نوع مقاله: مقاله پژوهشی

نویسنده

عضو هیات علمی دانشکده علوم پایه دانشگاه کردستان

چکیده

کاربرد میکروارگانیسم ها بعنوان کاتالیست های طبیعی ارزان قیمت جهت کاهش و حذف پساب های حاوی سلنیت از محیط زیست بطور چشمگیری در حال افزایش است. در این مطالعه، توانمندی مخمرهای بومی دریازی مقاوم به سلنیت در بهسازی زیستی آلودگی های محیطی به سلنیت مورد بررسی قرار گرفت. نمونه گیری از دریای خزر و خلیج انجام گرفت. جداسازی از طریق غنی سازی در محیط های حاوی سلنیت صورت گرفت. از آزمون میکروپلیت الیزا برای تعیین مقاومت سویه های مخمری استفاده شد. سنجش میزان حذف سلنیت از طریق روش رنگ سنجی انجام شد. شناسایی ملکولی با تکثیر توالی نوکلئوتیدی ITS1-5.8S-ITS2 rDNA انجام شد. تاثیر پارامترهای مختلف از جمله غلظت های اولیه سلنیت، بیومس سلول، کلرید سدیم و اثرات دما، pH، دور شیکر و مدت زمان واکنش بر کارآیی فرآیند حذف بررسی شد. براساس نتایج بدست آمده در این مطالعه، سویه مخمری Cas se5 (جدا شده از دریای خزر) با بالاترین مقاومت (g/L22) بعنوان سویه برتر تحت نام Trichosporon شناسایی و با شماره دسترسی KT033396 در بانک ژنی ثبت شد. نتایج بدست آمده از آزمایشات حذف سلنیت نشان داد که مخمر مذکور بیش از 93 درصد از سلنیت موجود در محیط واکنش را تحت شرایط بهینه شده حذف نموده و میزان سلنیت اولیه را ازg/L 10 به حدودg/L 7/0 با نرخ تجزیهg/L/h 26/0رسانده است. این اولین گزارش از جداسازی جنس Trichosporon با قابلیت حذف سلنیت از دریای خزر است. انتظار می رود مخمر مذکور بتواند بعنوان کاتالیست نقش مهمی در بهسازی آلودگی آبها و فاضلاب کارخانه های آلوده به سلنیت ایفاء نماید.

کلیدواژه‌ها

موضوعات

عنوان مقاله [English]

Isolation and characterization of a selenite resistant marine yeast strain and its application in selenite bioremediation

نویسنده [English]

  • Morahem Ashengroph

Asistant Professor

چکیده [English]

Application of microorganisms as natural and cost-effective catalysts to reduce and remove selenite from environment is remarkably on the rise. In the current study, potential of selenite resistant marine yeasts for the bioremediation of selenite-polluted sites was investigated. Samples were collected from regions in the Persian Gulf and the Caspian Sea. Isolation of the yeast strains was performed via enrichment cultures in media containing selenite. ELISA miocroplate was used to determine resistance patterns of the yeast strains to selenite. A colorimetric method has been developed for the evaluation of selenite removal. Molecular Characterization was performed based on amplification the ITS1-5.8S-ITS2 rDNA regions. The effect of different parameters such as initial concentrations of selenite, biomass, NaCl and initial pH, temperature, agitation as well as time of incubation on selenite removal efficiency was studied. According to the results obtained in the study, the highest selenite resistance (22 g/L) was found in the yeast strain Cas se5 isolated from Caspian Sea. The strain was identified to the genus Trichosporon under the accession number KT033396 in GenBank. Based on the results of selenite removal experiments, the yeast strain Cas se5 is capable remove 93% of selenite at initial concentration of 10 g/l with a degradation rate of 0.26 g/L/h under optimized conditions.
This paper is the first report on isolation of Trichosporon genus with potential of selenite removal from Caspian Sea. The isolated yeast is expected to play an important role as catalyst for the remediation of selenite-contaminated waters and wastewaters.

کلیدواژه‌ها [English]

  • Resistance pattern
  • Bioremediation
  • Selenite
  • Trichosporon sp. Cas se5

جداسازی و تعیین خصوصیت یک سویه مخمری دریازی مقاوم به سلنیت و کاربرد آن در زی پالایی سلنیت 

