نوع مقاله: مقاله پژوهشی

نویسندگان

1 گروه علوم گیاهی، دانشکده علوم زیستی، دانشگاه خوارزمی، تهران

2 دانشگاه آزاد شهرکرد

3 گروه میکروبیولوژی، دانشکده علوم، دانشگاه آزاد اسلامی واحد شهرکرد

چکیده

آنزیم چاویکول-O- متیل‌ترانسفراز یک آنزیم کلیدی در مسیر ساخته‌شدن فنیل‌پروپانوئیدها در ریحان (Ocimum basilicum L.) یک گیاه دارویی و معطر از خانواده نعناعیان (Lamiaceae) است. در این پژوهش اثر الیسیتور کیتوزان بر میزان اسانس، ترکیبات فنیل‌پروپانوئیدی و بیان ژن آنزیم چاویکول-O- متیل‌ترانسفراز در گیاه ریحان تحت شرایط تنش خشکی مورد بررسی قرار گرفت. تیمارهای این تحقیق شامل تنش خشکی (نرمال، تنش ملایم و متوسط) و محلول پاشی کیتوزان با غلظت‌های 2/0 و 4/0 گرم در لیتر بودند. میزان متیل‌چاویکول به وسیله کروماتوگرافی گازی (GC) و کروماتوگرافی گازی متصل به طیف سنج جرمی (GC/MS) تعیین شد و سطح بیان ژن چاویکول-O- متیل‌ترانسفراز نیز با روش Semi-quantitative RT-PCR بررسی گردید. نتایج تجزیه واریانس نشان داد میزان اسانس، میزان بیان ژن چاویکول-O- متیل‌ترانسفراز و ترکیب متیل‌چاویکول تحت تأثیر تنش خشکی و الیسیتور کیتوزان در مقایسه با نمونه‌های شاهد افزایش معنی‌داری یافت؛ به‌طوری که بیشترین میزان آن با به‌کارگیری غلظت 4/0 گرم در لیتر از کیتوزان در تنش ملایم یعنی آبیاری در 30 تخلیه رطوبتی از ظرفیت زراعی به‌دست آمد. تغییرات میزان ترکیب متیل‌چاویکول با میزان بیان ژن آنزیم چاویکول– O- متیل ترانسفراز مطابقت داشت، که می‌توان بخشی از این تغییرات را ناشی از تغییر در سطح بیان ژن آنزیم چاویکول-O- متیل‌ترانسفراز درنظرگرفت. بنابراین کیتوزان به عنوان یک الیسیتور زیستی می‌تواند از طریق افزایش بیان ژن و فعالیت آنزیم چاویکول-O- متیل‌ترانسفراز سبب افزایش ترکیبات فنیل‌پروپانوئیدی گیاه ریحان در شرایط تنش خشکی شود.

کلیدواژه‌ها

عنوان مقاله [English]

Effects of chitosan on gene expression of chavicol-O-methyl transferase and phenylpropanoid components of Ocimum basilicum (purple cultivar) under water deficit

نویسنده [English]

  • abdollah ghasemi 2

2 Islamic Azad University, Shahrekord branch

چکیده [English]

Chavicol -O-methyl transferase (CVOMT) is a key enzyme in phenylpropanoid pathway in basil (Ocimum basilicum L.), which is a medicinal and aromatic plant of the Lamiaceae family. In this study, the effect of chitosan elicitor on essential oils yield, phenylpropanoid components and chavicol -O- methyl transfrase gene expression under water deficit was evaluated. The plants under different irrigation regimes were treated with 0.2 and 0.4 g/L chitosan in three stages of growth. Phenylpropanoid compounds were identified by Gas Chromatography and Gas Chromatography/Mass Spectrometry (GC/MS) and the level of gene expression was monitored by Semi quantitative RT-PCR. An analysis of variance indicated that oil yield and CVOMT gene expression and methylchavicol increased under water deficit and chitosan elicitor compared to untreated plants. The changes observed in methylchavicol components were in accordance with the changes of gene expression of chavicol -O-methyl transferase. Thus, chitosan as a biotic elicitor could increase phenylpropanoid components in purple basil by increased gene expression and activity of chavicol -O-methyl transferase.

کلیدواژه‌ها [English]

  • Chitosan
  • Gene expression
  • phenylpropanoid compound
  • purple basil (Ocimum basilicum L.)

اثر کیتوزان بر بیان ژن چاویکول- O- متیل ترانسفراز و ترکیبات فنیلپروپانوئیدی ریحان بنفش L.Ocimum basilicum تحت تنش خشکی

فاطمه ملک پور1،2، عبدالله قاسمی پیربلوطی2*،اعظم سلیمی1 وحسن ممتاز3

1 تهران، دانشگاه خوارزمی، دانشکده علوم زیستی، گروه علوم گیاهی

2 شهرکرد، دانشگاه آزاد اسلامی واحد شهرکرد، مرکز پژوهش­های گیاهان دارویی، گروه گیاهان دارویی

3 شهرکرد، دانشگاه آزاد اسلامی واحد شهرکرد، دانشکده علوم، گروه میکروبیولوژی

تاریخ دریافت: 8/2/94                  تاریخ پذیرش: 19/10/95

چکیده

آنزیم چاویکول-O- متیل­ترانسفراز یک آنزیم کلیدی در مسیر ساخته­شدن فنیل­پروپانوئیدها در ریحان (Ocimum basilicum L.) یک گیاه دارویی و معطر از خانواده نعناعیان (Lamiaceae) است. در این پژوهش اثر الیسیتور کیتوزان بر میزان اسانس، ترکیبات فنیل­پروپانوئیدی و بیان ژن آنزیم چاویکول-O- متیل­ترانسفراز در گیاه ریحان تحت شرایط تنش خشکی مورد بررسی قرار گرفت. تیمارهای این تحقیق شامل تنش خشکی (نرمال، تنش ملایم و متوسط) و محلول پاشی کیتوزان با غلظتهای 2/0 و 4/0 گرم در لیتر بودند. میزان متیل­چاویکول به وسیله کروماتوگرافی گازی (GC) و کروماتوگرافی گازی متصل به طیف سنج جرمی (GC/MS) تعیین شد و سطح بیان ژن چاویکول-O- متیل­ترانسفراز نیز با روش Semi-quantitative RT-PCR بررسی گردید. نتایج تجزیه واریانس نشان داد میزان اسانس، میزان بیان ژن چاویکول-O- متیل­ترانسفراز و ترکیب متیل­چاویکول تحت تأثیر تنش خشکی و الیسیتور کیتوزان در مقایسه با نمونه­های شاهد افزایش معنی­داری یافت؛ به­طوری که بیشترین میزان آن با به­کارگیری غلظت 4/0 گرم در لیتر از کیتوزان در تنش ملایم یعنی آبیاری در 30 تخلیه رطوبتی از ظرفیت زراعی به­دست آمد. تغییرات میزان ترکیب متیل­چاویکول با میزان بیان ژن آنزیم چاویکول– O- متیل ترانسفراز مطابقت داشت، که می­توان بخشی از این تغییرات را ناشی از تغییر در سطح بیان ژن آنزیم چاویکول-O- متیل­ترانسفراز درنظرگرفت. بنابراین کیتوزان به عنوان یک الیسیتور زیستی می­تواند از طریق افزایش بیان ژن و فعالیت آنزیم چاویکول-O- متیل­ترانسفراز سبب افزایش ترکیبات فنیل­پروپانوئیدی گیاه ریحان در شرایط تنش خشکی شود.

