نوع مقاله: مقاله پژوهشی

نویسنده

هیات علمی گروه گیاهپزشکی دانشگاه ایلام

چکیده

سپتوریوز برگ گندمSeptoria tritici blotch (STB) یکی از مهمترین بیماری‌های گندم در استان ایلام می باشد. برای تعیین تنوع ژنتیکی بیمارگر در مزارع گندم استان ایلام تعداد 44 نمونه آلوده از مزارع مناطق مختلف جمع‌آوری گردید. پس از کشت، خالص‌سازی و شناسایی جدایه‌ها، آزمون مولکولی با استفاده از پنج جفت آغازگر ریزماهواره انجام گردید. از آغازگرهای ریزماهواره 22 آلل در جدایه‌ها تکثیر کردند. میانگین تعداد آلل در هر جایگاه 4/4 می باشد. تنوع ژنتیکی جمعیتها دارای دامنه 138/0 تا 166/0 و میانگین 154/0 بودند. بر اساس دندروگرام در سطح تشابه 54/0 درصد، جدایه‌ها در 18 گروه قرار گرفتند. نتایج تجزیه واریانس مولکولی نشان داد که 98 درصد از تنوع ژنتیکی در بین کلیه جدایه‌ها و تنها 2 درصد آن به مناطق مختلف جغرافیایی اختصاص دارد. بنابراین بین جدایه‌ها از مناطق مختلف شباهت ژنتیکی بالایی وجود داشت. شباهت ژنتیکی بالا را می توان به مهاجرت ژن یا ژنوتیپ در اثر عوامل مختلف نسبت داد.

کلیدواژه‌ها

موضوعات

عنوان مقاله [English]

Study of genetic diversity of Septoria tritici isolates from wheat fields in Ilam province using SSR marker

نویسنده [English]

  • Khoshnood Nourollahi

scientific board

چکیده [English]

Septoria tritici blotch (STB) caused by Septoria tritici is one of the most important wheat diseases in Ilam Province. In order to determine genetic diversity of pathogen, 44 samples were collected from wheat fields of different regions in Ilam province. Molecular test was carried out with a set of five pairs of SSR primers after purification and identification of isolates. The SSR primers amplified a total 22 alleles among isolates. The average of allele number was 4.4 per each primer. Genetic diversity of the populations ranged from 0.138 to 0.166 with an average of 0.154. Cluster analysis based on UPGMA method and Dice coefficient, divided the isolates into 18 groups at 0.54% similarity level. Result of AMOVA showed that 98% of genetic diversity was in relation to isolates and only 2% was in related to different geographical regions. Therefore there is the high genetic similarity between isolates from different geographic regions. High genetic similarity can be attributed to emigration of gene or genotype as a result of various factors.

کلیدواژه‌ها [English]

  • Genetic diversity
  • Septoria tritici
  • SSR
  • Wheat

مطالعه تنوع ژنتیکی جدایه های Septoria tritici از مزارع گندم استان ایلام با استفاده از نشانگر SSR 

خشنود نوراللهی

ایلام، دانشگاه ایلام، گروه گیاه پزشکی

تاریخ دریافت: 17/5/94                تاریخ پذیرش: 25/11/94

چکیده

سپتوریوز برگ گندمSeptoria tritici blotch (STB)  یکی از مهم ترین بیماریهای گندم در استان ایلام می باشد. برای تعیین تنوع ژنتیکی بیمارگر در مزارع گندم شهرستانهای دهلران و مهران استان ایلام تعداد 44 نمونه مشکوک به آلودگی از مزارع مناطق مختلف جمع‌آوری گردید. پس از کشت، خالص‌سازی و شناسایی جدایه‌ها، تنوع جدایه ها با استفاده از پنج جفت آغازگر ریزماهواره انجام گردید. از آغازگرهای ریزماهواره 22 آلل در جدایه‌ها تکثیرگردید. میانگین تعداد آلل در هر جایگاه 4/4 می باشد. تنوع ژنتیکی جمعیتها دارای دامنه 138/0 تا 166/0 و میانگین 154/0 بودند. بر اساس دندروگرام رسم شده براساس روش UPGMA و ضریب دایس، در سطح تشابه 54/0 درصد، جدایه‌ها در 18 گروه قرار گرفتند. نتایج تجزیه واریانس مولکولی نشان داد که 98 درصد از تنوع ژنتیکی در درون جمعیتها و تنها 2 درصد آن به بین جمعیتها از مناطق مختلف جغرافیایی اختصاص دارد. بنابراین بین جدایه‌ها از مناطق مختلف شباهت ژنتیکی بالایی وجود داشت. شباهت ژنتیکی بالا را می توان به مهاجرت ژن یا ژنوتیپ در اثر عوامل مختلف نسبت داد.

واژه های کلیدی: تنوع ژنتیکی، Septoria tritici، SSR، گندم

نویسنده مسئول، تلفن: 09186396733 ، پست الکترونیکی: k.nourollahi@ilam.ac.ir

مقدمه

 

