد. در این مطالعه، از جدایه بومی باکتری گرم مثبت Paenibacillus sp. A01  از استخرهای پرورش میگو در جنوب کشور برای تولید پروتئین نوترکیب کیتیناز استفاده گردید. در این مطالعه با توجه به کاربردهای ذکر شده، آنزیم کیتیناز انتخاب شد. از آنجاییکه برخی باکتری ها می توانند کیتین را هضم کنند؛ باکتری  Paenibacillus sp. A01 به منظور جداسازی ژن کیتیناز ترموفیل انتخاب شد.  پس از تکثیر ژن توسط پرایمرهای اختصاصی و برای بیان هترولوگ آنزیم نوترکیب، همسانه سازی در وکتور بیانی pET26b انجام شد و به باکتری اشرشیا کلی به منظور تولید پروتئین مورد نظرانتقال داده شد. تخلیص پروتئین نیز با ستون میل ترکیبی نیکل-سفارز انجام شد و همچنین فعالیت بیولوژیک آن  نیز مورد بررسی قرار گرفت.

مواد و روشها

آنزیم پلیمرازی Taq وآنزیم­های برش­دهنده با اثر محدودکننده  BamhHindШ، آنزیمT4 DNA ligase ، نشانگر اندازه DNA، نشانگر پروتئینی و IPTG  از شرکت  Fermentas((Burlington, Canada خریداری شدند. کیتHigh Pure PCR Product Purification  برای خالص­سازی محصول PCR و نیز خالص­سازی قطعات DNA از روی ژل آگارز، و نیز کیت High Pure Plasmid Isolation برای استخراج نوکلئیک اسید ناقلی از شرکت (Indianapolis, USA) Roche خریداری گردیدند. N-Acetyl-D-glucosamine 3,5-Dinitrosalicylic acid، آنتی­بیوتیک کانامایسین، آگارز وکیتین از شرکت  (Steinheim, USA) Sigma خریداری شدند. ستون نیکل(Ni-NTA Agarose) از شرکت Invitrogen (Carlsbad, USA)  و کیت  استخراج نوکلئیک اسید برای استخراج نوکلئیک اسید ژنومی از شرکت
(Anaheim, USA) BioNEER خریداری شدند.  ایمیدازول، آکریل آمید، بیس آکریل آمید، APS و TEMED و آگار از شرکت  (Darmstadt, Germany) Merck تهیه شدند. آغازگر­ها از شرکت  (Anaheim, USA) BioNEER تهیه گردیدند.

در این تحقیق، از باکتری Paenibacillus sp. A01که از استخرهای پرورش میگو در حله بوشهر جداسازی شده بود؛ به­منظور استخراج نوکلئیک اسید ژنومی استفاده شده است. باکتری اشرشیا کلی سویه  DH5aبه­عنوان میزبان در مراحل کلون­سازی و نیز جهت تکثیر و نگهداری DNA پلاسمیدی مورد استفاده قرار گرفت. جهت بیان آنزیم کیتیناز، از باکتری اشرشیا کلیسویهBL21(λDE3)   استفاده شد.

تشخیص و شناسایی سویه جدا شده: سویه جداشده برای آزمون های بیوشیمیایی از قبیل ژلاتین، سیترات، متیل رد و سایر فاکتورها مورد ارزیابی قرار گرفت و تست های میکروبی نیز طبق پروتکل های استاندارد انجام شد.

استخراج نوکلئیک اسید ژنومی از  Paenibacillus sp. A01 و تکثیر ژن کیتیناز :  DNAاز تک کلونی باکتری ترموفیل رشدیافته در دمای °C 60 در محیط کشت LB (5/0% عصاره مخمر، 1% پپتون، 1% کلرید سدیم) توسط کیت  استخراج نوکلئیک اسید،  به­دست آمد و  از نظر کمّی و کیفی توسط دستگاه  اسپکتروفتومتر و الکتروفورز ژل آگاروز تایید گردید.