مراحم آشنگرف* و راضیه ارجمند 

سنندج، دانشگاه کردستان، دانشکده علوم پایه، گروه علوم زیستی

تاریخ دریافت: 15/7/94                تاریخ پذیرش: 17/11/94 

چکیده

کاربرد میکروارگانیسم ها به عنوان کاتالیستهای طبیعی ارزان قیمت جهت کاهش و حذف سلنیت از پسابهای حاوی سلنیت به طور چشمگیری در حال افزایش است. در این مطالعه، توانمندی مخمرهای بومی دریازی مقاوم به سلنیت در زی پالایی آلودگیهای محیطی به سلنیت مورد بررسی قرار گرفت. نمونه گیری از دریای خزر و خلیج فارس انجام گرفت. جداسازی از طریق غنی سازی در محیطهای حاوی سلنیت صورت گرفت. از روش میکروتیترپلیت برای تعیین الگوی مقاومت سویه های مخمری استفاده شد. سنجش میزان حذف سلنیت از طریق روش رنگ سنجی انجام شد. شناسایی مولکولی با تکثیر توالی نوکلئوتیدی ITS1-5.8S-ITS2 rDNA انجام شد. تأثیر پارامترهای مختلف از جمله غلظتهای اولیه سلنیت، توده سلولی، کلرید سدیم و اثرات دما، pH، دور شیکر و مدت زمان واکنش بر کارآیی فرآیند حذف بررسی شد. براساس نتایج به دست آمده در این مطالعه، سویه مخمری Cas se5 (جدا شده از دریای خزر) با بالاترین مقاومت (g/L22) به عنوان سویه برتر تحت نام Trichosporon شناسایی شد. نتایج به دست آمده از آزمایشات حذف سلنیت نشان داد که مخمر مذکور بیش از 93 درصد از سلنیت موجود در محیط واکنش را تحت شرایط بهینه شده غلظت سلنیت 10 گرم در لیتر، غلظت توده سلولی 35 گرم در لیتر، غلظت کلرید سدیم 5/2 درصد وزنی/حجمی، pH برابر 4/7، دمای 30 درجه سانتی گراد و دور همزن rpm 100حذف نموده و غلظت سلنیت اولیه ازg/L  10 به حدودg/L  7/0 با نرخ حذفg/L/h  26/0پس از 72 ساعت گرماگذاری کاهش یافته است. این اولین گزارش از جداسازی جنس Trichosporon با قابلیت حذف سلنیت از دریای خزر است. انتظار می رود مخمر مذکور  بتواند به عنوان کاتالیست نقش مهمی در زی پالایی آلودگی آبها و فاضلاب کارخانه های آلوده به سلنیت ایفاء نماید.

واژه های کلیدی: الگوی مقاومت، زی پالایی، سلنیت، Trichosporon sp. Cas se5

* نویسنده مسئول، تلفن: 33664600-087 ، پست الکترونیکی: m.ashengroph@uok.ac.ir

مقدمه

 