سپتوریوز برگ گندم با نام انگلیسی Septoria tritici blotch (STB) یکی از بیماریهای مهم مناطق کشت گندم در دنیاست، قارچ عامل بیماری در فرم جنسی Mycosphaerella graminicola (Fückel) J. Schröt in Cohn و در فرم غیر جنسی Zymoseptoria tritici (Desm.) Quaedvlieg et al., 2011)  نامیده می شود (11، 12 و 39). فرم جنسی قارچ اولین بار توسط ساندرسون در سال 1972 در نیوزلند شناسایی شد (33)، سپس از کشورهای استرالیا، برزیل، هلند، انگلیس، آمریکا و کانادا  گزارش گردید (11 و 14). میزان خسارت حاصل از این بیماری در شرایط مناسب با رطوبت نسبی بالا (85 درصد) و دمای بهینه 22 درجه سانتی گراد از 30 تا 70 درصد در ارقام حساس گندم گزارش شده است (11 و 17). این بیماری برای اولین بار توسط دسمازیرس (9) از فرانسه و پس از آن از سایر نقاط دنیا گزارش گردید. این بیماری در ایران اولین بار توسط پتراک و اسفندیاری (33) و بعد توسط  شریف و ارشاد (40) از مناطق گندم خیز کشور گزارش شده است (42). تغییر الگوی کشت، تراکم بالای بذر، افزایش استفاده از  کودهای ازته و کشت تک محصولی با تعداد محدودی از ارقام گندم باعث افزایش شیوع بیماری می گردد (5). با استفاده از مدیریت تلفیقی شامل ارقام مقاوم، تناوب زراعی، کاربرد مناسب کودها و قارچ کشها و تراکم مناسب بذر در کاهش خسارت بیماری مؤثر می باشد (36). آگاهی از تنوع ژنتیکی جمعیتهای قارچ عامل بیماری و وضعیت تولید مثل جنسی و غیر جنسی آن در داخل جمعیتهای قارچ در بهبود روشهای مدیریت پایدار این بیماری برای اصلاح و انتخاب ارقام مقاوم، از اهمیت زیادی برخوردار است (24 و 38). استفاده از نشانگرهای مولکولی برای مطالعه جمعیت قارچهای بیمارگر گیاهی مختلف، ارتباط فیلوژنتیکی بیمارگرها و همچنین مطالعات ژنتیک جمعیت رو به افزایش است (6، 8، 16، 18، 20، 23 و 26). تنوع ژنتیکی S. tritici با استفاده از نشانگر RAPD (34 و 35) و سایر نشانگرها (26) در سایر نقاط جهان بررسی شده است، ولی گزارش در زمینه تنوع ژنتیکی این قارچ در ایران محدود است. تنوع ژنتیکی جمعیتهای قارچ M. graminicola با تعداد جدایه های مختلف و نشانگرهای مختلفی مورد مطالعه قرار گرفته است (6، 19، 25، 34، 35، 38 و 44). در این زمینه برای مطالعه تنوع ژنتیکی جمعیتهای کنزاس قارچ
M. graminicola در سطوح مختلف کوچک، بزرک و ایالتی از نشانگرهای AFLP استفاده شد (15). مدینی و حمزه (27) از نشانگر AFLP برای تنوع ژنتیکی جدایه های  M. graminicola از تونس، الجزایر و کانادا استفاده نمودند و تنوع ژنتکی بالایی را در این مناطق گزارش کرده اند. مطالعات قبلی نشان داده که نمونه های جمعیتهای M. graminicola در اندازه جغرافیایی کوچک در یک مزرعه با تنوع ژنتیکی بالایی همراه بوده اند (22،21). جورجنز و همکاران (14) با بررسی ساختار ژنتیکی جمعیتهای قارچ M. graminicola در ایران، فلسطین اشغالی، آرژانتین و استرالیا گزارش نمودند که جمعیت جمع‌آوری شده از فلسطین اشغالی بیشترین تنوع ژنتیکی را داشت اما جمعیتی که از منطقه دزفول در استان خوزستان ایران جمع‌آوری شده بودند کمترین تنوع ژنتیکی معادل 26/0 را داشت و هاپلوتیپهای مشابه در داخل جمعیت فوق زیاد بود. کمیجانی و همکاران (18) نیز به منظور بررسی تنوع ژنتیکی و تعیین میزان نزدیکی ژنتیکی جدایه‌های قارچ عامل بیماری در ایران، 58 جدایه از هفت استان کشور را با استفاده از نشانگر rep-PCR، مطالعه کردند و نشان دادند که 56 جدایه بیش از 50 درصد از نظر ژنتیکی از همدیگر متفاوت بودند و اغلب جدایه‌هایی که با همدیگر مشابه بودند از یک منطقه جغرافیایی بودند. ابرین بنا و همکاران (1) 221 جدایه از پنج استان کشور را با استفاده از نشانگر AFLP و ژنگاه تیپ آمیزشی بررسی کردند. با توجه به اهمیت زیاد و خسارت زا بودن این بیماری در استانهای مختلف اتخاذ راهبردهای مناسب برای مدیریت بیماری ضروری دانسته شده است. عامل بیماری سپتوریوز غلات در طول فصل رشد و در مناطق با میزان بارندگی بالا باعث کاهش عملکرد به میزان 30 تا 40 درصد می‌شود. به علت شرایط آب و هوایی مناسب در مناطق جنوب کشور و در شهرستانهای مهران و دهلران استان ایلام، خسارت بسیار بالا و در بعضی از مزارع بالاتر از 30 درصد گزارش شده است. با توجه به سطح زیر کشت بالای گندم و کشت اصلی گندم در این مناطق و وجود کانونهای آلودگی، گاهی میزان خسارت بسته به شرایط آب و هوایی تا 100 درصد هم می‌رسد که از لحاظ اقتصادی خسارت جبران ناپذیری به کشاورزان منطقه و به دنبال آن استان و کشور وارد می‌گردد. هدف از انجام این مطالعه بررسی ساختار ژنتیکی و تنوع جمعیت قارچ M. graminicola با نشانگر مولکولیSimple Sequence Repeats (SSR)  در مناطق نمونه برداری است که اطلاعات مفیدی را در مورد میزان تغییرپذیری بیمارگر عامل بیماری به دست می­دهد و چنین اطلاعاتی در اصلاح ارقام مقاوم به بیماری در جهت افزایش پایدار عملکرد گندم کمک می­کند.

مواد و روشها 

نمونه برداری: در این بررسی در بهار 1390 ضمن بازدید از مناطق شیوع بیماری از مزارع گندم شهرستانهای مهران و دهلران استان ایلام، از گیاهانی که دارای علائم آلودگی به صورت زخمهای کلروتیک، نکروتیک و وجود پیکنیدهای سیاه رنگ بر روی برگها بوده به صورت تصادفی و حرکت زیگزاگی نمونه‌برداری صورت گرفت. برای تسهیل در آنالیز ساختار ژنتیکی جمعیتها، نمونه های به دست آمده (بسته به فاصله مزارع آلوده از همدیگر از 500 متر تا 3 کیلومتر) در جمعیتهای مختلف قرار داده شدند (جدول1). نمونه­ها در پاکتهای کاغذی به آزمایشگاه منتقل شده و برای جداسازی قارچ در دمای 4 درجه سانتی گراد در یخچال نگهداری شدند.

جدول 1 - مشخصات جدایه‌های قارچ  Septoria tritici به دست آمده از مناطق مختلف نمونه برداری

ردیف

کد جدایه

کد جمعیت

شهرستان

1

ISO1

P1

دهلران

2

ISO2

P1

دهلران

3

ISO3

P1

دهلران

4

ISO4

P1

دهلران

5

ISO5

P1

دهلران

6

ISO6

P1

دهلران

7

ISO7

P1

دهلران

8

ISO8

P1

دهلران

9

ISO9

P2

دهلران

10

ISO10

P2

دهلران

11

ISO11

P2

دهلران

12

ISO12

P2

دهلران

13

ISO13

P2

دهلران

14

ISO14

P2

دهلران

15

ISO15

P2

دهلران

16

ISO16

P2

دهلران

17

ISO17

P2

دهلران

18

ISO18

P2

دهلران

19

ISO19

P3

مهران

20

ISO20

P3

مهران

21

ISO21

P3

مهران

22

ISO22

P3

مهران

23

ISO23

P3

مهران

24

ISO24

P3

مهران

25

ISO25

P3

مهران

26

ISO26

P3

مهران

27

ISO27

P4

مهران

28

ISO28

P4

مهران

29

ISO29

P4

مهران

30

ISO30

P4

مهران

31

ISO31

P4

مهران

32

ISO32

P4

مهران

33

ISO33

P4

مهران

34

ISO34

P4

مهران

35

ISO35

P4

مهران

36

ISO36

P5

مهران

37

ISO37

P5

مهران

38

ISO38

P5

مهران

39

ISO39

P5

مهران

40

ISO40

P5

مهران

41

ISO41

P5

مهران

42

ISO42

P5

مهران

43

ISO43

P5

مهران

44

ISO44

P5

مهران

 

جداسازی، خالص سازی و نگهداری جدایه­ها: برای جداسازی قارچ عامل بیماری، بعد از ضدعفونی سطحی قطعات برگ با الکل 70 درصد به مدت 15 ثانیه و هیپوکلریت سدیم 5/0 درصد به مدت 90 ثانیه،  شستشوی نمونه ها با آب مقطر سترون و خشک کردن آنها با کاغذ صافی سترون، نمونه ها روی محیط آب آگار کشت گردیدند. بعد از 16 تا 24 ساعت، پیکنیدیوسپورها به محیط کشت آب آگار 5/1درصد (15گرم آگار در یک لیتر آب مقطر) یا محیط کشت YMDA (2/0 گرم آنتی بیوتیک استرپتومایسین، دکستروز، عصاره مالت و عصاره مخمر از هر کدام چهار گرم، 15 گرم آگار و یک لیتر آب مقطر) منتقل گردیدند. پرگنه‌های حاصل از رشد تک پرگنه‌ها، قارچهای خالصی بودند که برای ادامه آزمایش استفاده شدند. برای نگهداری قارچ ، جدایه ها در لوله های آزمایش حاوی محیط کشت PDA منتقل شدند و بعد از رشد کافی در دمای 5-4 درجه سانتی گراد در یخچال نگهداری گردیدند. 

بررسی آزمون بیماریزایی در گلخانه: برای انجام آزمون بیماریزایی، از آنجائی که خصوصیات ظاهری همه جدایه ها مشابه هم بودند ابتدا به صورت تصادفی از هر جمعیت یک جدایه به عنوان نماینده آن جمعیت برای اثبات بیماریزایی انتخاب گردید. سپس شش گلدان را از خاک سترون پر کرده و بذ‌ر گندم رقم فلات در آنها کشت داده شد یکی از این گلدانها به عنوان شاهد انتخاب گردید. پس از 3 هفته رشد، گیاهان با سوسپانسیون اسپور به غلظت 106×1 اسپور دریک میلی لیتر از جدایه های نماینده و با آب‌پاش دستی اسپورپاشی گردیدند. برای حفظ رطوبت، گلدانها به مدت یک شبانه­روز با کیسه نایلونی پوشانده شدند. بعد از ایجاد علائم عامل ایجاد بیماری مجدداً جداسازی و شناسایی گردید. گلدان شاهد با آب مقطر سترون محلول پاشی گردید.