براساس توالی­های گونه­های باکتریایی نزدیک به Paenibacillus sp. A01 در NCBI، آغازگرهای اختصاصی طراحی و به­منظور همسانه­سازی در ناقل بیانی pET26b نواحی برشی آنزیم­های محدود­الاثر BamH I و Hind III به­ترتیب در آغازگرهای پیش­بر (5΄CCATTGGATCCATGACGAGCTATACG3΄) و معکوس (5΄CCTATTAAGCTTTGAGCGACAGCGAC3΄) با استفاده از نرم­افزار Oligo5 طراحی گردیدند. برای حفظ سایت برشی ( بازهای آلی که زیر آنها خط کشیده شده است) در مراحل همسانه­سازی و همچنین افزایش کارآیی برش، تعداد 6 باز آلی در 5΄ هر آغازگر  در نظر گرفته شد.

واکنش­های زنجیره­ای پلیمراز (PCR) با استفاده از آغازگرهای فوق با برنامه 5 دقیقه در 94 درجه سانتی­گراد برای واسرشتی اولیه، 32 چرخه {مدت 30 ثانیه در 94 درجه، 30 ثانیه در دمای 50 درجه و 3 دقیقه در دمای 72 درجه سانتی­گراد} و یک دور به مدت 5 دقیقه در دمای 72 درجه سانتی گراد انجام شد. انجام شد و محصول PCR به حجم ml 100 بر روی ژل آگارز (w/v) % 1برده شد و باند اختصاصی از ژل با استفاده از کیت  تخلیص محصول PCR مطابق با دستورالعمل شرکت سازنده، تخلیص شد. برای سنجش میزان غلظت DNA تخلیص­شده،  دو میکرولیتر از آن بر روی ژل آگارز % 1قرار گرفت .

همسانه­سازی ژن کیتیناز در ناقل بیانی pET26b : هضم آنزیمی محصول PCR و ناقل بیانی pET26b (سه میکروگرم) با یک واحد از هر یک از آنزیم­های برشی BamH I و Hind III در حضور 5/2 میکرولیتر بافر مشترک R  در حجم نهایی 25 میکرولیتر (دمای 37 درجه سانتی­گراد به مدت دو ساعت) صورت گرفت و بر روی ژل آگارز 1% (w/v) جدا شد و به کمک کیت تخلیص محصول PCR خالص گردید.

با استفاده از یک واحد از آنزیم T4 DNA ligase ، محصولات برش­یافته (4/0 میکروگرم از هر  محصول) در حضور بافر ×5 (5 میکرولیتر) در حجم نهایی 25 میکرولیتر به مدت 16 ساعت و در دمای 14 درجه سانتی­گراد به هم ملحق شدند. باکتری مستعد  اشرشیاکلی سویه BL21 به روش شوک حرارتی (در دمای 42 درجه سانتی­گراد به مدت دو دقیقه) ترانسفورم گردید و پس از افزودن 500 میکرولیتر محیط کشت LB و نگهداری به مدت 45 دقیقه در 37 درجه سانتی­گراد، بر روی محیط کشت LB حاوی 1% (w/v) آگار و آنتی­بیوتیک کانامایسین (25 میکروگرم در میلی لیتر) به مدت 16 ساعت در37 درجه سانتی­گراد کشت گردید.

تک کلونی حاصله، در محیط کشت LB به مدت 16 ساعت و در 37 درجه سانتی­گراد با هوادهی کشت شد و از سوسپانسیون باکتریایی با استفاده از کیت High Pure Plasmid Isolation و مطابق با  دستورالعمل آن، پلاسمید حاوی ژن کیتیناز جدا و با استفاده از آغازگرهای اختصاصی ناقل توسط شرکت ژن فن­آوران توالی یابی گردید و حضور ژن در ناقل و قرار گرفتن آن به درستی در پایین­دست پروموتور تعبیه­شده در ناقل تایید شد (15 و 16).