آلودگی هوا، خاک و آب با مواد شیمیایی سمی و خطرناک، خطرات بالایی را برای موجودات زنده به صورت مستقیم و غیر مستقیم ایجاد کرده است. فلزات سنگین و اکسی آنیونهای سمی به واسطه طبیعت غیر قابل تجزیه و اثرات سمی شناخته شده بر روی چرخه حیات مشکلات زیست محیطی فراوانی را به وجود می آورند. تخلیه نامناسب پسابهای حاوی فلزات و اکسی آنیونهای سمی نه تنها برای زندگی انسان و حیوانات سمی است بلکه سبب بروز مشکلات جدی در آبهای زیرزمینی، آبهای سطحی و منابع خاک می شود و توجه به رفع آلودگی این مواد بسیار حائز اهمیت است (10 و 13). یکی از موارد آلودگی پسابها اکسی آنیونهای سلنیوم است. آلودگی سلنیومی در سراسر جهان پراکنده است و ارتباط زیادی با فعالیتهای انسانی دارد (17). عنصر سلنیوم با توجه به خواص آنتی اکسیدانتی، از نظر فیزیولوژیک یک ریز مغذی ضروری برای سیستمهای زنده است و نقش مهمی در سلامت جامعه ایفا می کند. با این وجود مواجهه حاد و مزمن با غلظتهای بالای سلنیوم محلول بسیار سمی است (2). محدوده بین مقدارحداقل این عنصر (جهت تشخیص) و حداکثر (سمیت) سطوح قابل تحمل این عنصر در موجودات مختلف کمتر از یک میلی گرم در لیتر است. اگرچه سلنیوم در طی فرسایش طبیعی و مکانیسم شست وشوی سنگهای سلنوفروس وارد طبیعت می‌شود، منابع دیگری چون آلودگی خاک، آب شیرین، آب‌های زیرزمینی و محتویات رسوبات شامل: ذوب فلزات، حمل ونقل، پالایش، بهره‌برداری واحتراق سوختهای فسیلی در نیروگاه‌، تولید رنگدانه، تولید شیشه و آبیاری مکرر خاکهای کشاورزی غنی از سلنیوم می‌باشد (22). در طبیعت سلنیوم در غلظتهای 01/0تا 2 میکروگرم در هر گرم از سطح خاک به صورت اکسی‌آنیونهای سلنات Se(IV)، سلنیت Se(IV)، سلنید Se(−II) و سلنیوم عنصری Se0 وجود دارد. در غلظتهای بالا، اکسی‌آنیونهای سلنیوم برای گیاهان و جانوران سمی هستند (3). سمیت فرمهای اکسی آنیونی سلنیوم به درجه حلالیتشان در آب بستگی دارد و تأثیرات زیستی آنها را افزایش می‌دهد. سلنیت و سلنات دوگونه انحلال‌پذیر سلنیوم هستند که اغلب در محیطهای هوازی یافت می‌شوند. هر دو این اکسی آنیونها سمی بوده وتمایل به تجمع زیستی دارند. سلنیوم در شکل 4 ظرفیتی(سلنیت) نسبت به سلنیوم در حالت 6 ظرفیتی (سلنات) سمیت بیشتری برای موجودات دارد (7). سمیت سلنیت می‌تواند منجر به ایجاد شرایطی به نام سلنوسیس شده که می‌تواند بلند مدت یا کوتاه مدت باشد. علائم سلنوسیس شامل: ناراحتیها‌ی دستگاه گوارش، ریزش مو، لکه‌های سفید ناخن، خستگی، تحریک پذیری (حساسیت)، آسیب عصبی خفیف، لرزش، نوروپاتی محیطی و عدم هوشیاری  و علائم شدید مسمومیت شامل سیروز کبدی، ادم ریوی، ترومبوسیتوپنی، مشکلات غدد تیروئید و مرگ را می‌توان نام برد (19). تاکنون روشهای مختلفی برای حذف اکسی آنیونهای سمی سلنیوم از محیطهای آبی و پسابها شامل روشهای شیمیایی (رسوب‌دهی شیمیایی، الکتروشیمیایی وتبادل کننده های یونی آلی ) و روشهای فیزیکی (جذب سطحی و اسمزمعکوس) ابداع و در مواردی به کار گرفته شده اند (4). با این حال بسیاری از روشهای فیزیکی و شیمیایی مذکور از نظر مصرف مواد شیمیایی سمی، حجم بالای پسماند، مصرف انرژی بالا، آلودگی زیست محیطی و ناکارآمدی در کاهش یا حذف سلنیت در غلظتهای پایین غیر اقتصادی هستند (8). بنابراین زیست‌پالایی میکروبی از نظر هزینه مقرون به صرفه و کارآمد است و می تواند به عنوان جایگزینی متناسب با اصول حفاظت از محیط زیست در مقایسه با روشهای فیزیکوشیمیایی پیشنهاد شود (5). خصوصیت میکروارگانیسم‌ها در جذب و تجمع زیستی فلزات و مواد سمی از پسابها این امکان را فراهم کرده که بتوان از آنها به عنوان کاتالیستهای طبیعی ایمن و ارزان قیمت در جهت حذف یا کاهش فلزات سمی در مقیاس صنعتی استفاده نمود. به علاوه از مزیتهای مهم آن استفاده مجدد از توده زیستی میکروبی برای این فرآیند است (1). بسیاری از میکروارگانیسم‌ها می‌توانند محدوده ای از 5 تا 2000 میکروگرم در لیتر از ترکیبات سلنیومی را از طریق واکنشهای اکسیداسیون احیاء و تبدیل فرم غیر معدنی به فرم معدنی تحمل کنند (3). گونه های باکتریایی مختلف از گروه باکتریهای هتروتروف هوازی (21) باکتریهای هتروتروف بی هوازی (14) و باکتریهای شیمیوتروف متفاوتی شناخته شده اند که در حذف اکسی آنیون سمی سلنیت و تبدیل آن به فرم کمتر سمی سلنیوم عنصری نقش دارند (13). علاوه بر این توانمندی قارچهایی رشته ای متعلق به جنس های Aspergillus و Fusarium  و مخمرهایی مانند Candida utilis، Yarrowia lipolytica  و  Saccharomyces cerevisiae در سم زدایی سلنیت گزارش شده است (14). سویه های مخمری به دلیل فراوانی در خاکهای غنی و زیستگاههای آبی، میزان بالای رشد در محیطهای کشت ارزان، سهولت رشد و تولید توده زیستی فراوان از روشهای تخمیری صنعتی، سطح تعامل بالا با محیط اطراف، جذب کارآمد مواد معدنی و تبدیل آنها در ساختارهای سلولی، به عنوان کاتالیستهای طبیعی ایمن و ارزان قیمت برای پاکسازی پسابهای آلوده کاربرد زیادی می‌توانند داشته باشند. هدف کلی از انجام این پژوهش، غنی سازی مخمرهای بومی دریازی مقاوم به سلنیت و ارزیابی توانمندی آنها در بهسازی آلودگیهای محیطی به اکسی آنیون سمی سلنیت بود. در این تحقیق، برای اولین بار توانمندی مخمرهای دریازی بومی در آزمایشات سلنیت زدایی مورد بررسی قرار گرفت و حذف سلنیت در سویه مخمری بومی تریکوسپورون (جدا شده از دریای خزر) گزارش شد. امید می رود این مخمر بتواند به عنوان کاتالیست نقش مهمی در زی پالایی آلودگی آبها و فاضلاب کارخانه های آلوده به سلنیت ایفاء نماید.

مواد و روشها

مواد شیمیایی: سلنیت سدیم و حلال تولوئن از شرکت سیگما-آلدریچ انگلستان خریداری شد. معرف 3و 3- دی آمینو بنزیدین از شرکت مرک آلمان تهیه شد. آنتی بیوتیک کلرامفنیکل از شرکت پادتن طب ایران تهیه شد. گلوکز، عصاره مخمر، نمک کلرید سدیم و پپتون از کمپانی مرک تهیه شد. آگار- آگار از شرکت دیفکو آمریکا تهیه شد. آگارز، K2HPO4 و KH2PO4 از مرک خریداری شد. مواد استفاده شده در واکنش PCR از شرکت تکاپو زیست ایران خریداری شد.