استخراج DNA: برای به دست آوردن میسلیوم جهت استخراج DNA از پرگنه‌های تکثیر شده در محیط کشت YMDA استفاده شد که با استفاده از اسکالپل این پرگنه‌ها از محیط کشت جدا شده و درون ویالهای سترون جمع‌آوری گردیده و در دمای 20- درجه سانتی گراد جهت انجام آزمایشات مولکولی نگهداری شدند. جهت استخراج DNA  قارچ از روش CTAB دویل و دویل (10) با اندکی تغییرات استفاده شد.. در ابتدا بافر تجزیه حاوی ترکیبات EDTA (20mM) ، Tris-HCL (100mM)،CTAB (2%) ،  (2-mercaptoethanol (0.2%)، NaCl(1.4M) تهیه شد. بافر تجزیه با توده میسلیومی جدایه ها مخلوط شد، مخلوط حاصل به مدت 30 دقیقه در دمای 65 درجه سانتی گراد در حمام آب گرم (Ban mary) قرارداده شدند. محلول کلروفرم- ایزوآمیل‌الکل به نسبت 24:1 به مخلوط اضافه گردید و سانتریفیوژ با 12000 دور به مدت 20 دقیقه انجام گرفت. فاز رویی را برداشته، آنزیمRNase  با غلظت نهایی20 میکرولیتر در میلی‌گرم در دمای 37 درجه سانتی گراد به مدت 30 دقیقه به آن اضافه گردید. بعد از این مرحله، کلروفرم- ایزوآمیل‌الکل مطابق بالا اضافه شد و ویالها به مدت 10 دقیقه با 12000 دور سانتریفیوژ شدند. به فاز رویی شفاف، سدیم استات و ایزوپروپانول سرد اضافه گردید و نمونه ها به مدت 10 دقیقه با سرعت 12000 دور در دقیقه سانتریفیوژ شدند. فاز رویی دور ریخته، به رسوب ته‌نشین شده الکل اتانول 70 درصد جهت شستشو اضافه گردید. بعد از سانتریفیوژ کوتاه و دور ریختن الکل، رسوب DNA حاصل به مدت 30 دقیقه در هوای آزاد قرار داده شد، پس از خشک شدن 50 میکرولیتر بافر TE به آن اضافه گردید. DNA استخراج شده قارچ درویالهای حاوی بافر TE در دمای 20- درجه برای مراحل بعد نگهداری شدند. برای اطمینان از کمیت و کیفیت DNA استخراج شده، از ژل آگارز 8/0 درصد استفاده شد.

بررسی تنوع ژنتیکی جدایه‌های Septoria tritici به کمک نشانگرهای SSR : برای این منظور از پنج جفت آغازگر ریزماهواره (SSR) برای Septoria tritici استفاده گردید (29) (جدول2). سپس واکنش زنجیره‌ای پلیمراز (PCR) با استفاده از آغازگرها به صورت جداگانه با DNA ژنومی جدایه­ها با دستگاه ترموسایکلر Analytikjena  مدل Monoblock 60 به طور جداگانه و در حجم واکنش 25میکرولیتر انجام شد. حجم واکنش شامل: بافر 10X PCR به مقدار 5/2 میکرولیتر، MgCL2 (50mM)  به مقدار 5/1 میکرولیتر، dNTP (10mM) به مقدار 9/0 میکرولیتر، از هر جفت آغازگر (Forward, Reverse)، هر کدام به مقدار 1 میکرولیتر، Taq DNA polymerase (250 unit) به مقدار 2/0 میکرولیتر از شرکت سیناکلون، DNA ژنوم به مقدار 5/2 میکرولیتر، آب مقطر سترون 4/15 میکرولیتر در یک برنامه حرارتی شامل 40 چرخه به صورت زیر انجام شد: واسرشت سازی اولیه در 95درجه سانتی گراد به مدت 3 دقیقه، واسرشت سازی در 94 درجه سانتی گراد به مدت یک دقیقه، اتصال و هیبرید شدن آغازگرها در دمای بین 59-51 درجه سانتی گراد به مدت 1دقیقه، سنتز در 72 درجه سانتی گراد به مدت 2 دقیقه،  سنتز نهایی 72 درجه به مدت 7 دقیقه، برای مشاهده محصول  PCR مقدار پنج میکرولیتر از آن در ژل آگارز 5/1 درصد به مدت 50-60 دقیقه در ولتاژ 90  الکتروفورز گردید تا باندهای DNA پدیدار شوند. برای رنگ‌آمیزی ژل از محلول Safe stain در زمان تهیه ژل به مقدار 3 میکرولیتر در 100 سی سی محلول آگارز استفاده شد. برای مشاهده باندهای DNA از دستگاه Gel Documentation مدل Intas استفاده شد.

تجزیه و تحلیل داده‌ها: به منظور تعیین میزان تشابه جدایه‌های S. tritici ابتدا باندهای واضح در تصاویر ژلها مشخص شدند. داده‌ها براساس حضور باند (یک) و یا عدم حضور باند (صفر) وارد نرم افزار Excel گردیدند. ماتریس تشابه بین جفت جدایه‌ها با استفاده از ضریب تشابه دایس و تجزیه خوشه‌ای داده‌ها با روش UPGMA و Neighbor joining با نرم افزارNTsys ver. 2.02  محاسبه گردید (37). بررسی تنوع ژنتیکی جمعیتهای قارچ و تجزیه واریانس مولکولی داده‌ها با استفاده از نرم افزار Gen Alex ver.6.501 (30) انجام شد، اجزای واریانس محاسبه و سهم هر یک از آنها در تنوع کل تعیین گردید. فاصله ژنتیکی بین جمعیتها با استفاده از ضریب نی (28) محاسبه و بدین ترتیب ماتریس فاصله ژنتیکی بین زوج جمعیتها تهیه شد. میانگین تنوع ژنی، ضریب شانون، میزان چندشکلی، میانگین تعداد آلل‌ مشاهده شده ومتوسط تعداد آلل مؤثر در هر جایگاه ژنی، با استفاده از نرم افزار Gen Alex ver.6.501 به دست آمد. میانگین Gst و میزان جریان ژنی (Nm) از Fst مطابق فرمولNm = 0.25 (1- Fst) Fst با استفاده از نرم افزار POP GENE (43) انجام گرفت. برای به دست آوردن نمودار تجزیه به مختصات اصلی جدایه ها از نرم‍افزار DARwin (32) استفاده گردید.

نتایج و بحث

در این بررسی 44 جدایه S. tritici از مزارع مختلف شهرستانهای مهران و دهلران جداسازی و خالص شدند، که همگی متعلق به گونه S. tritici بودند و کارهای مولکولی براساس این گونه انجام گرفت.

مشخصات قارچ S. tritici : یکنیدیوم‌ها به صورت ‌کروی شکل و به رنگ قهوه‌ای روشن بوده که در روی لکه ها تشکیل‌شده و اندازه‌آنها ۲۱۰-۱۶۰ میکرومتر می‍باشد. پیکنیدیوسپورها بی‌رنگ، استوانه‌ای، مستقیم گاهی با خمیدگیهای نامنظم، اغلب با سه بند و با دو سر گرد بوده و اندازه آنها ۴-۲ × ۳۲-۱۵ میکرومتر بود. تحت شرایط مرطوب این اسپورها به صورت رشته‌های صورتی رنگ از دهانه پیکنیدیوم خارج می‌شوند.