بیان هترولوگ ژن کیتیناز: کلونی توالی­یابی شده در 5 میلی لیتر محیط LB دارای کانامایسین (25 میکروگرم در میلی­لیتر) تلقیح یافت و به مدت 16 ساعت در  37 درجه سانتی­گراد قرار داده شد. حجم یک میلی­لیتر از این محیط کشت به 50 میلی­لیتر محیط کشت جدید LB حاوی کانامایسین  در داخل ارلن تلقیح شد و در شیکرانکوباتور تا رسیدن جذب نوری آن به 4/0 الی 8/0 در طول موج 600 نانومتر در دمای  37 درجه سانتی­گراد با سرعت 180 دور در دقیقه قرارگرفت.  قبل از القاء توسط IPTG، یک میلی­لیتر از هر کدام از نمونه­ها، به­عنوان کنترل منفی برداشته شد و در 6000 دور در دقیقه به مدت 10 دقیقه سانتریفیوژ گردید و رسوب حاصل در دمای 20- درجه سانتی­گراد قرار گرفت. سپس به هر ارلن 50 میلی­لیتری حاوی محیط کشت LB و آنتی­بیوتیک کانامایسین IPTG  8/0 مولار اضافه گردید به­طوریکه غلظت نهایی IPTG  به 1 میلی­مولار برسد. ارلن­ها در دمای 30 درجه سانتی­گراد و با شیک 150 دور در دقیقه قرار گرفتند و پس از 3 ساعت، 1 میلی­لیتر از نمونه به مدت 10 دقیقه در 6000 دور در دقیقه سانتریفیوژ و به­عنوان رسوب حاوی پروتئین القاء شده در نظر گرفته شد و  در دمای 20-  درجه سانتی­گراد نگهداری گردید (6).

برای استخراج پروتئین نوترکیب، ابتدا رسوب حاصل از هر 50 میلی­لیتر سلول‌های جمع‌آوری­شده با 5 میلی­لیتر بافر لیزکننده طبیعی  (50 میلی­مولار سدیم دی هیدروژن فسفات، 500 میلی­مولار  کلرید سدیم، 10 میلی­مولار ایمیدازول و 05/0% Tween 20) مخلوط و 45 دقیقه درون یخ قرار داده شد، سپس دیواره و غشاء پلاسمایی باکتری از طریق سونیکاسیون با قدرت 70 درصد و 5/0 پالس در پنج چرخه زمانی(هر کدام شامل 45  ثانیه سونیکاسیون و 1 دقیقه استراحت درون یخ) با استفاده از نیروی امواج مافوق صوت شکسته شدند. محلول بدست آمده بلافاصله به مدت 10 دقیقه در دمای 4 درجه سانتی­گراد و با سرعت 6000 دور در دقیقه سانتریفوژ شد و محلول (رویی) شفاف در مراحل بعدی برای تخلیص پروتئین نوترکیب مورد نظر استفاده گردید.

خالص­سازی پروتئین نوترکیب: ستون کروماتوگرافی نیکل به حجم یک میلی لیتر آماده و دو بار با آب مقطر(به حجم کل ستون) شستشو داده شد. سپس برای به تعادل رساندن ستون، از بافر اتصال  (جدول 1) استفاده شد و ستون سه بار در حجم  5 میلی­لیتر (5 برابر حجم ستون) شستشو گردید. بعد از خروج بافر اول از ستون، محلول شفاف حاصل از مرحله قبل(سوپ پروتئینی) به ستون تزریق و سه بار از ستون عبور داده شد و محلول خروجی (flow) آن در یک ظرف جمع‌آوری گردید. تکرار تزریق و افزایش زمان در این مرحله باعث برقراری اتصال بهتر پروتئین­‌های نوترکیب به ستون می­شود. پروتئین­‌های میزبان با تزریق 5 میلی­لیتر بافر شستشو  (جدول 1) به ستون از رزین شسته شد و محلول خروجی آن در یک ظرف مجزا جمع‌آوری گردید. با رسیدن سطح بالایی بافر قبلی به یک چهارم انتهایی ستون، بافر خارج کننده  (جدول 1) در حجم 5 میلی­لیتر به ستون تزریق شد. پروتئین­‌های نوترکیب در این مرحله در رقابت با غلظت بالای ایمیدازول از رزین­ها جدا شدند و با جریان بافری به خارج هدایت شدند و محلول خروجی در حجم 500 میکرولیتردر 10 میکروتیوب جمع‌آوری شد.