واژه­هایکلیدی: بیان ژن، ریحان، فنیل­پروپانوئیدها، کیتوزان

* نویسنده مسئول، تلفن: 03833361010 ، پست الکترونیکی: ghasemi@iaushk.ac.ir

مقدمه

 

ریحان بنفش (Ocimum basilicum L.) یک گیاه دارویی و معطر است که به لحاظ دارا بودن مقدار زیادی اسانس در اندامهای رویشی، کاربرد زیادی در درمان بسیاری از بیماریها از جمله ناراحتیهای کلیوی، سردرد، سرفه، اسهال، بزرگ شدن طحال و برخی ناراحتیهای قلبی دارد (33). از طرف دیگر به خاطر اینکه منبع ترکیبات حلقوی است، عملکرد ضدباکتری، ضدقارچی و آنتی­اکسیدانی دارد و در صنایع غذایی، بهداشتی، آرایشی و غیره نیز کاربرد دارد (23 و 25). اسانس ریحان شامل دوگروه ترپن­ها (لیمونن، کامفور، لینالول، ژرانیول و غیره) و فنیل پروپانوئیدها (اوژنول، چاویکول، متیل چاویکول، سینامات و غیره) است که مخصوصاً ترکیبات فنیل پروپانوئید آن نماینده صفات دارویی در این گیاه است (9 و 22). فنیل پروپانوئیدها، مولکولهای کوچک فنولی هستند که دارای یک حلقه فنیلی و یک زنجیره سه کربنی هستند. این ترکیبات که از مسیر بزرگ فنیل پروپانوئیدی سنتز می­شوند. عامل طعم، بو و مزه در اسانس هستند و نقش مهمی در سازگاری گیاهان و افزایش رقابت آنها در منابع محدود مانند نور و آب با سایر گونه­های گیاهی دارند (6). بسیاری از آنها در دفاع بر علیه گیاهخواران و عوامل بیماریزا نقش دارند و یا در حفاظت مکانیکی، در جذب عوامل گرده افشان و پراکنده کردن میوه یا در کاهش رشد گیاهان رقیب دخالت دارند (36). این ترکیبات در شرایط تنش در گیاه تولید می­شوند.

یکی از مهم­ترین ترکیبات فنیل­پروپانوئیدی اسانس ریحان، متیل­چاویکول یا استراگُل است که یک مشتق آلیل فنول غیرترپنوئیدی است. متیل­چاویکول یک مایع بی­رنگ است که در آب حل نمی­شود و نقطه جوش آن 215 تا 216 درجه سانتی­گراد می­باشد. این ترکیب در صنعت داروسازی و عطرسازی کاربرد دارد و دارای خواص درمانی نظیر خاصیت ضدویروسی، ضدباکتریایی و ضداسپاسم می­باشد و نیز به عنوان حشره کش کاربرد دارد (28 و 29). متیل­چاویکول همچنین در ترکیب داروهایی وجود دارد که در درمان میگرن، سرماخوردگی، استفراغ، اسهال و دل درد به کار می­رود. سنتز متیل­چاویکول به قرار زیر می­باشد: فنیل­آلانین پیش ساز اولیه است، سپس دو مسیر از آن نتیجه می­شود که از مسیر اول چاویکول و متیل­چاویکول و از مسیر دوم اوژنول و متیل اوژنول ایجاد می­شود. در ابتدای مسیر با دِآمینه شدن فنیل آلانین به وسیله آنزیم فنیل آلانین آمونیالیاز (PAL)، سینامیک اسید تشکیل می­شود. در مسیر اول، برای بیوسنتز چاویکول با اضافه شدن هیدروکسیل، پاراکوماریک تشکیل می­شود. سپس شکلهای آلدئیدی و الکلی پاراکوماریک تشکیل شده و در نهایت چاویکول نتیجه می­شود. مرحله انتهایی هم متیله شدن 4-OH چاویکول به وسیله آنزیم چاویکول – O – متیل ترانسفراز (CVOMT) و تشکیل متیل­چاویکول می­باشد (18)، در واقع آنزیم CVOMT با عمل متیلاسیون گروه متیل را به گروه هیدروکسیل موقعیت پارا در مولکول چاویکول اضافه می­کند. در این واکنش S - آدنوزیل L- متیونین (SAM) دهنده گروه متیل است و بنابراین CVOMT یک متیل ترانسفراز وابسته به SAM است (شکل 1).

 

 

شکل 1- مسیر بیوسنتز متیل­چاویکول (18)

 

میزان اسانس ریحان با توجه به شرایط اقلیمی و محل رویش متفاوت است و بین 4/0 تا 5/1 درصد می­باشد (37). علی رغم استفاده وسیع و اهمیت ریحان و اسانس آن در مصرف روزانه اطلاعات کمی از مسیر بیوسنتزی و اثر تنظیمی ترکیبات مؤثر برکیفیت محصول و تولید اسانس وجود دارد. روشهای متعددی برای افزایش تولید متابولیتهای ثانویه وجود دارد. یکی از این روشها که به منظور افزایش تولید متابولیتهای ثانویه از جمله ترپنوئیدها و غیره به کار می­رود، استفاده از الیسیتورهای زیستی و غیرزیستی می­باشد (41 و 42). الیسیتورها ترکیباتی با منشأ زیستی یا غیرزیستی می­باشند که از طریق القای سیستم دفاعی باعث بیوسنتز و انباشت متابولیتهای ثانوی و همچنین تغییرات فیزیولوژیکی و مورفولوژیکی در گیاهان می­شوند. الیسیتورها همچنین ممکن است ژنهای جدیدی را فعال کنند که آنزیمها و در نهایت مسیرهای بیوسنتزی مختلفی را راه اندازی کنند و باعث تشکیل متابولیتهای ثانویه شوند (21 و 39). از الیسیتورهای زیستی می­توان کیتوزان را نام برد که از ترکیبات اصلی دیواره سلولی بسیاری از گونه­های قارچی، میگو، خرچنگ و غیره می­باشد (19) و برای بهبود بخشیدن بیوسنتز متابولیتهای ثانویه در گیاهان دارویی زیادی تأیید شده است (15). کیتوزان یک پلی­ساکارید گلوکوزامین است که از کیتین مشتق شده است. در کشاورزی، کیتوزان به صورت پوشش بر روی بذر، برگ و میوه استفاده می‌شود. همچنین به عنوان کود در کنترل آزاد سازی مواد آگروکمیکال، برای افزایش تولید گیاه، جهت تحریک ایمنی گیاه، برای محافظت گیاه در مقابل میکروارگانیسم‌ها و برای تحریک جوانه‌‌زنی و رشد گیاه استفاده می­شود. کیتوزان در بیوتکنولوژی برای تثبیت آنزیمها و تجزیه کردن پروتئین استفاده می­شود و همچنین در گیاهان دارویی با بیان ژنها در مسیر بیوسنتزی منجر به افزایش تولید متابولیتهای ثانویه می­شود (35). بررسیها نشان داده کیتوزان باعث افزایش سریع و قابل توجهی در میزان مشتقات فنیل­پروپانوئیدی در کشت تعلیقی نارگیل می­شود (12).