آزمون بیماریزایی: در این آزمون پس از مایه‌زنی قارچ عامل بیماری بر روی گیاه گندم علائم بیماری بعد از 4 هفته ابتدا به صورت لکه‌های کوچک نامنظم به رنگ قهوه‌ای مایل به قرمز ظاهر شدند. لکه‌ها به وسیله رگبرگها محدود شده و به صورت طولی توسعه می‌یابند. به تدریج که لکه‌ها پیشرفت می‌کنند، از مرکز تغییر رنگ داده و خاکستری می‌شوند و به مرور تمام سطح برگ را فرا می‌گیرند و در نهایت نقاط سیاه ریز (پیکنیدیومها) در روی لکه‌ها ظاهر می‌شوند. در اغلب موارد زردی و خشکیدگی برگ نیز اتفاق می‌افتد. از قسمتهایی که علائم بیماری مشاهده شد قارچ مورد نظر مجدداً جداسازی گردید. 

بررسی تنوع ژنتیکی جمعیتهای مورد بررسی: تنوع ژنتیکی جدایه هایS. tritici  با استفاده از پنج جفت نشانگر ریزماهواره مورد بررسی قرار گرفت. تعداد کل آللهای مشاهده شده 22 آلل بودند. باندهای DNA حاصل از تکثیر آغازگر ST1E7  به عنوان نمونه در شکل(1) آمده است. لوکوس ST1E7 با شش آلل بیشترین آلل را در میان آللهای تولیدی آغاز‌گر‌ها داشت (جدول 3).

 

 

جدول 2- مشخصات و توالی آغازگرهای SSRs مورد استفاده برای مطالعه جدایه‌های Septoria tritici(29)

Primer sequences (5´-3´)

Reported repeat Motif 

Primer

F- CTCTCTCCCGTGCTGTGTTT
R- CAGACCACCTGCACAGCAT

(GGC)7/(GGT)2

ST1A2

F- GGTTCGATGGAGAGATTT
R- TCACCTCCTCATCGCAGA

(CCG)7

ST1A4

F- AGGCGAGAAACTTGCTTGCAG
R- AATGAACGTCCCATGGACGTG

(AGCGG)4

ST2C10

F- GATCTCGAGCAGGGCGGAAGT
R- TCACACGCTGGTCTGTGAATC

(CGG)5

ST1E7

F- TTGAAGTGGCATCCTCCATT
R- AACTCGGCTGGTGGAACA

(AC)22

ST1D7

 

 

میانگین تعداد آلل (همردیف ژن) در کل ژنگاهها برابر 4/4 است. میانگین تعداد آلل برای هر آغازگر بین 6/0 تا 2/1 متفاوت بود به طوری که میانگین تعداد آلل برای آغازگر ST2C10 برابر 6/0 و برای آغازگر ST1E7 برابر 2/1 بود. در این مطالعه تمام نشانگر‌های مورد استفاده چند‌شکلی مناسب از خود نشان داده است از طرف دیگر تفاوت در نمونه قارچی، تعداد جدایه، تعداد نشانگر و نوع نشانگر از جمله عواملی هستند که در تعداد باند و آلل مشاهده شده اثر دارند.

 

 

 

 

 

شکل 1- باندهای DNA حاصل از تکثیر آغازگرST1E7  در بین جدایه هایISO6,1,17,4,19,16,12,20,22,3,34,31,22,35,44 قارچ S. tritici (اعداد درج شده در بالا نشان دهنده جدایه ها و M  نشانگر استاندارد bp 100)

 

 

جدول 3- مشخصات نشانگر‌های مورد استفاده

آغازگر

اندازه آلل

تعداد آلل تکثیر شده

نسبت چندگانه مؤثر

ST1A2

875-180

5

5

ST1A4

500-125

4

4

ST2C10

175-120

3

3

ST1E7

525-110

6

6

ST1D7

1250-112

4

4

میانگین

-

4/4

4/4

         

 

 

 

جدول 4- تجزیه واریانس ژنتیکی جمعیتهایS. tritici

منبع تغییرات

درجه آزادی

مجموع مربعات

میانگین مربعات

خطای استاندارد

واریانس داخل و بین جمعیت

سطح احتمال

تنوع بین جمعیتها

4

282/13

320/3

060/0

2%

021/0

تنوع درون جمعیتها

39

764/108

789/2

789/2

98%

 

کل

43

045/122

 

849/2

100%

 

               

جدول5- اطلاعات به دست آمده در جمعیتهای S. tritici

جمعیت

اندازه جمعیت

Na

Ne

I

H

درصد چندشکلی

1

8

455/1

219/1

271/0

160/0

73/72

2

9

364/1

212/1

249/0

149/0

18/68

3

9

091/1

215/1

222/0

138/0

55/54

4

9

455/1

241/1

274/0

166/0

73/72

5

9

364/1

238/1

259/0

158/0

18/68

کل

44

345/1

225/1

255/0

154/0

27/67

 

جدول 6- فاصله ژنتیکی به دست آمده از داده های ماتریس نی در جمعیتهای S. tritici

جمعیت

1

2

3

4

5

1

*

987/0

977/0

989/0

988/0

2

010/0

*

981/0

988/0

987/0

3

018/0

012/0

*

988/0

982/0

4

013/0

012/0

019/0

*

990/0

5

012/0

011/0

024/0

013/0

*

                          قسمت بالای * نشان دهنده شباهت ژنتیکی است           قسمت پایین* نشان دهنده فاصله ژنتیکی است

 

جدول 7- میزان جریان ژنی در  جایگاههای مورد مطالعه

جایگاه

تعداد جدایه ها

Ht

Hs

Gst

Nm

1

44

498/0

440/0

116/0

795/3

2

44

084/0

079/0

069/0

666/6

3

44

432/0

361/0

164/0

532/2

4

44

375/0

361/0

036/0

306/13

5

44

499/0

495/0

007/0

656/62

6

44

166/0

162/0

025/0

048/19

7

44

084/0

079/0

069/0

666/6

8

44

124/0

108/0

127/0

437/3

9

44

295/0

261/0

117/0

742/3

10

44

451/0

396/0

122/0

582/3

11

44

299/0

252/0

155/0

708/3

12

44

415/0

371/0

106/0

200/4

13

44

171/0

154/0

099/0

519/4

14

44

266/0

261/0

020/0

757/23

15

44

043/0

039/0

090/0

000/5

16

44

292/0

246/0

155/0

717/2

17

44

171/0

154/0

099/0

519/4

18

44

090/0

083/0

074/0

186/6

19

44

134/0

114/0

145/0

935/2

20

44

239/0

203/0

149/0

840/2

21

44

292/0

207/0

290/0

220/1

22

44

129/0

122/0

050/0

470/9

میانگین

-

2526/0

2252/0

1084/0

1139/4

     Nm = میزان جریان ژنی              Gst = میزان تمایز ژنتیکی

 

 

شکل 2 - دندروگرام تشابه جدایه هایS. tritici  در پنج نشانگر باروش UPGMA و ضریب تشابه دایس

 

شکل3- گروه بندی جمعیتهای S. tritici براساس UPGMA

 

 

شکل 4- دندروگرام تشابه جدایه هایS. tritici   با روش   Neighbor joining

 

شکل 5- نمودار دو بعدی تجزیه به مختصات اصلی پراکنش جدایه‌های S. tritici

جدول 8 - درصد تبیین واریانس ژنتیکی توسط مؤلفه‌های حاصل از تجزیه به مختصات اصلی

محور

درصد تبیین

درصد تجمعی

مؤلفه اول

49/26

49/26

مؤلفه دوم

46/23

95/49

مؤلفه سوم

11/17

06/67

 

 

دامنه اندازه باندها در این نشانگرها بین 110 تا 1250 جفت باز متغیر بود که آغازگر ST1D7 محدوده بیشتری را تکثیر کرد. بیشترین تعداد آلل تکثیر شده و نسبت چند گانه مؤثر مربوط به نشانگر  ST1E7بود. نشانگر‌هایی که تعداد آلل و شاخص نشانگر بالاتری دارند، تفکیک بهتری در درون و بین جمعیتها انجام می‌دهند، از این رو می‌توان در سایر مطالعات مربوط به جدایه‌هایS. tritici  و گونه‌های نزدیک به این جنس از آنها استفاده کرد. نسبت چندگانه مؤثر که بیانگر تعداد جایگاههای ژنی چند‌شکل موجود در یک ژرم‌پلاسم است در این مطالعه برای آغازگرها SSR بین 3 تا 6  و میانگین 4/4 بود (جدول3). میانگین درصد مکانهای چند ‌شکل برای تمام جمعیتها با 86/58 و دامنه 54 تا 68 درصد متغیر بود (جدول5). وجود مکانهای چند‌شکلی یکی از عوامل نشان‌دهنده تنوع در جمعیتها می‌باشد.