 

 

جدول 1- مواد لازم برای تهیه محلول های مورد نیاز جهت خالص­سازی آنزیم کیتیناز توسط ستون نیکل

Elution buffer(pH=8)

washing buffer(pH=8)

Binding buffer (pH=8)

NaH2PO4        (mM 50)

NaH2PO4 (mM 50)

NaH2PO4 (mM 50)

 NaCl           (mM 500)

 NaCl      (mM 500)

NaCl (mM 500)

05/0 %  Tween 20,

05/0  %  Tween 20,

05/0  % Tween 20,  pH= 8,

ایمیدازول (mM 250)

ایمیدازول (mM 20)

ایمیدازول (mM 10)

 

 

بخش­های مختلف فرآیند تولید و خالص­سازی پروتئین نوترکیب با استفاده از ژل سدیم دودسیل سولفات الکتروفورز ژل پلی آکریل آمید (SDS-PAGE) به انجام رسید (Laemmli 1970) و ژل­ها با استفاده از رنگ کوماسی آبی R-250 در آب، متانول و اسید استیک (1:5:4) برای مدت یک ساعت رنگ­آمیزی شد (3).

بررسی فعالیت آنزیم کیتیناز: ماده N- استیل D- گلوکز آمین که در اثر فعالیت آنزیم کیتیناز تولید می­شود، در حضور معرف­ 3 و 5 – دی نیترو سالیسیلیک اسید  (DNS) تشکیل رنگ نارنجی مایل به قرمز می­دهد. کیتین کلوئیدی به­عنوان سوبسترا در سنجش فعالیت آنزیم کیتیناز و به­عنوان منبع کربن در محیط کشت، از استفاده شد (6).

نتایج و بحث

جداسازی و تشخیص سویه جدا شده: تست های مورفولوژیکی، میکروبیولوژی و بیوشیمیایی (جدول2) سویه مورد نظر انجام گرفت و باکتری مورد نظر یک سویه جدید از Paenibacillus  تشخیص داده شد.

همسانه سازی ژن کیتیناز باکتری Paenibacillus sp. A01: پس از تهیه کشت تازه از سویه ایزوله شده، DNA ژنومی با استفاده از کیت تخلیص DNA استخراج شد (شکل1 چاهک 2). ژن کیتیناز (1677 جفت باز) با واکنش زنجیره­ای پلیمراز و با استفاده از آغازگرهای اختصاصی با سایت برشی مهندسی شده تکثیر شد (شکل 1 چاهک3). با برش قطعه تکثیری، ژن در ناقل خطی شده pET26b با همان آنزیم­های برشی (شکل 1 چاهک 4) الحاق گردید و به باکتری BL21 منتقل شد و با ترادف­یابی حضور ژن و استقرار آن به درستی در محل تایید گردید (Accession No. JQ675723). توالی حاصله با ژن کیتیناز از باکتری
P. ehimensis 87% شباهت داشت.

بیان، خالص سازی نسبی ژن کیتیناز و سنجش فعالیت آنزیمی: با القا باکتری، پروتیین هترولوگی با وزن ملکولی نسبی 50 کیلو دالتون (شکل 2، چاهک3) تولید گردید و پروتیین تولیدی به کمک ستون نیکل سفاروز به­طور نسبی خالص گردید (شکل 2، چاهک 4). آنزیم کیتیناز در حضور سوبسترای مخصوص خود یعنی کیتین کلوئیدی در محیط، اقدام به تجزیه آن نموده و آنرا تبدیل به گلوکز آمین و دیگر الیگوساکارید های کیتینی می نماید، واکنش گلوکز آمین با معرف  رنگی دی نیترو سالیسیلیک اسید باعث تغییر رنگ محیط از زرد به نارنجی شد که این نشان از فعالیت آنزیم کیتیناز دارد.

کیتین دومین منبع آلی و تجدیدپذیر در طبیعت است. کیتینازهای آنزیم­های تجزیه­کننده کیتین بوده و عملکردهای مهم بیوفیزولوژیکی و کاربردهای بالقوه فراوانی دارند (5).

 

شکل 1- DNA ایزوله شده از باکتری (چاهک شماره 2) ، محصول PCR ژن کیتیناز (چاهک شماره 3) ، ناقل خطی شده pET26b (چاهک شماره 4)، چاهک شماره 1 مارکر DNA می­باشد (Fermentas, Burlington, Canada).