 

غنی سازی مخمرهای دریازی با پتانسیل تحمل پذیری ذاتی نسبت به یون سمی سلنیت: برای غنی سازی مخمرهای دریازی بومی مقاوم به سلنیت، نمونه گیری از عمق 15 سانتیمتری از آبهای دریای خزر و خلیج فارس انجام شد. 25 نمونه آب از سواحل دریای خزر در سه استان مازندران، گیلان و گلستان و 10 نمونه از سواحل جزایر قشم، کیش و لاوان در خلیج فارس با استفاده از بطریهای استریل برداشت و به آزمایشگاه منتقل شد. 20 میلی لیتر از نمونه های آب جمع آوری شده به لوله های فالکون استریل 45 میلی لیتری منتقل شد و در دور rpm 4500 به مدت 10 دقیقه سانتریفیوژ شد. سپس محلول رویی را دور ریخته و مقدار یک میلی لیتر از مایع تحتانی به محیطهای کشت اخنصاصی و غنی کننده مخمرهای دریازی شامل YPD آگار ( 2 درصد گلوکز، 2 درصد پپتون، 1 درصد عصاره مخمر، 2 درصد آگار و pH برابر 8/5) حاوی سه درصد نمک کلرید سدیم و 100 نانوگرم بر میکرولیتر آنتی بیوتیک کلرامفنیکل منتقل شد (18). به محیطهای کشت مذکور، یون سلنیت در غلظت نهایی 5 گرم در لیتر، پس از استریل شدن توسط فیلترهای سرسرنگی 25/0 میکرونی، افزوده شد. پلیتها به مدت سه تا پنج روز در دمای 28 درجه سانتی گراد گرماگذاری شدند. کلنیهای مخمری با استفاده از ویژگیهای ظاهری مشخص شدند. به منظور خالص سازی سویه های مخمری غنی شده، هر کلونی مخمر به محیطهای کشت YPD آگار منتقل و به روش خطی کشت داده شد. تجدید کشت تا حصول اطمینان از خالص بودن جدایه های مخمری انجام شد.

بررسی الگوی مقاومت سویه های مخمری به اکسی آنیون سلنیت: برای به دست آوردن الگوی مقاومت سلنیتی سویه های مخمری جدا شده، از دستگاه الیزا ریدر و روش میکروتیترپلیت استفاده شد (25). در این روش پس از تهیه محلول استوک سلنیت استریل و تهیه رقتهایی از غلظتهای استفاده شده (5 تا 25 گرم در لیتر) در محیط YPD براث، به میزان ده میکرولیتر از سوسپانسیون تهیه شده از کشت 24 ساعته جدایه های مخمری (با تراکم نیم مک فارلند) به چاهکهای الیزای حاوی 140 میکرولیتر YPD براث شامل غلظتهای مشخصی از یون سلنیت، اضافه گردید. پلیتهای مذکور در دمای 28 درجه سانتی گراد به مدت 48 ساعت گرماگذاری شدند. پس از طی مدت زمان گرماگذاری میزان کدورت توسط دستگاه الیزا ریدر (ﻣﺪﻝ Sunrise. ﻣﺎﺭﮎ TECAN، ساخت کشور سوئیس) در مقایسه با شاهدهای تهیه شده در طول موج 620 نانومتر قرائت شد. غلظت آخرین چاهک عدم رشد به عنوان MIC (حداقل غلظت مهار کنندگی رشد) ثبت گردید. آزمایشات برای هر جدایه مخمری و هر غلظت به کار گرفته شده سه بار تکرار شد.

شناسایی مولکولی سویه مخمری Cas se5: شناسایی اولیه سویه مخمری PGO6 بر مبنای ویژگیهای ریخت شناسی و بیوشیمیایی، براساس استاندارد طبقه بندی Kurtzman and Fell (16)  انجام شد. جهت تشخیص مورفولوژی سلولی با میکروسکوپ نوری، لام مرطوب از کشت مایع دو روزه در محیط کشت YPD تهیه و بررسی گردید. جهت انجام شناسایی جذب قندها از محیطYNB (Yeast nitrogen base) استفاده گردید. این محیط که حاوی انواع نوترینتها، ویتامینها، فاکتورهای رشد و عناصر کمیاب می باشد به صورت آماده از شرکت HIMDEIA هند خریداری شد. پس از اضافه نمودن منابع قندی مختلف در غلظت 5 درصد به محیط مذکور، محلولهای فوق با استفاده از فیلترهای سرنگی 45/0 میکرونی استریل شد. سپس به لوله های حاوی مواد قندی تهیه شده، سوسپانسیون رقیقی از سویه مخمری فوق تلقیح شد. پس از آن لوله ها در دمای 25 درجه سانتی گراد و به مدت 3 هفته در انکوباتور شیکردار قرار داده شدند. جذب قندها از روی کدورت در مقایسه با شاهدها تخمین زده شد. جهت شناسایی تستهای تخمیری هیدراتهای کربن، معادل 2 گرم از منابع قندی مختلف در محلول 1 درصد عصاره مخمر حل شد و سپس 5 میلی لیتر از محیط ساخته شده قندی به لوله های آزمایش حاوی لوله های دورهام، اضافه شد. بدنبال اتوکلاو نمودن با استفاده از لوپهای سوزنی از یک کشت فعال مخمری به محیطهای فوق تلقیح و سپس لوله ها در دمای 25 درجه سانتی گراد به مدت 3 هفته در انکوباتور قرار داده شدند. رشد در دماهای مختلف و در غلظتهای مختلف نمک سدیم کلراید برروی محیط YPD آگار انجام شد. برای شناسایی مولکولی مخمر جدا شده، DNA ژنومی با استفاده از روش استاندارد فنل – کلروفرم و تخریب به کمک دانه های شیشه ای استخراج شد. پس از استخراج DNA ژنومی سویه مخمری Cas se5، با استفاده از یک جفت پرایمر نواحی ITS (Internal Transcribed Spacers)، شامل پرایمر بالادستITS1 (tccgtaggtgaacctgcgg) و پرایمر پایین دست ITS4 (tcctccgcttattgatatgc) تکثیر نواحی ژنی ITS1-5.8S-ITS2 انجام شد (24). واکنش PCR در دستگاه ترمو سایکلر ساخت شرکت BioRad کشور آمریکا انجام شد. مخلوط واکنش PCR (25 میکرولیتر) شامل 5/12 میکرولیتر Master mix (حاوی بافر PCR، MgCl2، dNTPs و آنزیم Taq-polymerase)، یک میکرولیتر پرایمرهای بالادست و پایین دست (10 میکرومولار)، یک میکرولیتر DNA ی الگو و 5/9 میکرولیتر آب PCR استفاده شد. شرایط دمایی واکنش در این فرآیند PCR به شرح زیر بود: واسرشت اولیه در دمای 95 درجه سانتی گراد به مدت 5 دقیقه انجام شد. چرخه تکثیر شامل 35 سیکل تکرار شونده با دمای واسرشت اولیه 95 درجه سانتی گراد به مدت 30 ثانیه، دمای اتصال 55 درجه سانتی گراد به مدت 30 ثانیه و دمای بسط 72 درجه سانتی گراد به مدت 2 دقیقه. پس از اتمام سیکلها و به منظور تکثیر و تکمیل نهایی DNA استخراج شده، نمونه ها به مدت 10 دقیقه در دمای 72 درجه سانتی گراد انکوبه شدند. پس از اطمینان از صحت انجام PCR توالی نوکلئوتیدی سویه مخمری se29w جهت تعیین توالی به همراه پرایمرهای رفت (ITS1) و برگشت (ITS4) به شرکت ماکروژن کره جنوبی (توسط شرکت تکاپو زیست) ارسال شد. نتایج حاصل از تعیین توالی در بانک ژنی NCBI بررسی شد. سپس درخت فیلوژنی توالی سویه مخمری Cas se5 با توالیهای حاصل از جستجو در پایگاه اطلاعات ژنی به کمک نرم افزار بیوانفوماتیک MEGA. 6 و با استفاده از الگوریتم Neighbour-Joining method رسم شد. بررسی اعتبار شاخه با Bootstrap=1000 انجام شد (23).