تجزیه واریانس مولکولی (AMOVA) جمعیتهای
S. tritici : براساس تجزیه واریانس مولکولی جمعیتها در این مطالعه و الگوی توزیع تنوع مولکولی برای نشانگرها، واریانس ژنتیکی درون جمعیت 98 درصد و واریانس ژنتیکی بین جمعیتها برابر با دو درصد بود (جدول 4). رضوی و هیوز (34 و 35) تنوع ژنتیکی 90 جدایه قارچ M. graminicola جمع آوری شده از 10 نقطه مختلف یک مزرعه در ایالت ساسکاچوان کانادا را 441/0 برآورد نمودند که 88 درصد تنوع در داخل و 12 درصد آن در بین مکانهای نمونه برداری توزیع شده بود.

واریانس ژنتیکی درون جمعیت نشان‌دهنده تنوع درون جدایه‌های مربوط به هر جمعیت می‌باشد. تنوع درون جمعیت به دلایل مختلف از جمله جهش، سیستم تولید مثل و جریان ژن می‌باشد. تنوع بین جمعیتهای مختلف در اینجا برابر با دو درصد بود که نشان می‌دهد جمعیتها از لحاظ ژنتیکی بسیار به یکدیگر نزدیکند. تمایز کمتر بین جمعیت نسبت به داخل جمعیتها نشان‌دهنده این است که گروه‌بندی صورت گرفته برای جدایه‌ها، در تفکیک جدایه‌ها بر اساس شباهت آنها موفق عمل کرده است و جمعیتها از افراد متفاوتی تشکیل شده‌اند، اما بین این جمعیتها تنوع کم و در عین حال معنی‌داری وجود دارد. بیشترین تنوع درون جمعیت مربوط به جمعیت چهار، با 22/24 درصد بود. همچنین تنوع درون جمعیتهای یک، دو، سه و پنج به ترتیب برابر 87/21، 22/22، 22/18 و 22/22 درصد به دست آمد.

اطلاعات تنوع ژنتیکی جایگاههای SSR برای جمعیتهای S. tritici : بالا بودن تعداد آللها، تعداد آللهای مؤثر، ناخودپروری و شاخص تنوع شانون نشان‌دهنده چند‌شکلی بالا‌تر می‌باشد. جمعیت چهار بیشترین ضریب شانون و جمعیت سه کمترین ضریب شانون را دارد. از این رو می‌توان گفت جمعیت چهار تنوع ژنتیکی بالاتری نسبت به بقیه جمعیتها دارد و این تنوع جمعیت نشان دهنده احتمال سازگاری بیشتر جدایه ها نسبت به تغییرشرایط محیطی است. به خاطر پایین بودن تنوع ژنتیکی بین جمعیتها، همان گونه که مشاهده می‌شود ضرایب مربوط به تعداد آللها، تعداد آللهای مؤثر، ناخودپروری، درصد مکانهای چند‌شکل و شاخص تنوع شانون به یکدیگر بسیار نزدیکند (جدول 5). میانگین ضریب شانون محاسبه شده در اینجا برابر با 255/0 بود.

فاصله ژنتیکی بین جمعیت و درون جمعیتهایS. tritici  مورد بررسی: بیشترین فاصله ژنتیکی در جمعیتهای
S. tritici 024/0 بود که بین جمعیتهای سه و پنج مشاهده گردید و کمترین فاصله ژنتیکی011/0 بوده است که بین جمعیتهای دو و پنج دیده شد (جدول 6). بیشترین شباهت ژنتیکی99/0 است که بین چهار و پنج دیده می‌شود، ‌که این شباهت بالا نشان دهنده جریان ژنی است. همچنین نشان می‌دهد که این جمعیتها ممکن است از یک کانون آلودگی مشترک منشأ گرفته باشند. جریان ژنی با توجه به فاصله زیاد شهرستانها و وجود موا نع طبیعی جغرافیایی ممکن است با جا‌به‌جایی بذرهای آلوده یا بقایای گیاهی آلوده به قارچ در شهرستانها و یا در جمعیتهای نزدیک به هم از طریق مکانیسم‌ پراکنش طبیعی قارچ و بذرهای خود مصرفی که هرساله کشاورزان از بذور تولیدی خود برای کشت استفاده می‍کنند تسهیل شده باشد.

میزان جریان ژنی جایگاههای مورد مطالعه: در جایگاههای مورد بررسی در این پژوهش بیشترین جریان ژنی مربوط به  جایگاه شماره پنج با مقدار656/62 وکمترین میزان جریان ژنی مربوط به ژنگاه 21 با مقدار 220/1 بود و متوسط جریان ژنی 113/4 محاسبه شد و متوسط تمایز ژنتیکی در این تحقیق 108/0 بود (جدول7).

رسم دندروگرام جدایه‌های قارچ  S. tritici: برای بررسی تنوع ژنتیکی جدایه‌های مورد بررسی از ضریب تشابه دایس و روش UPGMA استفاده شد (شکل2). در دندروگرام به دست آمده،  با در نظر گرفتن خط برش از ضریب تشابه 54/0، جدایه‌ها در 18 گروه قرار گرفتند. این گروهها شامل هفت گروه تک عضوی، یک گروه 10عضوی، یک گروه شش عضوی، یک گروه چهار عضوی، دو گروه سه عضوی و پنج گروه دو عضوی است که این گروهها نشان دهنده تنوع ژنتیکی بیشتر جدایه های مختلف مربوط به درون جمعیتها می باشد که آنالیز واریانس مولکولی این تنوع ژنتیکی را مورد تأیید قرار می دهد. عدم ارتباط بین جدایه و منشاء جغرافیایی می‌تواند ناشی از غلبه جریان ژنی بر تأثیرات رانش ژنتیکی و جلوگیری از تفکیک و تمایز محدود به یک منطقه بین جمعیتها باشد. به عبارت دیگر، مهاجرت جدایه‌ها و اختلاط مداوم ژنوتیپها بین زیرجمعیتها و تبادل ژنتیکی فراوان تفکیک و تمایز محدود به یک منطقه را کاهش می‌دهد (41). مقایسه ها نشان می دهد که دندروگرام در بعضی موارد با پراکنش جغرافیایی تطابق ندارد، به عبارت دیگر قرار گرفتن جدایه ها با منشاء جغرافیایی متفاوت در یک گروه نتایج مشخصی را بیان نمی کند و تطابق مشخصی بین تنوع ژنتیکی و تنوع جغرافیایی را نشان نمی دهد و می توان نتیجه گرفت که جدایی جغرافیایی تنها عامل به وجود آوردن تنوع ژنتیکی نمی باشد و عواملی مانند جریان ژنی از طریق نقل و انتقال زادمایه قارچ از یک نقطه به نقطه دیگر میتواند باعث پراکنش جدایه ها شود، با استفاده از تعداد زیاد نمونه که در منطقه گسترده‌ای قرار دارد شاید بتوان ارتباطی بین مناطق جغرافیایی و خوشه بندی مشاهده کرد.

اما در رسم دندروگرام جمعیتها دو گروه مشخص شده یک گروه شامل جمعیتهای پنج و چهار از شهرستان مهران و گروه دیگر شامل جمعیتهای یک، دو و سه، از شهرستان دهلران که جمعیت شماره یک اندک تفاوتی با جمعیتهای دو و سه دارد (شکل3). نتایج حاکی از این دندروگرام نشان دهنده تنوع ژنتیکی کمتر میان جمعیتهاست و واریانس ژنتیکی بین جمعیتها را مورد تأیید قرار می دهد.