از سوی دیگر، کشور ایران در بخشی از کره زمین قرار گرفته که در بسیاری از نقاط آن نزولات جوی نیاز آبی گیاهان زراعی و دارویی را تأمین نمی­کند (2). خشکی یکی از مهم‌ترین عوامل محدود کننده تولید محصولات کشاورزی بوده که تأثیر عمده‌ای بر رشد، نمو و مواد مؤثره گیاهان دارویی دارد (42). تنش خشکی ضمن کاهش محتوای آب در بافتهای گیاهان باعث محدود شدن رشد و برخی تغییرات فیزیولوژیکی و متابولیکی در آنها می گردد و ﻣﻲﺗﻮاﻧﺪ ﺻﺪﻣﺎت ﺳﻨﮕﻴﻨﻲ ﺑﻪ رﺷﺪ و ﻧﻤﻮ و ﻫﻤﭽﻨﻴﻦ ﺑﺮ ﻣﻮاد ﻣﺆﺛﺮه داروﻳﻲ ﮔﻴﺎﻫﺎن وارد نماید (1). بنابراین، تولید متابولیتهای ثانویه در گیاهان به‌وسیله عوامل محیطی تغییر می یابد و تنش رطوبتی نیز عامل مؤثری در سنتز ترکیبات طبیعی گیاهان دارویی می‌باشد (31)، لذا ارائه‌ روشهایی که بتواند گیاهی ماده مؤثره بیشتر تولید نماید، ضروری به نظر می رسد و باید به طور کامل مورد ارزیابی قرار گیرد. از آنجا که در مسیر بیوسنتزی فنیل­پروپانوئیدها، چاویکول –O – متیل ترانسفراز یکی از آنزیمهای نهایی و آنزیم کلیدی مسیر بیوسنتز متیل چاویکول می­باشد و نیز متیل چاویکول از اهمیت کاربردی قابل توجهی برخوردار است،

بنابراین هدف از مطالعه حاضر ارتباط بیان ژن و فعالیت آنزیم CVOMT با تغییرات میزان ترکیبات فنیل پروپانوئیدی از جمله متیل چاویکول تحت تیمار کیتوزان در شرایط تنش خشکی بود. ممکن است مصرف این الیسیتور بتواند راهکاری جهت افزایش و بهبود ماده مؤثره این گیاه در شرایط عادی و خشکی شود.

مواد و روشها

کشت و آماده سازی ریحان: برای انجام این پژوهش بذرهای ریحان بنفش از شرکت پاکان بذر اصفهان تهیه و در اردیبهشت سال 1393 در گلدانهایی حاوی خاک مزرعه با کود حیوانی پوسیده با نسبت 1/3 در مزرعه تحقیقاتی دانشگاه آزاد اسلامی شهرکرد (اقلیم سرد و نیمه خشک بر اساس روش آمبرژه) کشت شدند. در داخل هر گلدان بذرها به تعداد زیاد کاشته و پس از رشد گیاهچه­ها، تنک کردن آنها در طی چند مرحله انجام گرفت. تا یک ماه پس از کاشت بذور (مرحله 6 تا 8 برگی شدن بوته­ها)، گلدانها به طور مساوی آبیاری می­شدند و از این مرحله به بعد، تیمارهای آبیاری اعمال شد که شامل آبیاری در شرایط نرمال، تنش ملایم خشکی آبیاری در زمان تخلیه 30 درصد رطوبت نسبت به ظرفیت زراعی و تنش متوسط آبیاری در زمان تخلیه 60 درصد رطوبت نسبت به ظرفیت زراعی بودند.

تیمار با الیسیتورها: برای استفاده از الیستور زیستی کیتوزان ابتدا پودر آن در استیک اسید 5 درصد حل شد و سپس با استفاده از آب مقطر غلظتهای مختلفی از آن تهیه شد و به صورت محلول­پاشی طی سه مرحله، رویشی (قبل از گلدهی و 50 درصد گلدهی و پایان گلدهی) اعمال شد. سپس اندامهای هوایی گیاه یک هفته پس از اعمال آخرین تیمار کیتوزان به منظور مطالعات، برداشت شد. به این منظور بخش هوایی گیاهان از سطح خاک قطع شدند. بخشی از گیاهان برای آزمایشهای مولکولی در فریزر در دمای 80- درجه سانتی گراد نگهداری شد و بخشی دیگر برای استخراج اسانس در دمای اتاق (25 درجه سانتی گراد) به مدت 2 هفته دور از نور مستقیم خشک شدند.

اسانس گیری: جهت استخراج اسانس گیاه ریحان از روش تقطیر با آب و دستگاه اسانس گیر کلونجر استفاده شد. بدین ترتیب که عمل اسانس گیری در مورد همه تیمارها به مدت سه ساعت ادامه یافت. حجم اسانس به دست آمده به دقت یادداشت شد و در ظرفهای مخصوص تا زمان تجزیه در یخچال نگهداری شد (شکل 2).

تجزیه اسانس با GC-MS((Gas chromatography- Mass spectrometry: برای تجزیه اسانسها، از دستگاه گاز کروماتوگرافی و گاز کروماتوگرافی متصل به طیف سنج جرمی استفاده شد.

 

شکل 2-  نمایی از دستگاه کلونجر

دستگاه Agilent 7890 A و نوع ستون 5% HP-5 MS (طول ستون m30، قطر داخلی ستون  μm 25/0، قطر بیرونی ستون mm25/0). گاز هلیوم با سرعت ml/min 8/0 جریان داشت. دمای اولیه ستون 60 درجه و دمای نهایی ستون 280 درجه بود. افزایش دما تا min4 درجه برنامه ریزی شد. نسبت جداسازی 100:1 تنظیم شد. دمای تزریق کننده 300 درجه بود. خلوص گاز هلیوم 999/99 درصد بود. جهت تزریق نمونه­ها از میزان 1/0 میکرولیتر اسانس با استفاده از سرنگ همیلتون استفاده شد. شناسایی ترکیبات با استفاده از پارامترهای مختلف از قبیل زمان و شاخص بازداری (RI)، مطالعه طیفهای جرمی و مقایسه این طیفها با ترکیبهای استاندارد (10) و اطلاعات موجود در کتابخانه رایانه دستگاه GC-MS صورت گرفت. درصد نسبی هر کدام از ترکیبات تشکیل دهنده اسانس با توجه به سطح نسبی هر کدام از ترکیبات تشکیل دهنده اسانس با توجه به سطح زیر منحنی آن در کروماتوگرام GC به دست آمد.