اثر پارامترهای مختلف روی حذف سلنیت تحت شرایط سلولهای در حال استراحت سویه مخمری Cas se5: برای تهیه سلولهای در حال استراحت، سلولها در محیط YPD به مدت 44 ساعت رشد داده شدند. در فواصل زمانی هر 4 ساعت یک بار میزان دانسیته سلولی (OD600nm) اندازه گیری و منحنی رشد ترسیم شد (شکل 1). سپس سلولها با استفاده از سانتریفیوژ یخچالی (×g 3000، 10 دقیقه، 4 درجه سانتی گراد) برداشت و توده سلولی سه مرتبه با بافر فسفات (KH2PO4/K2HPO4) شستشو داده شد. از این سلولها ی برداشت شده از انتهای فاز رشد لگاریتمی (ساعت 28 ام) به عنوان کاتالیست برای آزمایشات سلنیت زدایی استفاده شد.

 

 

شکل 1- منحنی رشد سویه مخمری Cas se5 در محیط کشت مایع YPD تحت شرایط دمایی 30 درجه سانتی گراد و دور شیکر rpm 150

 

برای ارزیابی حذف سلنیت توسط سویه مخمر Cas se5 از روش Hurlbut و همکاران طبق استاندارد AOAC (Association of Official Analytical Chemists) استفاده شد. در این روش معرف 3 و 3- دی آمینو بنزیدین با یون سلنیت واکنش داده و یک ترکیب زرد رنگ ایجاد می شود که پس از استخراج در حلال تولوئن، جذب مخلوط در 420 نانومتر توسط دستگاه اسپکتروفتومتر (Analytik Jena's spectrophotometer SPECORD 210, Carel Zeiss Technology, Germany) خوانده شد (11). برای رسم منحنی استاندارد، ابتدا غلظتهای مختلف از محلولهای استاندارد سلنیت تهیه و سپس به کمک رسم منحنی کالیبراسیون و تهیه معادله خط منحنی استاندارد، غلظت سلنیت باقیمانده در مخلوط واکنش زیست تبدیلی تعیین گردید (شکل 2 قسمت های A و B). جهت ارزیابی اثر غلظتهای اولیه یون سلنیت، حذف سلنیت در غلظتهای مختلف (5/2 تا 20 گرم در لیتر) سنجیده شد. سایر عاملها شامل غلظت اولیه توده سلولی 10 گرم در لیتر، دمای 28 درجه سانتی گراد، pH برابر 8/5، دور شیکر rpm 150 و زمان گرماگذاری 24 ساعت، ثابت در نظر گرفته شدند. همچنین حذف سلنیت در غلظتهای مختلف از توده سلولی بر حسب وزن تر (10 تا 50 گرم در لیتر)، غلظتهای مختلف نمک کلرید سدیم (1 تا 5 درصد وزنی/حجمی)، در شرایط pH (8/5 تا 8/7)، دمای (25 تا 35 درجه سانتی گراد) در محیط واکنش زیست تبدیلی حاوی 10 گرم در لیتر یون سلنیت و پس از 24 ساعت گرماگذاری تخمین زده شد. پس از بهینه سازی عاملهای واکنش زیست تبدیلی از طریق روش تک عاملی، اثر زمان گرماگذاری (12، 24، 48، 60، 72 و 84 ساعت) بر حذف سلنیت توسط سویه مخمر بومی Cas se5 بررسی شد. درصد حذف سلنیت از تقسیم تفاضل علظت اولیه و غلظت باقی مانده بر غلظت اولیه ضربدر 100 تخمین زده شد. تمام آزمایشات به صورت سه تایی انجام شد و نتایج به صورت میانگین گزارش شد. در بخش نتایج خطاهای آزمایش به صورت خطای معیار نمایش داده شد.