رسم دندروگرام جدایه‌ها بر اساس اتصال مجاور: همچنین دندروگرام حاصل از گروه بندی خوشه‌ای جدایه‌های مورد مطالعه با استفاده از نشانگر SSR بر اساس ضریب تشابه دایس و روش نزدیکترین اتصال مجاور (Neighbor joining) برای نشان دادن بهتر ارتباط ژنتیکی بین جدایه‌ها ترسیم گردید. جدایه‌ها در فاصله 2 تا 20 قرار داشتند (شکل4). با در نظر گرفتن خط برش در فاصله 50/7، 12 گروه تشخیص داده شد که این دندروگرام همانند دندروگرام فوق پراکنش جدایه ها را در گروههای مختلف نشان می دهد.

تجزیه به مختصات اصلی در جدایه‌های S. tritici بر اساس نشانگر SSR: برای بررسی تنوع آللی در جدایه‌های مورد مطالعه، از تجزیه به مختصات اصلی در جهت تکمیل تجزیه خوشه‌ای انجام شد. تجزیه به مختصات اصلی روش آماری چند متغیره مشابه با تجزیه به مؤلفه‌های اصلی در مورد داده‌های کمی است که کاربرد زیادی در تنوع ژنتیکی دارد در این روش برای نمایش نمودار دوبعدی و سه‌بعدی پراکنش جدایه‌ها به کار می‌رود. نمودار پراکنش جدایه‌ها بر اساس تجزیه به مختصات اصلی و نحوه پراکنش آن در شکل(5) به صورت دو بعدی آورده شده است. نمودار دو بعدی نشان می دهد که پراکندگی زیادی در جدایه‌های مربوط به جمعیتها وجود داشته و جدایه ها در هر چهار ناحیه نمودار پراکنده شده اند، نتایج به دست آمده از گروه بندی تا حدود زیادی با نتایج به دست آمده از  تجزیه خوشه ای مطابقت دارد.

نتایج این نمودار نشان می‌دهد که محور‌های اصلی اول، دوم و سوم به ترتیب 49/26 و 46/23 و11/17 درصد و در مجموع این سه محور تقریباً 06/67 درصد واریانس کل داده ها را توجیه نموده اند (جدول 8). این تبیین حاکی از عدم همبستگی بین نشانگرهای ریز‌ماهواره است.

مفهوم ژنومی این عدم همبستگی، پراکنده بودن فواصل قابل تکثیر بین جایگاههای ریز ماهواره در سراسر ژنوم می‌باشد. اما جدایه‌هایی که از مناطق یکسان جمع‌آوری شده اند نیز به خوبی از یکدیگر تفکیک نشده‌اند. چنین استنباط می‌شود که تعداد اندکی نشانگر ریز‌ماهواره اگر پراکنش مناسبی در ژنوم داشته باشند به خوبی در تفکیک گونه‌های مختلف موفق عمل می‌کنند و همچنین برای اختلاف درون گونه‌ای نیز این نشانگر به خوبی عمل می‌نماید. از این رو می‌توان گفت عدم پراکندگی مناسب نشانگر بر روی کل ژنوم یکی از دلایل عدم تفکیک آنها می‌باشد. چندین عامل در تخمین روابط ژنتیکی تأثیر دارند که از بین آنها می‌توان تعداد نشانگر مورد استفاده، توزیع نشانگر‌ها در ژنوم نمونه‌های آنالیز شده و ماهیت مکانیسم تکاملی و واریانس اندازه‌گیری شده را نام برد (7).

نتیجه‌گیری و بحث

سپتوریوز برگی یکی از مهم ترین بیماریهای گندم می‍باشد، به طوری که در اروپا در درجه اول اهمیت قرار دارد و خسارت قابل توجهی به محصول وارد می کند (39). استفاده از ارقام پا کوتاه و پرمحصول در چند سال اخیر در ایران و بسیاری از کشورهای دیگر باعث گسترش این بیماری شده است (42). به توجه به اهمیت محصول گندم، باید اقدامات صحیح و اصولی برای کنترل این بیماری صورت گیرد.

در بین همه راههای کنترل این بیماری استفاده از ارقام مقاوم یا متحمل یکی از مطمئن‌ترین واقتصادی‌ترین روشهای مبارزه با سپتوریوز برگی می‌باشد. با شناسایی گروههای جمعیتی بیمارگر می‌توان به شناسایی ارقام مقاوم در هر منطقه مبادرت نمود و این خود مستلزم انجام آزمونهای بیماریزایی و بررسی عکس العمل در برابر بیمارگر است(4). بنابراین به منظور انتخاب ارقام مقاوم به عامل بیماری نیاز به آگاهی در مورد ماهیت عامل بیماری، چگونگی بیماریزایی، شرایط محیطی مناسب برای بیماریزایی، تنوع ژنتیکی در جمعیتهای قارچ عامل بیماری و احتمال وجود فرم جنسی قارچ در چرخه‌ی زندگی عامل بیماری در طبیعت می‌باشد. آگاهی از میزان تنوع ژنتیکی جمعیتهای قارچ عامل بیماری ضروری است.  بیماری‌شناسان به دنبال بررسی علل و عوامل تأثیرگذار بر تغییر در بیماریزایی بیمارگرها، فراوانی ژنهای بیماریزا از نظر زمانی، مکانی و مطالعه اپیدمیولوژی بیمارگرهای حامل ژنهای مختلف بیماریزا هستند. ازطرفی دیگر متخصصین اصلاح نباتات تنوع در بیماریزایی بیمارگر را به دلیل تأثیر آن بر پایداری مقاومت میزبان حائز اهمیت دانسته و شکسته شدن مقاومت ارقام را به این مسئله نسبت می‌دهند (31). نتایج این تحقیق بیانگر وجود تنوع ژنتیکی کم در بین جدایه‌های S. tritici جدا شده از گندم می‌باشد. و  با توجه به اینکه نشانگرهای مورد استفاده در این مطالعه چندشکلی مناسبی را نشان داده اند می توان از آنها برای مطالعات تنوع ژنتیکی در جدایه های دیگری از مناطق مختلف کشور استفاده کرد و با توجه به تنوع به دست آمده در بین جدایه های مورد بررسی می توان از آنها در برنامه های اصلاحی استفاده کرد