در این مطالعه، ژن کیتیناز از باکتری  Paenibacillus sp. A01 که از استخرهای پرورش میگو در آبادان جداسازی شده بود؛ با استفاده از آغازگرهای اختصاصی جداسازی و در ناقل بیانی pET26b همسانه­سازی گردید (شکل 1) و توسط شرکت ژن ­فن­آوران تعیین توالی شد. علت انتخاب  ناقل pET26b برای همسانه سازی ژن کیتیناز داشتن مزایایی بود که این ناقل دارای آن می باشد که از جمله آن می توان به داشتن پروموتور قدرتمند T7 برای بیان ژن خارجی اشاره نمود یکی دیگر از مزایای این ناقل، داشتن پپتید نشانه برای انتقال پروتئین نوترکیب به فضا ی پری پلاسمی می باشد، این فضا دارای مزایای متعددی برای بیان پروتئین­های نوترکیب از جمله ایجاد انتهای آمینی صحیح، امکان تاخوردگی بهتر، تشکیل پیوند­های صحیح دی­سولفیدی با وجود شرایط اسیدی در این ناحیه، تعداد کم پروتئاز­ها در محیط پری­پلاسمی و تخلیص ساده­تر پروتئین نوترکیب است (18). سپس در باکتری اشرشیا کلی سویه B121 بیان شد که نتایج به­دست آمده حضور و صحت قرارگیری ژن کیتیناز را در این باکتری تأیید کرد (شکل 1).

 

 

 

جدول 2- خصوصیات فنوتیپی و بیوشیمیایی باکتری Paenibacillus sp. A01

نام باکتری

واکنش گرم

مورفولوژی

تولید رنگدانه

حرکت

متیل رد

تولید اسپور

voges-Proskauer

پروتئاز

آمیلاز

ژلاتیناز

سیتراتاز

Paenibacillus

مثبت

میله ای

سفید

منفی

مثبت

مثبت

مثبت

مثبت

مثبت

منفی

منفی

 

 

تعیین توالی ژن کیتیناز بصورت دو طرفه و به­وسیله پرایمرهای یونیورسال اختصاصی برای ابتدا و انتهای پروموتور T7 انجام گرفت و سپس توالی به دست آمده با توالی ژن های ثبت شده در بانک جهانی NCBI مقایسه شد و نتیجه حاصل نشان داد ژن کیتیناز جدا شده از سویه بومی Paenibacillus sp. A01 دارای 87 درصد همولوژی با ژن کیتیناز chit60 باکتری paenibacillus ehimensis می­باشد. پیش از اقدام برای بیان ژن کیتیناز توالی به­دست آمده از ژن کیتیناز همسانه­سازی شده به­صورت مجازی به توالی اسید آمینه­ای ترجمه شد که پروتئین کامل به دست آمد. سپس آنزیم کیتیناز با استفاده از ستون کروماتوگرافی نیکل خالص گردید که با استفاده از SDS-PAGE و رنگ­آمیزی کوماسی آبی وزن تقریبی 50% را نشان داد (شکل 2). در انتها فعالیت آنزیم کیتیناز به­وسیله رنگ­سنجی با معرف DNS سنجیده شد و تغییر رنگ محیط از رنگ زرد به نارنجی نشان­دهنده فعالیت آنزیم کیتیناز بود (شکل 3).

کیتیناز­ها جهت کنترل آفات با حل کردن غشای پری­تروفیک دستگاه گوارش میانی حشرات و همچنین اسکلت خارجی آنها، کاربرد دارند. کیتیناز­های حشره­ای در حال حاضر جهت کاربرد به عنوان آفت­کش­های بیولوژیکی در تکمیل برنامه­های کنترل و مدیریت آفات و حشرات در دسترس هستند. در سال 1997، Kramer و همکاران، به­منظور استفاده از آنزیم کیتیناز به­عنوان یک آفت­کش گیاهی و حشره­کش، ژن کیتیناز را از کرم تنباکو(Mandula sexta) جدا کردند و برخی خواص فیزیکی، شیمیایی و آنزیمی آن را مورد بررسی قرار دادند.