 

 

شکل 2- (A) رسم منحنی کالیبراسیون با استفاده از جذب محلولهای استاندارد سلنیت و  (B) طیف جذبی محلول سلنیت- معرف در حلال تولوئن


تجزیه و تحلیل آماری : تحلیل آماری نتایج با استفاده از نرم افزار SPSS11.5، در دو سطح توصیفی و استنباطی انجام شد. در سطح توصیفی از شاخصهای میانگین و انحراف معیار و در بخش آمار استنباطی از آنالیز واریانس یک طرفه و براساس آزمون چند دامنه ای دانکن استفاده شد. حداقل سطح معناداری در تمام آزمون فرضیه های مربوط (P<0.05) در نظر گرفته شد.

نتایج

غنی سازی و تعیین الگوی مقاومت به سلنیت در سویه های مخمری بومی دریازی: در طی غربال گری مخمرهای آبزی مقاوم به سلنیت، از مجموع 35 نمونه آب جمع آوری شده از دریای خزر و خلیج فارس، حدود 37 سویه مخمری با پتانسیل تحمل پذیری 5 گرم در لیتر یون سلنیت جداسازی شد. در این میان، 14 سویه مخمری (6 سویه مربوط به دریای خزر و 8 سویه مربوط به خلیج فارس) دارای قابلیت احیای سلنیت به سلنیوم عنصری بودند که نتیجه آن ایجاد کلنیهای قرمز رنگ در محیط YPD آگار حاوی سلنیت بود. سویه های مذکور به عنوان سویه های برتر انتخاب شدند. در ادامه به منظور انتخاب بهترین سویه مخمری کارآمد جهت انجام آزمایشات سلنیت زدایی، تست MIC صورت گرفت (شکل 3). تعیین الگوی مقاومت سویه های مخمری جدا شده با توجه به MIC نشان داد که بیشترین مقاومت به یون سمی سلنیت (تحمل پذیری بالاتر از 22 گرم در لیتر) مربوط به سویه Cas se5 (جدا شده از دریای خزر) بود. همچنین کمترین میزان مقاومت با مقدار MIC 6 گرم در لیتر در سویه مخمری Per Gul3 مشاهده شد. در سایر مخمرهای جدا شده محدوده مقاومت سویه ها نسبت به یون سمی سلنیت بین 6 تا 22 گرم در لیتر مشاهده شد (شکل 3).

 

 

شکل 3- نمودار نتایج حاصل از میزان غلظت ممانعت کننده رشد سویه های مخمری جدا شده از نمونه های آب جمع آوری شده از سواحل دریای خزر و خلیج فارس. آزمایشات سه بار تکرار شده است و خطاهای آزمایش به صورت خطای معیار نمایش داده شده است.


شناسایی فیلوژنتیکی سویه جداسازی شده Cas se5: از نظر رنگ کلنی سویه مخمری Cas se5 بر روی محیط کشت YPD آگار به شکل کلنیهای نرم و صاف و به رنگ زرد متمایل به کرم مشاهده شد (شکل 4 قسمت A). همچنین سویه مذکور دارای پتانسیل احیای یون سلنیت به سلنیوم عنصری که با ایجاد کلنی قرمز رنگ در محیط کشت قابل شناسایی است، می باشد (شکل 4 قسمت B). از نظر تستهای فیزیولوژیک و بیوشیمیایی کلیدی از جمله هیدرولیز اوره، رشد بر روی محیط کشت حاوی سیکلوهگزامید و همچنین رشد در دمای 35 درجه سانتی گراد و نمک سدیم کلراید با غلظت 5 درصد (وزنی/حجمی) مثبت بود. نتایج تستهای تخمیر کربوهیدرات سویه Cas se5 بیانگر عدم توانایی سویه مذکور در مصرف گلوکز، سوکروز، لاکتوز، مالتوز، گالاکتوز و تری هالوز بود. بررسی تستهای جذب منابع کربن و ازت در سویه مخمری مذکور نشان داد که سویه Cas se5 قابلیت جذب گلوکز، گالاکتوز، مالتوز، سوکروز، زایلوز، سلوبیوز و د- ریبوز را دارد. نتایج تستهای جذب گلیسرول، تری هالوز، آرابینوز، اسید سیتریک و نیترات پتاسیم حکایت از عدم توانایی سویه مخمری مذکور در مصرف منابع کربن و ازت مذکور می باشد. براساس نتایج به دست آمده از آزمونهای فنوتیپی و بیوشیمیایی و بر طبق کتابهای مرجع، سویه Cas se5 به طور موقت در جنس تریکوسپورون تعیین هویت شد. در ادامه به منظور تعیین هویت مولکولی سویه مخمری Cas se5 یک قطعه 551 جفت بازی با استفاده از پرایمرهای ITS1 و ITS4 تکثیر و تعیین توالی شد. شکل 5 تصویر حاصل از الکتروفورز محصول PCR مخمر جداسازی شده در این مطالعه را نشان می دهد. در ادامه به منظور شناسایی سویه مخمری مذکور، نتایج حاصل از تعیین توالی با توالیهای موجود در بانک ژنی NCBI بلاست شد و سپس درخت فیلوژنی برای مخمر مذکور ترسیم شد (شکل 6). در نهایت توالی ITS1-5.8S-ITS2 برای سویه مخمری Cas se5 که از لحاظ فیلوژنتیکی دارای شباهت 99 درصدی با Trichosporon sp.  (با شماره دسترسی JX270347) بود به عنوان Trichosporon sp. strain Cas se5 با شماره دسترسی KT033396 در بانک ژنی ثبت نهایی شد.