مطالعه بیان ژن CVOMT: برای استخراج Total RNA از برگ ریحان، از محلول ریمازول همراه با کلروفرم، ایزوپروپانول، اتانول 75 درصد و آب DEPC (دی اتیل پیرو کربنات) استفاده شد. پس از استخراج RNA کل، کیفیت آن به وسیله الکتروفورز ژل آگارز بررسی شد. مرحله بعد از استخراج RNA، سنتز DNA معکوس بود. ساختن cDNA با استفاده از کیت (Cinnagen) و طبق دستور شرکت سازنده آن انجام شد. به منظور بررسی بیان ژن CVOMT از دو دسته آغازگرهای اختصاصی پیشرو و برگشتیاستفاده شد و به عنوان کنترل داخلی نیز از آغازگرهای اختصاصی پیشرو و برگشتی برای تکثیر cDNA ژن توبولین استفاده شد. طراحی آغازگرهای اختصاصی برای ژن CVOMT و Tubulin از طریق Blast search و با استفاده از سایت NCBI صورت گرفت (جدول 1).

 

جدول1- آغازگر طراحی شده برای ژن چاویکول - O- متیل ترانسفراز (CVOMT) و Tubulin

GC

(%)

Tm

(C)

MW

(g/mole)

Primer sequence

Gene name

32

51.8

7592.9

5'CCAATTTCTTCATAGAAGAAAACTC3'

F:CVOMT

47.8

49.8

7032.5

5'GATAAGCCTCTATGAGAGACCTC 3'

R:CVOMT

63.1

50.6

5662

5'GGGGCGTAGGAGGAAAGCA3'

F:Tubulin

40

55.2

5413.5

5'GCTTTCAACAACTTCTTCAG3'

R:Tubulin

 

برای بررسی بیان ژن به صورت نیمه کمی در مقایسه با کنترل داخلی، بیان ژن در چرخه­های متفاوت بررسی شد و پس از ارزیابی نتایج روی ژل بهترین شرایط تعداد 36 چرخه برای بررسی ژن مورد نظر و کنترل داخلی آن انتخاب شد. برای پیدا کردن بهترین دمای اتصال پرایمرها از گرادیان دمایی برای هر کدام از ژنها استفاده شد. چرخه­های مورد استفاده PCR به ترتیب شامل 94 درجه سانتی گراد به مدت 6 دقیقه بود که سپس 36 چرخه با 95 درجه سانتی گراد به مدت 60 ثانیه برای واسرشت شدن، 57 درجه سانتی گراد به مدت 60 ثانیه برای اتصال، 72 درجه سانتی گراد به مدت 1 دقیقه تکثیر و تکثیر نهایی در 8 دقیقه دنبال شد (جدول 2).

 

جدول2- شرایط دمایی و زمانی واکنش PCR

مرحله

دما و زمان مورد استفاده

فعالسازی ابتدایی آنزیم

94 درجه سانتی گراد به مدت 6 دقیقه

واسرشت شدن

95 درجه سانتی گراد به مدت 60 ثانیه

اتصال آغازگرها

57 درجه سانتی گراد به مدت 60 ثانیه

تکثیر

72 درجه سانتی گراد به مدت 60 ثانیه

تکثیر نهایی

72 درجه سانتی گراد به مدت 8 دقیقه

36 چرخه

 

در پایان محصولات PCR بر روی ژل آگارز (1درصد) الکتروفورز مشاهده و عکس­برداری شد. برای ارزیابی کمی بیان ژنها از مقایسه شدت چگالی باندهای ژن نسبت به کنترل داخلی و از نرم افزار Photo capMw استفاده شد. 

تجزیه آماری: کلیه داده­های حاصل از میزان اسانس، ترکیب متیل چاویکول و میزان بیان ژن توسط نرم افزار (version 6.12; SAS Institute, Cary, NC) SAS مورد تجزیه و تحلیل آماری قرار گرفت و مقایسه میانگین داده­ها به روش (General Linear Model)  GLM صورت گرفت. رسم نمودارها نیز در نرم افزار Excel 2010 انجام گرفت.

نتایج

نتایج تجزیه واریانس داده­های حاصل از آزمایش نشان داد که سطوح مختلف تنش خشکی و کیتوزان اثر معنی داری بر بازده اسانس، میزان بیان ژن CVOMT و میزان ترکیب متیل چاویکول دارند (01/0p<). نتایج تجزیه واریانس همچنین نشان داد اثر متقابل خشکی و کیتوزان نیز تأثیر معنی داری بر بازده اسانس، میزان بیان ژن CVOMT و میزان ترکیب متیل چاویکول دارند (جدول3).

تأثیر کیتوزان  و  خشکی بر  میزان  اسانس:  مقدار  کل

اسانس، بر اساس مقدار اسانس موجود در 100 گرم وزن خشک گیاه محاسبه شد.


جدول 3- نتایج تجزیه واریانس تیمارهای مختلف بر بازده اسانس، متیل چاویکول (درصد) و بیان ژن ریحان

منابع تغییر

 (S.O.V)

درجه آزادی (d.f)

میانگین مربعات (M.S)

بازده اسانس

متیل چاویکول

بیان ژن

سطوح آبیاری (I)

2

** 0979/0

**9/142

**192/0

کیتوزان (C)

3

**105/0

**9/120

**687/0

I×C

6

**0412/0

**1/118

**0185/0

خطا

-

0694/0

5/14

0303/0

کل

35

-

-

-

ضریب تغییرات (CV%)

67/1

48/15

12/19

21/10

**: اختلاف معنی دار در سطح یک درصد (01/0p<) 


نتایج تجزیه واریانس داده­ها نشان داد که تعییرات میزان اسانس در تیمارهای مختلف از نظر آماری معنی دار بود (01/0p<). نتایج نشان داد میزان اسانس با افزایش تنش خشکی افزایش می یابد، همچنین نمودار مقایسه میانگین داده­ها نشان داد در همه تیمارهای آبیاری میزان اسانس با به کار بردن غلظتهای مختلف کیتوزان نسبت به نمونه­های شاهد افزایش می یابد و بیشترین میزان اسانس با به کار بردن غلظت 4/0 گرم در لیتر کیتوزان به دست آمد (شکل 3).