در این تحقیق با استفاده از دندروگرامهای ترسیم شده گروههای مختلفی شناسایی شده، همچنین براساس نتایج تجزیه واریانس مولکولی تنوع ژنتیکی در بین جدایه های مورد بررسی در هر جمعیت یا نواحی جغرافیایی بالا بوده که علت آنرا شاید بتوان به عوامل مؤثر در تغییرات ژنتیکی نظیر جهش، ریزش ژنتیکی، گزینش، تولید مثل جنسی و غیر جنسی در ساختار جمعیت قارچ در این مناطق نسبت داد. که می توان از آنها در برنامه های اصلاحی استفاده کرد. در مجموع باتوجه به نتایج می توان گفت که تکنیک ssr یک تکنیک مفید و سودمند در بررسی تنوع ژنتیکی درون گونه‌های قارچی از جمله S. tritici است.. در مناطق مختلف جهان مطالعات مختلفی در این مورد گزارش شده است و سطوح مختلفی از تنوع ژنتیکی را نشان داده‌اند. اون و همکاران (29) با به کارگیری نه جفت آغازگر ریزماهواره تنوع ژنتیکی در داخل جمعیت M. graminicola را 49/0 به دست آوردند. بوکف و همکاران (2) ساختار ژنتیکی جمعیت بزرگی از M. graminicola جمع آوری شده از مزارع مختلف تونس را مطالعه نمودند و گزارش دادند که این بیماری دارای تنوع ژنتیکی بالایی در اثر جریان ژنی و نوترکیبی جنسی است. رضوی و هیوز (34 و 35) تنوع ژنتیکی 90 جدایه M. graminicola جمع‌آوری شده از یک مزرعه در ایالت ساکاچوان کانادا را 441/0 برآورد نمودند که 88 درصد تنوع در داخل و 12 درصد آن در بین مکانهای نمونه‌برداری توزیع شده بود و درجه بالایی از چند شکلی DNA را مشاهده نمودند که گزارش دادند که منبع اولیه بیماری به دلیل انتشار یکنواخت آسکوسپورها در درون مزرعه است. لیندا و همکاران (19) با بررسی 1098 جدایه M. graminicola از مناطق، مزارع و برگهای مختلف یک بوته گندم در سویس، فلسطین اشغالی و ایالتهای ارگون و تگزاس آمریکا دریافتند که میانگین تنوع ژنتیکی در سویس 47/0، فلسطین اشغالی 50/0 و ایالتهای ارگون و تگزاس آمریکا 44/0 بوده، همچنین 77 درصد تنوع در داخل جمعیتها و 23 درصد در بین جمعیتها توزیع شده بود. رضوی و هیوز (34 و 35) وجود فرم جنسی قارچ S. tritici  را در کانادا پیش بینی نموده اند و تحقیقات بعدی هورن و همکاران (13) صحت پیش بینی آنها را به اثبات رسانیدند و فرم جنسی قارچ از ایالت مانیتوبا در کانادا گزارش گردید. وجود فرم جنسی در داخل جمعیتهای قارچ باعث می­شود که ترکیب جدیدی از ژنها حاصل شده و منجر به تنوع ژنتیکی بالایی شود، گاهی منجر به پیدایش ژنوتیپهایی از بیمارگر می گردد که از قدرت بیماریزایی و تطابق بیشتری برخوردار هستند و می توانند بر مقاومت گیاه میزبان غلبه نمایند. به ویژه احتمال پیدایش اینگونه ژنوتیپها در بیمارگرهایی بیشتر است که در چرخه زندگی خود هم به روش جنسی و هم غیر جنسی تکثیر پیدا می کنند (24 و 25). یا توجه به اینکه این قارچ هم به روش جنسی و هم غیر جنسی تکثیر پیدا می کند و احتمال تشکیل فرم جنسی قارچ در ایران وجود دارد لذا احتمال پیدایش پاتوتیپهایی که قدرت بیماریزایی بیشتری دارند در منطقه زیاد است که این عامل می تواند باعث شکسته شدن مقاومت ارقام گردد. بنابراین می توان برای کنترل بیماری از ارقام گندم با ژنهای مقاوم غیر اختصاصی به نژاد (race non- specific resistance) و یا ارقام دارای چند ژن مقاوم، استفاده نمود. در تولید مثل جنسی با ایجاد افراد نوترکیب در یک جمعیت، تنوع ژنتیکی آن جمعیت افزایش می‌یابد، در تولید مثل پراجنسی با کاهش احتمال سازگاری رویشی بین جدایه‌ها در حالت تصادفی، تنوع در جمعیت کاهش می‌یابد. در این حالت احتمال به وجود آمدن افراد با تنوع ژنتیکی جدید بسیار کم است(3). در این تحقیق میزان جریان ژنیNm (113/4) بوده ومیزان  تمایز ژنتیکی Gst (108/0) به دست آمد و با توجه به کم بودن میزان Gst نسبت به Nm می‌توان گفت تمایز ژنتیکی محدود است. جریان ژنی یکی از نیرو‌های تکاملی است که نقش بسیار مهمی در تنوع ژنتیکی یک جمعیت دارد، جریان ژنی فرآیندی طبیعی است که در طی آن ژنها از جمعیتی به جمعیت دیگر منتقل می‌شوند و جمعیتها به سمت یکنواختی بیشتر پیش می روند. نتایج نشان داد که میزان جریان ژنی با میزان تمایز ژنتیکی رابطه معکوس دارد، هنگامی که جریان ژنی بالا باشد، تمایز ژنتیکی در پایین‌ترین مقدار خود قرار می‌گیرد.، در غیاب جریان ژنی، ریزش ژنتیکی باعث تفاوت در فراوانی آللها در جایگاههای ژنی خنثی درون جمعیت ‌گردد و باعث افزایش تمایز جدایه‌ها در جمعیتها می‌شود (24 و 25). با تخمین جریان ژنی، می‌توان میزان جریان ژنی که از تمایز جمعیتها جلوگیری می‌کند را مشخص کرد. زمانی که جریان ژنی کمتر از یک باشد نشان می‌دهد که تمایز در میان جمعیتها وجود دارد و جریان ژنی بیشتر از یک نشان می‌دهد که تمایز کمتری در میان جمعیتها رخ می‌دهد. ارقام مقاوم یکی از مهم ترین روشهای کنترل بیماری سپتوریوز گندم است و برای بررسی روشهای کنترل وتأثیر آنها اطلاعات تنوع ژنتیکی جمعیت بیمارگر بسیار مهم و حائز اهمیت است. افزایش تنوع ژنتیکی در هر جمعیت بیمارگر باعث افزایش پتانسیل سازگاری آن جمعیت در مقابل تغییرات شرایط آب و هوایی و میزبان گردد و ورود چند جدایه با قدرت تهاجمی بالا به این جمعیت ممکن است باعث ایجاد اپیدمی و شدت بالای بیماری شده و کنترل بیماری با مشکل مواجه شود. بنابراین می‌توان با بررسی ساختار ژنتیکی جمعیتهای این بیمارگر، با کاربرد ترکیبهای مختلف ژنهای مقاوم برای رسیدن به مقاومت پایدار گام برداشت تا اصلاح کنندگان بتوانند واریته‌هایی را که دارای پتانسیل مقاومت هستند مطابق با تنوع ژنتیکی جمعیت قارچ برای رسیدن به ارقام با مقاومت پایدار آزمایش کنند.

سپاسگزاری

از همکاری و پشتیبانی مالی معاونت  محترم پژوهشی و کمیته زیست فناوری دانشگاه ایلام، همچنین از همکاری خانم مهندس مونا مداح جلالی، خانم مهندس مهتاب راد و آقای مهندس سجاد فتاحی کارشناس آزمایشگاه بیماریهای گیاهی در کمک به اجرای این طرح تحقیقاتی تشکر و قدردانی می گردد.

  1. Abrinbana, M., Mozafari, J., Shams-bakhsh, M. and Mehrabi, R. 2012. Resistance spectra of wheat genotypes and virulence patterns of Mycosphaerella graminicola isolates in Iran. Euphytica 186: 75-90.
  2. Boukef, S., McDonald, B.A., Yahyaoui, A., Rezgui, S. and Brunner, P.C. 2012. Frequency of mutations associated with fungicide resistance and population structure of Mycosphaerella graminicola in Tunisia. European Journal of Plant Pathology 132(1): 111-122.
  3. Bowden, R.L., Leslie, J.F. 1992. Nitrate - nonutilizing mutants of Gibberella zeae (Fusarium graminearum) and their use in determining vegetative compatibility. Exprimental. Mycology 16: 307- 315.
  4. Burger, Y., Katzir, N., Tzuri, G., Portnoy, V., Saar, U., Shrider, S., Perl – Treves, R. and Cohen, R. 2003. Variation in the response of melon genotypes to Fusarium oxysorum f. sp. melonis race 1 determinated by inoculation tests and molecular markers. Plant pathology 52: 204-211.
  5. Camacho-Gasas, M.A., Kronstad, W.E. and Scharen, A.L. 1995. Septoria tritici resistance and association with agronomic traits in a wheat cross. Crop Science 35: 971-976.
  6. Chen, R. S., McDonald, B. A. 1996. Sexual reproduction plays a major role in the genetic structure of populations of the fungus Mycosphaerella graminicola .Genetics 142: 1119- 1127.
  7. Chowdhury, A.K., Yonemoto, Y., Kato, H. and Macha, M.M. 2005. Cultivar identification by morphometric descriptors and RAPD markers among some Acerola (Malpighia glabra Linn.) cultivars. Japonica Journal of Tropical Agriculture 49 (2): 41-42.
  8.  Datta, S., Choudhary, R.G., Shamim, M.d., Singh, R.K. and Dhar, V. 2011. Molecular dievrsity Indian isolates of Fusarium oxysporum f. sp. lentis inciting wilt disease in lentil (Lens culinaris Medik). African Journal of Biotechnology 10: 7314-7323.
  9. Desmazieres, J. B. H. J. 1842. Neuvieme notice sur quelques plants Cryptogames. Annual Sci. Nat. II 16: 91:118.PETRAK, F. and E. ESFANDIARI, 1941. Beiträge zur Kenntnis der iranischen plizflora. Annual Mycology 39: 204-228.