 

 

 

شکل 4- سویه مخمری خالص شده Cas se5 در محیط کشت YPD آگار پس از 48 ساعت گرماگذاری در دمای 30 درجه سانتی گراد و (B) کلنی سویه مخمری Cas se5 در محیط کشت YPD آگار حاوی 20 گرم در لیتر یون سلنیت پس از 48 ساعت گرماگذاری د ر دمای 30 درجه سانتی گراد.

 


اثر عاملهای مختلف بر روی حذف سلنیت توسط مخمر بومی تریکوسپورون سویه Cas se5: در این بخش از پژوهش، با هدف بهینه سازی راندمان حذف سلنیت تحت شرایط سلولهای در حال استراحت مخمر بومی تریکوسپورون از روش تک عاملی استفاده شد.

 

شکل 5- تصویر ژل الکتروفورز محصول PCR سویه مخمری جداسازی شده با قابلیت مقاومت همراه با احیای اکسی آنیون سمی سلنیت

برای این منظور، تأثیر غلظتهای اولیه یون سلنیت در محدوده 5/2 تا 20 گرم در لیتر در محیط بافری فسفات حاوی 10 گرم در لیتر توده سلولی (بر حسب وزن تر) به عنوان بیوکاتالیزور، دمای 28 درجه سانتی گراد، pH برابر 8/5، دور شیکر rpm 150 و پس از 24 ساعت گرماگذاری بررسی شد (شکل a7). نتایج نشان داد که با افزایش غلظت سلنیت تا 10 گرم در لیتر راندمان حذف افزایش می یابد. این در حالی است که در غلظتهای بالاتر میزان حذف در نتیجه کاهش فعالیت متابولیک و یا سمیت سلنیت کاسته شده است. این امر نشان دهنده این واقعیت است که حذف به شدت تابعی از غلظت اولیه یون سلنیت است. در نمودار شکل b7 اثر غلظتهای مختلف توده سلولی بر میزان حذف سلنیت توسط مخمر بومی تریکوسپورون سویه Cas se5 در غلظتهای مختلف توده سلولی در محیط بافری فسفات حاوی 10 گرم در لیتر یون سلنیت، دمای 28 درجه سانتی گراد، pH برابر 8/5، دور شیکر rpm 150 و پس از 24 ساعت گرماگذاری نشان داده شده است.

 

 

شکل 6- ترسیم درخت فیلوژنی سویه مخمری Cas se5 با استفاده از نرم افزار MEGA. 5 و براساس روش Neighbor-Joining. اعداد داخل پرانتز مربوط به شماره قابل دستیابی در بانک ژن می باشد.  Trichosporon brassicae به عنوان outgroup انتخاب شده است.

 

 

 

شکل7- نمودارهای اثر عاملهای مختلف بر میزان حذف سلنیت توسط مخمر بومی Trichosporon  سویه Cas se5 در محیط بافری فسفات. آزمایشات سه بار تکرار شده است و خطاهای آزمایش به صورت خطای معیار نمایش داده شده است.

 

نتایج نشان داد که بالاترین درصد حذف (12/24 درصد) در غلظت 35 گرم در لیتر مشاهده شده است. حذف سلنیت توسط مخمر بومی جداسازی شده در غلظتهای مختلف نمک کلرید سدیم در محیط بافری فسفات حاوی 10 گرم در لیتر یون سلنیت، 35 گرم در لیتر توده سلولی، دمای 28 درجه سانتی گراد، pH برابر 8/5، دور شیکر rpm 150 و پس از 24 ساعت گرماگذاری در نمودار شکل c7 نشان داده شده است. نتایج نشان داد که غلظتهای نمک بر میزان حذف بسیار موثرند. میزان حذف در محیط فاقد نمک 89/24 درصد بوده است این در حالی است که در حضور 5/2 درصد نمک کلرید سدیم، 78/39 درصد سلنیت از محیط واکنش حذف شده است.

 

 

 

شکل 8- نمودار اثر زمان گرماگذاری بر میزان حذف سلنیت توسط مخمر بومیTrichosporon  در محیط بافری فسفات حاوی 10 گرم در لیتر یون سلنیت، 35 گرم در لیتر توده سلولی، 5/2 درصد نمک کلرید سدیم، pH برابر 4/7، دمای 30 درجه سانتی گراد و دور شیکر rpm 100 در دور زمانی 84 ساعت. آزمایشات سه بار تکرار شده است و خطاهای آزمایش به صورت خطای معیار نمایش داده شده است.