 

 

شکل3- میزان بازده اسانس ریحان تحت تأثیر کیتوزان در شرایط مختلف تنش خشکی بر اساس میلی­لیتر اسانس بر صد گرم وزن خشک گیاه (V/W). (C1: آب مقطر، C2: اسید استیک، C3: کیتوزان 2/0 گرم در لیتر و C4: کیتوزان 4/0 گرم در لیتر ، I1: آبیاری 100 درصد  ظرفیت زراعی، I2: آبیاری در حد 60 درصد  ظرفیت زراعی و I3: آبیاری در حد 30 درصد ظرفیت زراعی)(حروف متفاوت روی نمودار نشان دهنده اختلاف معنی دار می­باشد01/0P<).

 

تأثیرکیتوزان و خشکیبرمقدارمتیلچاویکول: آنالیز اسانس به کمک دستگاه GC/MS نشان داد، بیش از 40 ترکیب مختلف در اسانس ریحان بنفش وجود دارد که فراوان ترین آنها عبارتند از: متیل چاویکول، E- سیترال، Z- سیترال و آلفا کادینول که بیش از 50 درصد اسانس ریحان را به خود اختصاص داده اند. متیل چاویکول به عنوان یکی از ترکیبات فنیل پروپانوئیدی، مهم­ترین ماده تشکیل­دهنده اسانس در تمام تیمارها بود. نتایج مقایسه میانگین داده­ها نشان داد مقدار ترکیب متیل­ چاویکول تحت تأثیر تیمار کیتوزان نسبت به نمونه­های شاهد افزایش یافت. از طرف دیگر اعمال تنش خشکی نیز باعث افزایش معنی دار میزان ترکیب متیل چاویکول گردید و در تیمار 4/0 گرم کیتوزان و آبیاری 30 درصد ظرفیت زراعی به بیشترین میزان خود رسید (شکل 4).

 

 

شکل 4- تغییرات مقدار متیل چاویکول تحت تأثیر کیتوزان در شرایط مختلف تنش خشکی بر اساس درصد وزن خشک گیاه (V/W). (C1: آب مقطر، C2: اسید استیک، C3: کیتوزان 2/0 گرم در لیتر و C4: کیتوزان 4/0 گرم در لیتر ، I1: آبیاری 100 درصد  ظرفیت زراعی، I2: آبیاری در حد 60 درصد  ظرفیت زراعی و I3: آبیاری در حد 30 درصد ظرفیت زراعی) (حروف متفاوت روی نمودار نشان دهنده اختلاف معنی دار می­باشد 01/0P<).

 

تأثیر کیتوزان و خشکی بر بیان ژن CVOMT: آنزیم چاویکول–O- متیل ترانسفراز (CVOMT) که عمل متیلاسیون چاویکول را بر عهده دارد، یکی از اعضای خانواده آنزیمیO- متیل ترانسفرازها می­باشد. ژن آن در کرکهای غده ای سپر مانند سطح برگ از بیان بالایی برخوردار است. در این تحقیق آنالیزهای نیمه کمی با نرم افزار Photo capMw و همچنین تجزیه واریانس داده­های حاصل از اندازه گیری بیان ژن CVOMT نشان داد که میزان نسبی بیان ژن مذکور در تیمارهای مختلف به طور معنی داری تغییر نموده است (01/0P<). همان طور که نمودار مقایسه میانگین داده­ها نشان می­دهد، کمبود آبیاری باعث افزایش معنی دار میزان بیان ژن CVOMT می­شود. همچنین در همه تیمارهای آبی میزان بیان ژن CVOMT با به کار بردن غلظتهای مختلف کیتوزان نسبت به نمونه­های شاهد افزایش نشان داد، که بیشترین میزان بیان آن با به کار بردن غلظت 4/0 گرم کیتوزان حاصل شد (شکل5).

 

 

شکل 5- میزان بیان ژن CVOMT تحت تأثیر کیتوزان در شرایط مختلف تنش خشکی. (C1: آب مقطر، C2: اسید استیک، C3: کیتوزان 2/0 گرم در لیتر و C4: کیتوزان 4/0 گرم در لیتر ، I1: آبیاری 100 درصد  ظرفیت زراعی، I2: آبیاری در حد 60 درصد ظرفیت زراعی و I3: آبیاری در حد 30 درصد ظرفیت زراعی) (حروف متفاوت روی نمودار نشان دهنده اختلاف معنی دار می­باشد 01/0P<).

 

بحث

ریحان (Ocimum basilicum) مانند دیگر گیاهان خانواده نعناع، به جهت دارا بودن ماده مؤثره اسانس از اهمیت دارویی زیادی برخوردار است و به طور وسیعی کشت می­شود. تشکیل اسانس در ریحان و ترکیبات آن تحت تأثیر عوامل مختلفی از قبیل فتوسنتز، شدت نور، تنوع فصلی، شرایط اقلیمی، تنظیم کننده­های رشد گیاهی و تنشهای محیطی قرار می­گیرد و میزان سنتز آن تحت تأثیر تنشهای زیستی و غیرزیستی تغییر می­کند (13 و 34) روند دقیق ساخت متابولیتهای ثانویه در گیاهان هنوز به خوبی مشخص نشده است، ولی متابولیتهای ثانویه به طور کلی بازمانده‌های ناشی از فرآیندهای اصلی متابولیسم گیاهان، به ویژه در پاسخ به تنش وارد شده به گیاه محسوب می­شوند (2). نتایج محققان نشان داده است که تنشهای محیطی باعث افزایش سطوح متابولیتهای ثانوی در گیاهان دارویی می‌شود. اگرچه آب یک عامل محدود کننده برای تولید گیاهان می‌باشد، اما تنش خشکی می‌تواند باعث افزایش متابولیت ثانوی در گیاهان دارویی شود. در حقیقت تولید این متابولیتها به عنوان یک راهکار بقاء در برابر تنشهای محیطی مطرح می­باشد. کمبود رطوبت، گیاه را وادار به واکنش­های مختلف متابولیکی و فعالیت ژنهای خاص و غیره می­کند.

به طور کلی همان طور که نتایج این تحقیق نشان می­دهد تنش خشکی باعث افزایش میزان اسانس در گیاه ریحان می­ شود که این نتایج با سایر گزارشات در مورد اثر تنش خشکی بر میزان اسانس، مطابقت دارد. Rizopoulous و Diamantoglon (32) با آزمایش بر روی گیاه Origamum majorana L. بیان کردند که تنش خشکی موجب افزایش میزان اسانس این گیاه شده است. نتایج تحقیقات انجام شده روی گیاه پونه کوهی مکزیکی نشان داد که درصد اسانس این گیاه دارویی با اعمال تنش خشکی افزایش چشمگیری یافت (17). همچنین نتایج این تحقیق با نتایج حاصل شده در نعناع (14) و گشنیز (20) همخوانی داشت. در بررسی اثر رژیمهای رطوبتی روی آویشن بالاترین درصد عملکرد اسانس در شرایط 70 درصد ظرفیت مزرعه ای به دست آمد (26). به طور کلی در شرایط تنش خشکی تولید ماده مؤثره به دلیل جلوگیری از اکسیداسیون درون سلولی افزایش می­یابد.