 

 

شکل 2- بررسی بیان پروتئین نوترکیب کیتیناز باکتری Paenibacillus توسط SDS-PAGE. عصاره باکتریایی قبل از القا (چاهک شماره 2)، عصاره باکتریایی بعد از القا با 1 میلی­مولار IPTG (چاهک شماره 3)، خالص سازی نسبی پروتیین نوترکیب با ستون نیکل سفاروز (چاهک شماره 4). چاهک شماره 1، مارکر پروتیینی است (Fermentas, Burlington, Canada).

 

 

شکل 3- سنجش فعالیت آنزیمی کیتیناز به­وسیله رنگ­سنجی با DNS سمت چپ، شاهد و سمت راست ، نمونه حاوی آنزیم کیتیناز

گیاهان تراریخته­ای که ژن کیتیناز جدا شده از کرم تنباکو به آنها منتقل شده بود، باززایی شدند و نسبت به حشرات و آفات گیاهی از خود مقاومت میزبانی نشان دادند. همچنین ویروس بیماری­زایی در حشرات که توسط این ژن تراریخته شده بود، نسبت به نوع غیر تراریخته آن از خود فعالیت حشره­کش بیشتری را نشان داد (10). Sheng و همکاران در سال 2002، کیتیناز جدیدی را در Bacillus brevis شناسایی و جداسازی کردند که این کیتیناز بر روی ژل اکریل آمید وزن مولکولی 85 کیلو دالتون را نشان داد؛ در حالی که با جوشاندن و تیمار آن با اوره یک مولار در دمای °C50 به مدت 10 دقیقه، این کیتیناز به 48 کیلو دالتون میل می­کرد (14). در سال 2013،  Saima و همکاران نشان دادند که دو گونه باکتریایی A. hydrophila HS4و A. punctata HS6 قادر به تولید مقدار خیلی زیادی کیتیناز در زمان کم هستند و هر دو گونه جدا شده از آئروموناس قادر به تولید کیتیناز بین دمای 22 و 40 درجه سانتیگراد هستند که دمای لازم برای کشت محصول در هند می­باشد که می­توانند جهت ایجاد شرایط لازم برای مقابله با قارچ­های پاتوژن­ گیاهی به­کار روند (11). در سال 2012، Gomaa باکتری­های تجزیه­کننده کیتین را از نمونه­های خاک جداسازی نمود و با انتخابB. thuringiensis  و B. licheniformis، فعالیت رقابتی کیتینازهای تولیدشده را در مقابل بعضی پاتوژن­های قارچی و اثرات آن­ها در افزایش جوانه­زنی دانه سویای آلوده­شده با سایر قارچ­های فیتوپاتوژن بررسی کرد و نشان داد که هر دو گونه مورد مطالعه توانایی لیز دیواره سلولی بسیاری از قارچ­های فیتوپاتوژن را دارند (7). در سال 2017، Thimoteo و همکاران نشان دادند که پایداری و فعالیت MetaChi18A در طیف وسیعی از شرایط بیانگر این است که این کیتیناز شاید برای به­کارگیری در فرایند صنعتی کیتین مفید و مناسب باشد (19).

به­طور کلی نتایج به­دست آمده در این مطالعه نشان­دهنده تجزیه کیتین توسط آنزیم کیتیناز در باکتری
 Paenibacillus sp. A01می­باشد و پیشنهاد می­شود از این باکتری به­منظور تولید انبوه این آنزیم در مصارف صنعتی و کشاورزی از قبیل آفت­کش­های بیولوژیکی استفاده گردد.

تشکر و قدردانی

از پژوهشگاه ملی مهندسی ژنتیک و زیست فناوری به دلیل فراهم آوردن امکانات پژوهش و تحقیق صمیمانه سپاسگزاری می­گردد.