10. Doyle J.J. and Doyle J.L. 1990. A rapid total DNA preparation procedure for fresh plant tissue, focus, 12: 13-15.

11. Eyal, Z., Scharen, A.L., Huffman, M.D. and Prescott, J.M. 1985.Global insights into virulence frequencies of Mycosphaerella graminicola. Phytopathology 75: 1456-1462.

12. Eyal, Z., Scharen, A.L., Perescott, J. and Van Ginkel, M.M. 1987. The septoria disease of wheat. Concepts and methods of disease management. Cimmyt, Mexico, D. F. Mexico. 46 PP.

13. Hoorne, C., Lamari, J.G. and Balance, G.M. 2002. First report of Mycosphaerella graminicola, the sexual state of Septoria tritici, in Manitoba, Canada. Canadian Journal of Plant Pathology 24: 445-449.

14. Jürgens, T., Linde, C. and MCdonald, B. 2006. Genetic structure of Mycosphaerella graminicola populations from Iran, Argentina and Australia. European Journal of Plant Pathology 115: 223-233.

15. Kabbage M., Leslie, J.F., Zeller, K.A., Hubert, S.H. and Bockus, W.W. 2001. Genetic diversity of Mycosphaerella graminicola the causal agent of septoria tritici blotch, in Kansas winter wheat. Agriculture, food, and environmental Science ISSN 1934- 7235, 2:1

16. Kale, M.S., Pardeshi, V.C., Gurjar, G.S., Gupata, V.S., Gohokar, R.S., Ghoropade, P.B. and Kadoo, N.Y. 2012. Inter simple sequence repeat markers reveal high genetic diversity among A. alternata isolates of Indian origin. Mycological Plant Pathology 42(2): 194-200.

17. King, J.E., Cook, R.J. and Melville, S.C. 1983. A review of Septoria diseases of wheat and barley. Annual Applied Biology 103: 345-373.

18. Komijani, S., Razavi, M., Etebarian, H.R. and Mardi, M. 2008. Study 0n the phylogenetic relationship of Mycosphaerella graminicola isolates cause of Septoria leaf blotch of wheat in Iran using rep-PCR. Proceeding Of the 18th Iranian Plant Protection Congress. Volume II, Aug. 24-27, 2008. Iran, Hamedan. pp. 658.

19. Linde, C.C., Zhan, J. and McDonald, B.A. 2002. Population structure of Mycosphaerella graminicola: From lesions to continents. Phytopathology 92: 946-955.

20.  Majer, D., Mithen, R., Lewis, B.G., Vos, P. and Oliver, R.P. 1996. The use of AFLP fingerprinting for the detection of genetic variation in fungi. Mycological Research 100(9):1107-1111.

21.  McDonald, B.A., McDermott, J.M., Allard, R.W. and Webster, R.W. 1989. Coevolution of host and pathogen populations in the Hordeum vulgareRhynchosporium secalis pathosystem. Proceedings of the National Academy of Sciences of the USA 86: 3924-3927.

22. McDonald, B.A., Zahn, J., Jarden, O., Hogan, K. Garton, J. and Pettway, R.E. 1999. The population genetics of Mycopshaerella graminicola and Phaeosphaeria nodorum. In: Lucas JA, Bowyer P and Anderson HM (eds) Septoria on cereals. CAB International, Wallingford, UK. pp. 44-69.

23. McDonald, B.A. 1997. The population Genetic of fungi: tools and techniques. Phytopathology 87: 448-453.

24. McDonald, B.A. and Linde, C. 2002. The population genetics of plant pathogens and breeding strategies for durable resistance. Euphytica 124: 163–180.

25. McDonald, B.A. and Martinez, J.P. 1990. DNA restriction fragment length polymorphisms among Mycosphaerella graminicola (anamorph Septoria tritici) isolates and host cultivars. Phytophathology 86: 200-212.

26. Mcdonald, B.A., Pettway, R.E., Chen, R.S., Boeger, J.M. and Martinez, J.P. 1995. The population genetics of Septoria tritici (teleomorph: Mycosphaerella graminicola). Canadian journal of botany 73: 292-301.

27.  Medini, M. and Hamza, S. 2008. Pathotype and molecular characterization of Mycosphaerella graminicola isolates collected from Tunisia, Algeria, and Canada. Journal of Plant Pathology 90: 65-73.

28. Nei, M. 1978. Estimation of average heterozygosity and genetic distance from a small number of individuals. Genetics 76: 379- 390.

29. Owen, P.G., Pei, M., Karp, A., Royle, D.J. and Edwards, K.J. 1998. Isolation and characterization of microsatellite loci in the wheat pathogen Mycosphaerella graminicola. Molecular Ecology 7:1611-1612.

30. Peakall, R. and Smouse, P.E. 2012. GenAlEx 6.5: genetic analysis in Excel. Population genetic software for teaching and research an update. Bioinformatics 28: 2537-2539.

31. Peever, T.L., Olsen., Ibanez, A. and Timer L.W. 2000. Genetic differentiation and host specificity among populations of Alternaria spp. causing brown spot of grapefruit and tangerine and grapefruit hybrids in Florida. Phytopathology 90(4): 407- 414.

32. Perrier, X. and Jacquemoud-Collet, J.P. 2006. DARwin software, http://darwin.cirad.fr/darwin

33. Petrak, F. and Esfandiari, E. 1941. Beiträge zur Kenntnis der iranischen plizflora. Annual Mycology 39: 204-228.

34. Razavi, M. and Hughes, G.R. 2004a. Molecular variability of Mycopshaerella graminicola as detected by RAPD markers. Journal of Phytopathology 152: 543-548.

35. Razavi, M. and Hughes, G.R. 2004b. Microsatellite markers provide evidence for sexual reproduction of Mycosphaerella graminicola in Saskatchewan. Genome 47: 789-794.

36. Rezgui, S., Fakhfakh, M.M., Boukef, S., Rhaiem, A., Chérif, M. and Yahyaoui, A.H. 2008. Effect of common cultural practices on septoria leaf blotch disease and grain yield of irrigated durum wheat. Tunisian Journal of Plant Protection 3(2): 59-68.

37. Rohlf, F.J. 1998. NTSYS pc: Numerical Taxonomy and Multivariate Analysis System version 2.02 Exeter Software.

38. Schneider, F., Koch, G., Jung, C. and Verret, J.A. 2001. Genetic diversity of the wheat pathogen Mycosphaerella graminicola is characterized by high nuclear diversity, low mitochondrial diversity, regular recombination, and gene flow. Fungal Genetic and Biology 38: 286-297.

39. Shaner, G., Finney, R.E. and  Patterson, F.L. 1975. Expression and effectiveness of resistance in wheat to septoria leaf blotch. Phytopathology 65: 761-766.

40. Sharif, G. and Ershad, D. 1966. A list of fungi on cultivated plants, shrubs and trees of Iran. Ministry of Agriculture, Plant Pests and Diseases Research institute, Evin, Tehran.

41. Slatkin, M. 1987. Gene flow and the geographic structure of natural populations. Science 236: 787-792.

42. Torabi, M. 1979. Study on the biology and pathobiology of Septoria tritici on wheat in northern and southern parts of Iran. MSc. Thesis, Tehran University, 127 pp.

43. Yeh, F.C., Yang, R.C. and Boyle, T. 1999. Microsoft Window-based freeware for

 population genetic analysis (POPGENE) ver.1.31, ftp://ftp.microsoft.com/softlib/MSLFILES/HPGL.EXE.

44.  Zhan, J., Pettway, R.E. and McDonald, B.A. 2003.The global genetic structure of the wheat pathogen Mycosphaerella graminicola is characterized by high nuclear diversity, low mitochondrial diversity, regular recombination, and gene flow. Fungal Genetic and Biology 38: 286-297.