از جمله عوامل دیگری که می­تواند تشکیل اسانس و ترکیبات را تحت تأثیر قرار دهد الیسیتورها می­باشند. مطالعات متعددی نشان داده اند که ترکیبات اصلی دیواره سلولی بسیاری از گونه­های قارچی، مانند کیتوزان، باعث افزایش میزان متابولیتهای ثانویه می­شود (24 و 30). نتایج مقدار اسانس حاصل از تیمارهای مختلف در این مطالعه، بر حسب میلی لیتر (موجود در 100 گرم گیاه) اندازه گیری شد. تجزیه واریانس داده­ها نشان داد که تغییرات مقدار اسانس در تیمارهای مختلف از نظر آماری معنی دار بود ((P< 0.01. بررسیها نشان داد که بیشترین میزان اسانس تحت شرایط تنش خشکی و با به کار بردن غلظت 4/0 گرم کیتوزان حاصل شد.

همان­طور که نتایج این تحقیق نشان می­دهد غلظتهای مختلف الیسیتور نیز باعث افزایش میزان اسانس گیاه ریحان می­شوند. غلظت الیسیتور نقش مهمی در فرآیند تحریک دارد و عامل مؤثری بر شدت پاسخ است. غلظت مؤثر الیسیتور نیز بر حسب گونه گیاهی فرق می کند، به طوری که غلظتی از الیسیتور که در یک گیاه اثر تحریکی دارد، ممکن است در گیاه دیگر اثر نداشته باشد. در این مطالعه میزان اسانس با افزایش غلظت کیتوزان به طور معنی داری افزایش نشان داد. به نظر می­رسد ترکیبات فعال الیسیتورهای زیستی نقش مؤثری در افزایش تولید متابولیتهای ثانوی دارند. هر چند الیسیتورهایی مانند کیتین و کیتوزان به طور گسترده در تولید متابولیتهای ثانویه به کار گرفته شده اند (24 و 30) . با این حال مکانیسم اثر الیسیتورهای زیستی بر تولید متابولیتهای ثانوی در گیاه به خوبی شناخته نشده است. به طور کلی الیسیتورها با تحریک سیگنالهای سلولی و برهمکنش مولکولی میان گیرنده­های گیاهی در سطح غشای سلولی یا سیتوپلاسمی موجب شناسایی آنها می­شوند. در نتیجه سیگنال دریافتی توسط سلولهای گیاهی، بیان ژنهای مرتبط در مسیر را تحریک می­کنند و موجب سنتز متابولیتهای ثانویه در گیاهان می­شوند (40). ساز و کارهای متعددی چون پیام رسانهای Ca2+، فاکتورهای مؤثر بر نفوذپذیری دیوارة سلولی، بازدارندگی و فعال­سازی مسیرهای درون سلولی، تغییرات سریع در پروتئینها از طریق فسفریلاسیون و فعال سازی پروتئین کینازها و تغییرات در استرسهای اسمزی و ... در این مسیر فرض می­شوند. البته تمام الیسیتورها چنین مسیرهای پیوسته­ای را طی نمی­کنند و موارد مختلفی از جمله منبع الیسیتور، اختصاصی بودن آن، غلظت الیسیتور، مرحله رشدی گیاه، زمان افزودن الیسیتور و مدت زمانی که گیاه در معرض الیستور قرار می­گیرد، بر افزایش تولید متابولیتهای ثانوی تأثیر می گذارد (11و 38). نتایج حاصل از بررسی میزان ترکیبات اسانس با دستگاه GC/MS نشان داد ترکیب غالب اسانس گیاه ریحان متیل چاویکول می­باشد، گرچه میزان نسبی آن در تیمارهای مختلف متفاوت بود. غلظتهای مختلف کیتوزان باعث افزایش میزان ترکیب متیل چاویکول در گیاه ریحان می­شود. در یک مطالعه (16)، میزان ترکیب متیل­چاویکول 48 ساعت پس از اضافه کردن کیتوزان 25 درصد افزایش نشان داد. همچنین، در یک مطالعه رجب بیگی و همکاران (3) با استفاده از الیسیتورهای فیزیکی مانند میدانهای الکترومغناطیسی با فرکانس 1 kHz باعث افزایش میزان متیل چاویکول در گیاه ریحان شدند. از طرف دیگر در طی مطالعات مشخص شده است که عوامل محیطی و استرس­زا مثل تنش خشکی همواره ترکیب شیمیایی و اسانس گیاهان را تحت تأثیر قرار می­دهند. در بعضی از گزارشها به افزایش سنتز متابولیتهای ثانویه خاص در شرایط تنش خشکی اشاره شده است. زهتاب سلماسی (4) اعلام کرد که درصد اسانس و آنتول دانه­های انیسون با عرضه آب قابل استفاده رابطه عکس داشت، بدین ترتیب که با کاهش آب آبیاری درصد اسانس و آنتول افزایش داشت. بالاترین میزان تیمول در آویشن باغی در 70 درصد ظرفیت مزرعه­ای حاصل شد (27). میزان کارواکرول در مرزه تحت تنش خشکی ملایم 2 برابر گیاهان تحت ظرفیت زراعی بود (7). در بابونه کبیر وقتی دور آبیاری از 3 روز به 9 روز یک بار افزایش یافت، میزان اسانس و به ویژه پارتنوئید آن افزایش معنی داری داشت (5).

تغییرات کمی بیان ژن CVOMT تحت اثر تیمار کیتوزان در شرایط تنش و غیر تنش در شکل 3 نشان داده شده است. نتایج بررسی بیان ژن چاویکول- O- متیل ترانسفراز (CVOMT) در این مطالعه، بیانگر این است که بیان ژن CVOMT تحت تنش خشکی افزایش معنی داری داشت. از طرف دیگر غلظتهای مختلف الیسیتور کیتوزان نیز باعث افزایش بیان این ژن نسبت به نمونه­های شاهد گردید و بیان ژن مورد بررسی را نسبت به شاهد چه در شرایط تنش و چه در شرایط غیر تنش افزایش داد. CVOMT که عمل متیلاسیون چاویکول را بر عهده دارد، یکی از اعضای خانواده آنزیمی O- متیل ترانسفرازها می باشد و در کرکهای غده ای سپر مانند سطح برگ ریحان، از بیان بالایی برخوردار می­باشد. مطالعات بر روی ژن آنزیمهای خانواده  O- متیل ترانسفراز در گیاهان مختلف تا حدی صورت گرفته و تأثیر تیمارهای مختلف بررسی شده است، به طور مثال Simon و Deshamps (34) گزارش کردند تیمارهای شیمیایی مانند متیل جاسمونات و متیل سالیسیلات بیان ژن آنزیمهای O- متیل ترانسفراز CVOMT را در ریحان افزایش می­دهند. نادری و همکاران (8) نیز افزایش بیان ژن CVOMT را در غلظتهای مختلف کیتوزان گزارش کردند که نتایج آن با مطالعات حاضر هماهنگی دارد. همچنین گزارش شده است که عوامل مختلف بر روی بیان ژن این آنزیمها تأثیر دارند، از جمله Gang و همکاران (18) گزارش نمودند که سن گیاه می­تواند عامل تأثیرگذاری باشد. مطالعات اندکی در مورد اثر تنشهای محیطی و الیسیتورها بر میزان بیان ژنهای مسیر فنیل پروپانوئیدی از جملهCVOMT صورت گرفته است. تحقیق حاضر نخستین گزارش در رابطه با تأثیر تنش خشکی و کیتوزان بر بیان ژن CVOMT در گیاه ریحان می­باشد که مشخص کرد تنش خشکی باعث افزایش بیان این ژن در ریحان می­شود و همچنین اثر توأم خشکی و کیتوزان نیز موجب افزایش معنی دار بیان این ژن می­شود.