  1. Berini, F., I. Presti, F. Beltrametti, M. Pedroli, K. M. Vårum, L. Pollegioni, S. Sjöling and F. Marinelli (2017). "Production and characterization of a novel antifungal chitinase identified by functional screening of a suppressive-soil metagenome." Microbial Cell Factories 16(1): 16.
  2. Brameld, K. A. and W. A. Goddard (1998). "The role of enzyme distortion in the single displacement mechanism of family 19 chitinases." Proceedings of the National Academy of Sciences 95(8): 4276-4281.
  3. Brunelle, J. L. and R. Green (2014). "Coomassie blue staining." Methods in enzymology 541: 161.
  4. Cardozo, F. A., C. K. Zimpel, A. M. S. Guimaraes, A. Pessoa and I. N. G. Rivera (2016). "Draft genome sequence of marine-derived Aeromonas caviae CHZ306, a potential chitinase producer strain." Genome Announcements 4(6): e01293-01216.
  5. Duo-Chuan, L., S. Chen and L. Jing (2005). "Purification and partial characterization of two chitinases from the mycoparasitic fungus Talaromyces flavus." Mycopathologia 159(2): 223-229.
  6. Emruzi Tubkanlu Z., Aminzadeh S., Karkhanei A.A. and A. J. (2015). "Study of active site adjacent residues on Serratia marcescens B4A chitinase catalytic activity." journal of cellular and molecular researches 28(3): 318-326.
  7. Gomaa, E. Z. (2012). "Chitinase production by Bacillus thuringiensis and Bacillus licheniformis: their potential in antifungal biocontrol." The Journal of Microbiology 50(1): 103-111.
  8. Henrissat, B. (1991). "A classification of glycosyl hydrolases based on amino acid sequence similarities." Biochemical Journal 280(2): 309-316.
  9. Henrissat, B. (1991). "Sequence homology between a beta-galactosidase and some beta-glucosidases." Protein sequences & data analysis 4(1): 61.
  10. Kramer, K. J. and S. Muthukrishnan (1997). "Insect chitinases: molecular biology and potential use as biopesticides." Insect biochemistry and molecular biology 27(11): 887-900.
  11. Kuddus, M. and I. Ahmad (2013). "Isolation of novel chitinolytic bacteria and production optimization of extracellular chitinase." Journal of Genetic Engineering and Biotechnology 11(1): 39-46.
  12. Laemmli, U. K. (1970). "Cleavage of structural proteins during the assembly of the head of bacteriophage T4." nature 227: 680-685.
  13. Leatham, G. F. and M. E. Himmel (1991). Enzymes in biomass conversion, ACS Publications.
  14. Li, S., Z.-A. Zhao, M. Li, Z.-R. Gu, C. Bai and W.-D. Huang (2002). "Purification and characterization of a novel chitinase from Bacillus brevis." ACTA BIOCHIMICA ET BIOPHYSICA SINICA-CHINESE EDITION- 34(6): 690-696.
  15. Neufeld, E. F. and V. Ginsburg (1966). Complex carbohydrates, Academic Press.
  16. Rathore, A. S. and R. D. Gupta (2015). "Chitinases from bacteria to human: properties, applications, and future perspectives." Enzyme research 2015.
  17. Robertus, J. D. and A. F. Monzingo (1998). "The structure and action of chitinases." Exs 87: 125-135.
  18. SC, M. (1996). "Strategies for achieving high-level expression of genes in Escherichia coli." Microbiol Rev 60: 512-538.
  19. Thimoteo, S., A. Glogauer, H. Faoro, E. de Souza, L. Huergo, B. Moerschbacher and F. Pedrosa (2017). "A broad pH range and processive chitinase from a metagenome library." Brazilian Journal of Medical and Biological Research 50(1).
  20. Ueda, M., M. Kojima, T. Yoshikawa, N. Mitsuda, K. Araki, T. Kawaguchi, K. Miyatake, M. Arai and T. Fukamizo (2003). "A novel type of family 19 chitinase from Aeromonas sp. No. 10S‐24." European Journal of Biochemistry 270(11): 2513-2520.
  21. Yamashita, Y. and K. Okazaki (2004). "Purification and antifungal activity of recombinant chitinase from Escherichia coli carrying the family 19 chitinase gene of Streptomyces sp. J-13-3." Bioscience, biotechnology, and biochemistry 68(10): 2193-2196.
  22. Yazdanpanah-Samani M., Zamani M.R., Motallebi M. and M. J. Z. (2015). "Heterologous expression of Chit36 from Trichoderma atroviride in prokaryotic system." journal of cellular and molecular researches 28(3): 447-457.