از طرفی در این مطالعه مشخص گردید، روند تغییرات ترکیبات فنیل پروپانوئیدی، همچون متیل چاویکول، با روند تغییرات میزان بیان ژن CVOMT در تیمارهای مختلف مطابقت دارد، به طوری که با افزایش بیان ژن CVOMT، مقدار متیل چاویکول گیاه نیز افزایش می­یابد. افزایش میزان متیل چاویکول در این مطالعه مؤید این مطلب است که تأثیر تیمارهای کیتوزان به طور غیرمستقیم و با میانجیگری پروتئینهای آنزیمی از جمله CVOMT انجام می­گیرد و به طور کلی مطابق با نتایج تحقیقات گذشته است که گزارش نمودند الیسیتورها بر بیان ژن چاویکول O- متیل ترانسفراز تأثیر دارند.

نتیجه گیری کلی 

به­طورکلی، بالاترین میزان اسانس در تیمار 30 درصد ظرفیت­زراعی و به­کارگیری 4/0 گرم­ در لیتر کیتوزان به دست آمد. ماده مؤثره متیل­چاویکول نیز تحت شرایط خشکی و به­کار بردن الیسیتورها افزایش یافت. میزان بیان ژن چاویکول – O- متیل­ترانسفراز نیز تحت تأثیر الیسیتور کیتوزان و تنش خشکی قرار گرفت و با به­کار بردن الیسیتور کیتوزان در غلظت 4/0 گرم­در لیتر افزایش یافت. با توجه به اهمیت اقتصادی متابولیتهای گیاهی و افزایش تقاضا برای آنها، می­توان با استفاده از روشهای زیست فناوری، تولید متابولیتهای با ارزش در گیاهان را افزایش داد و از الیستورها به عنوان ابزاری برای افزایش اسانسها و ترکیبهای مفید دارویی در گیاهان استفاده نمود. بنابراین، بر اساس نتایج حاصل از این تحقیق می­توان از کیتوزان به عنوان الیسیتور زیستی کارآمد، که از طریق القای بیان ژن خاص باعث بهبود بخشیدن بیوسنتز متابولیتهای ثانوی خاص می­شود، در بسیاری از گیاهان دارویی استفاده کرد و به نظر می­رسد این گامی با ارزش در جهت مهندسی متابولیت و تولید داروهای گیاهی با ارزش باشد. از آنجایی که متیل چاویکول در صنعت داروسازی و عطرسازی کاربرد دارد و دارای خواص درمانی نظیر خاصیت ضدویروسی، ضدباکتریایی و ضداسپاسم می­باشد، می­توان از الیسیتور کیتوزان برای افزایش خصوصیات درمانی ریحان بهره جست و میزان متیل چاویکول را در گیاه افزایش داد و همچنین پیشنهاد می شود این تیمار برای تولید تجاری اسانس در این گیاه در نظر گرفته شود.

1- امیدبیگی، ر، (1379)، رهیافت­های تولید و فرآوری گیاهان دارویی، جلد سوم، انتشارات فکر روز، 397 صفحه.

2- حسنی، ع، و امیدبیگی، ر، (1381)، اثرات تنش خشکی بر برخی خصوصیات مورفولوژیکی، فیزیولوژیکی و متابولیکی گیاه ریحان، مجله دانش کشاورزی 59-47 :(3)12.

3- رجب بیگی، ا، قناتی، ف، سفیدکن ف، عبدالملکی، پ، (1385)، بررسی تغییرات اسانس گیاه ریحان (Ocimum basilicum L.)  تحت تاثیر میدان الکترومغناطیسی، تحقیقات گیاهان دارویی و معطر ایران: (4)22: 341 -350.

4- زهتاب سلماسی، س، (1380)، بررسی اثرات اکوفیزیولوژیک آبیاری و تاریخ کاشت بر روی رشد، عملکرد، اسانس و آنتول در گیاه دارویی انیسون، پایان نامه دکتری زراعت و اصلاح نباتات، دانشگاه تبریز، ایران.

5- سحرخیز، م، ج، امیدبیگی، ر، و سفیدکن، ف، (1386)، اثر سطوح مختلف فسفر و دور آبیاری بر متابولیتهای ثانویه گیاه دارویی بابونه کبیر، سومین همایش گیاهان دارویی ایران، دانشگاه شاهد، تهران، 3-2 آبان: 5.

6- قاسمی، ع، (1389)، گیاهان دارویی و معطر (شناخت و بررسی اثرات آن­ها)، انتشارات دانشگاه آزاد اسلامی،  شهرکرد، 540 صفحه.

7- قربانلی، م، باهر، ز، میرزا، م، و رضایی، م، ب، (1380)، بررسی برخی از پارامترهای رشد و تغییرات کمی و کیفی ترکیبات موجود در اسانس مرزه، تحت تأثیر رژیمهای مختلف آبیاری در طی دور­ه­های رشد زایشی، پژوهش و سازندگی، 52: 45-40.

8- نادری، ص، فاخری، ب، اسمعیل زاده بهابادی، ص، (1393)، افزایش بیان ژن چاویکول O- - متیل ترانسفراز و فعالیت آنزیمهای کاتالاز و آسکوربات پراکسیداز گیاه Ocimum basilicum L. تحت تأثیر کیتوزان، مجله علمی پژوهشی زیست فناوری گیاهان زراعی، 6: 9-1.

 

9- Achnine, L., Blancaflor, E.B., Rasmussen, S., Dixon, R.A., (2004), Colocalization of phenylalanine ammonia-lyase and cinnamate 4-Hydroxylase for metabolic channeling in phenylpropanoid biosynthesis. Plant Cell, 16: 3098-3109.

10- Adams, R.P., (2007), Identification of essential oil components by gas chromatography⁄ quadrupole mass spectroscopy. Illinois: Allured Publishing Corporation, Carol Stream.

11- Angelova, Z., Georgiev, S. and Roos, W., (2006), Elicitation of plants. Biotechnology & Biotechnology, 20 (2): 72-83.

12- Chakraborty, P., Hossain, Sk. U., Murmu, N., Das, J. and Khattacharya, S., (2009), Modulation of Cyclophosphamide- Induced Cellular Toxicity by Diphenylmethyl Selenocyanate In vivo, an Enzymatic Study, Journal of Cancer Molecules, 4(6): 183-189.

13- Chalchat, J-C. and Ozen, M., (2008), Comparative essential oil composition of flower, leaves and stems of basil (Ocimum basilicum L.) used as herb. Food Chemistry, 110: 501-503.

14- Charles, D. J., Joly, R. J. and Simon, J. E., (1990), Effects of osmotic stress on the essential oil content and composition of peppermint. Phytochemistry 29: 2837-2840.

15- Cheng, X., Zhou, U., Cui, X., (2006), Improvement of phenylethanoid glycosides biosynthesis in Cistanche deserticola cell suspension cultures by chitosan elicitor, Biotechnology Journal, 121: 253–260.

16- Deschamps, C., Raskin, I. and Simon, J. E., (2008), Regulation of Essential Oil accumulation in Basil (Ocimum basilicum L.) in Response to Elicitation. International Journal of Plant Sciences, 169(8): 981-986.

17- Dunford, N.T. and Vazquez, R.S., (2005), Effect of water stress on plant growth and thymol and carvacrol concentrations in Mexican oregano grown under controlled conditions. Journal of Applied Horticulture, 7(1): 20-22.

18- Gang, D.R., Wang, J., Dudareva, N., Nam, K. H., Simon, J. E., Lewinsohn, E. and Pichersky, E., (2001), An investigation of the storage and biosynthesis of phenylpropenes in sweet basil. Plant Physiology, 125: 539-555.

19- Goorge, A. and Roberts, F., (1992), "Chitin Chemistry" In Senior Lecture in Dyeing Nottingham Polytechnic; 349p, The Macmilan press LTD. London.

20- Hamrouni, I., Salah, H. and Marzouk, B., (2001), Effects of water-deficit on oil of coriander aerial parts. INRST, Laboratoire d'Adaptation et d'Amelioration des Plants, BP 95 2050, Hammam-Lif, Tunisia, 95: 21-52.

21- Howlett, B., (2006), Secondary metabolite toxins and nutrition of plant pathogenic Fungi. Current Opinion in Plant Biology, 9: 371–375.

22- Iijima, Y., Rikanati, R.D., Fridman, E., Gang, D.R., Bar, E., Lewinsohn, E. and Pichersky, E., (2004), The biochemical and molecular basis for the divergent in the biosynthesis of terpenes and phenylpropenes in the peltate gland of three cultivars of basil. Plant Physiology, 136: 3724-3736.

23- Juliani, H. R., and Simon, J. E., (2002), Antioxidant activity of Basil, Trends in new crops and new uses, 575- 579.

24- Kang, S.M., Jung, H.Y. Kang, Y.M. and Yu, D.J., (2004), Effects of methyl jasmonate and salicylic acid on the production of tropane alkaloids and the expression of PMT and H6H in adventitious root cultures of Scopolia parviflora. Plant Science, 166: 745-751.

25- Labra, M., Miele, M., Ledda, B., Grassi, F., Mazzei, M. and Sala, F., (2004), Morphological characterization, essential oil composition and DNA genotping of Ocimum basilicum L. cultivars, Plant Science, 167: 725-731.

26- Letchamo, W. and Gosselin, A., (1996), Transpiration, essential oil glands, epicuticularwax and morphology of Thymus vulgaris are influenced by light intensity and water supply. Journal of Horticultural Science, 71(1): 123-134.

27- Letchamo, W., Marquard, R., Holzl, J. and Gosselin, A., (1994), Effect of water supply and light intensity on growth and essential oil of two Thymus vulgaris selection. Angewandte Botanik, 68, (3-4): 83-88.

28- Leung, A.Y., (1980), Encyclopedia of common natural ingredients used in food, drugs, and cosmetics, 241-245. John Wiley and Sons, New York.

29- Okundada, A.L. and Olaifa, J.A., (1987), Estragole: an acute toxic principle from the volatile oil of the leaves of Clausena anisata. Journal of Natural Products, 50: 990-991.

30- Pu, G.B., Dong-Ming, M., Chen, J.L. and Ma, L.Q., (2009), Salicylic acid activates artemisinin biosynthesis in Artemisia annua L. Plant Cell Reports 28(7): 1127–1135.

31- Reddy, A.R., Chaitanya, K.V. and Vivekanandan, M., (2004), Drought induced responses of photosynthesis and antioxidant metabolism in higher plants. Journal of Plant Physiology 161: 1189-1202.

32- Rizopoulous, S. and Diamantoglon, S., (1991), Water stress, induced diumal variation in leaf water relation stomatal conductance, soluble sugar, lipids and essential oil content of Origanum majorana L. Journal of Horticultural Science, 66: 119-250.

33- Sajjadi, S.E., (2006), Analysis of the essential oils of two cultivated Basil (Ocimum basilicum L.) from Iran, DARU, Journal of Pharmaceutical Sciences, 14 (3): 128-130.

34- Simon, J.E. and Deshamps, C., (2002), Regulation of essential oil biosynthesis in basil (Ocimum basilicum L.). Prude University, Ph.D Thesis.

35- Suchada, B., Meechouib, S. and Sarobol, E.D., (2010), Physiological and morphological responses of field corn seedlings to chitosan under hypoxic conditions. Science Asia, 36: 89–93.

36- Taiz, L. and Zeiger, E., (2006), Plant Physiology, 4th Edition. 260-287. Sinauer Associates Inc. Sunderland, Massachusetts. USA

37- Telci, I., Bayram, E., Yilmaz, G. and Avci, B., (2006), Variability in essential oil composition of Turkish basils (Ocimum basilicum L.). Biochemical Systematics and Ecology, 34: 489-497.

38- Vasconsuelo, A. and Boland, R., (2007), Molecular aspects of the early stages of elicitation of secondary metabolites in plants. Plant Science, 172: 861-875.

39- Zhang, Y., Mian, M.R., Bouton, J.H., (2006), Recent Molecular and Genomic Studies on Stress Tolerance of Forage and Turf Grasses. Crop Science, 46: 497–511.

40- Zhao, J. and Sakai, K., (2003), Multiple signaling pathways mediate fungal elicitor-induced betathujaplicin biosynthesis in Cupressus lusitanica. Cell Cultures, 4: 647-656.

41- Zhao, J., Davis, L.C. and Verpoorte, R., (2005), Elicitor signal transduction leading to production of plant secondary metabolites. Biotechnology Advances, 23: 283-333.

42- Zhu, L.W., Zhung, J.J. and Tang, Y.J., (2008), Significance of fungal elicitors on the production of ganoderic acid and Ganoderma polysaccharides by the submerged culture of medicinal mushroom Ganoderma lucidum. Process Biochemistry, 43: 1359-1370.