اثر pH های مختلف در محدوده 8/5 تا 8/7 در حذف سلنیت توسط مخمر بومی تریکوسپورون در محیط بافری فسفات حاوی 10 گرم در لیتر یون سلنیت، 35 گرم در لیتر توده سلولی، 5/2 درصد کلرید سدیم، دمای 28 درجه سانتی گراد، دور شیکر rpm 150 و پس از 24 ساعت گرماگذاری در شکل d7 نشان داده شده است. نتایج نشان داد که در pH بهینه 8/7 مخمر مذکور 44/50 درصد از سلنیت موجود در محیط واکنش زیست تبدیلی را تحت شرایط بهینه شده از نظر غلظت اولیه سلنیت (10 گرم در لیتر)، غلظت اولیه توده سلولی (35 گرم در لیتر) و غلظت کلرید سدیم (5/2 درصد وزنی/حجمی) را حذف کرده است. اثر دماهای مختلف در حذف سلنیت توسط مخمر غربال گری شده در محیط بافری فسفات حاوی 10 گرم در لیتر یون سلنیت، 35 گرم در لیتر توده سلولی، 5/2 درصد کلرید سدیم، pH برابر 4/7 ، دور شیکر rpm 150 و پس از 24 ساعت گرماگذاری در شکل e7 قابل مشاهده است. نتایج نشان داد که راندمان حذف در دمای 25 درجه سانتی گراد 12/45 درصد، دمای 30 درجه سانتی گراد 11/52 درصد و دمای 35 درجه سانتی گراد 12/34 درصد می باشد که بیانگر دمای بهینه 30 درجه سانتی گراد برای حذف سلنیت توسط سویه مورد مطالعه است. در نمودار شکل f7، اثر دور شیکر های متفاوت در حذف سلنیت توسط مخمر مورد بررسی در محیط بافری فسفات حاوی 10 گرم در لیتر یون سلنیت، 35 گرم در لیتر توده سلولی، 5/2 درصد کلرید سدیم، pH برابر 4/7، دمای 30 درجه سانتی گراد و پس از 24 ساعت گرماگذاری نشان داده شده است. همان طور که در شکل قابل مشاهده است بیشترین میزان حذف سلنیت (44/63 درصد) در دور شیکر rpm 100 صورت گرفته که حکایت از بهینه فعالیت آنزیم مؤثر احتمالی در حذف سلنیت در مقدار مشخصی از اکسیژن دارد. در نهایت پس از بهینه سازی شرایط واکنش حذف زیستی سلنیت از طریق روش تک عاملی و پیدا نمودن مقادیر مناسب از پارامترهای واکنش، اثر زمان گرماگذاری بر راندمان حذف مورد بررسی قرار گرفت (شکل 8). براساس نتایج به دست آمده پس از 72 ساعت گرماگذاری، سلولهای در حالت استراحت سویه مخمری Cas se5 توانستند بیش از 93 درصد از سلنیت موجود در محیط زیست تبدیلی را حذف کنند که حکایت از پتانسیل مناسب کاتالیزور میکروبی مذکور در حذف سلنیت سمی از محیطهای واکنش دارد.

بحث و نتیجه گیری

با توجه به گسترش روز افزون صنایع و افزایش آلودگیهای محیطی نیاز به رفع خطرات ناشی از این آلودگیها محسوس است. ازجمله این آلودگیها، فلزات سنگین و شبه فلزات است که از طریق دفع پسابها و زباله ها وارد کانالهای آب و در نتیجه زنجیره غذایی می‌گردند. آلودگی با فلزات سنگین مساله زیست‌ محیطی جدی می‌باشد. بنابراین شناخت توانمندی میکرواورگانیسم‌ها جهت حذف فلزات از مکانهای آلوده، آنها را به عنوان کاتالیستهای ارزان و مناسب جهت پالایش و حذف فلزات سمی معرفی کرده است. توانایی جذب سطحی و اصلاح زیستی اکسی آنیون سمی سلنیت توسط میکروارگانیسم ها منجر به توجه خاص پژوهشگران به مطالعه انواع باکتریها، کپک های رشته ای، مخمرها و جلبکها در جهت زیست پالایی ترکیب سمی سلنیت از محیط زیست به ویژه از پسابهای صنعتی، فاضلابهای آلوده و آبهای آشامیدنی شده است. میکروارگانیسم ها مکانیسمهای متفاوتی در جهت سم زدایی محیط زیست از اکسی آنیونهای سلنیوم و جلوگیری از اثرات سمی شدید آنها بر موجودات زنده دارند که از آن جمله می توان به احیاء کردن، متیله کردن، رسوب دادن، تشکیل کمپلکس، تبخیر و تجمع داخل سلولی اشاره کرد (3 و 7). میکروارگانیسم های ساکن در زیستگاههای دریایی نسبت به انواع خشکی زی از نظر خصوصیات فیزیولوژیک و تنوع متابولیک متفاوت بوده و به طور معمول توانمندی بالایی در تولید فرآورده های فعال زیستی دارند. با توجه به سازگاری طولانی مدت میکروارگانیسم های ساکن در زیست بوم دریایی با شرایط سخت محیطی از نظر دما، pH، فشار، غلظتهای مختلف نمک و عناصر کمیاب، کاندیدهای مناسب به عنوان کاتالیست های مبتنی بر شیمی سبز برای مطالعات زیست پالایی میکروبی محسوب می شوند. از میکروبهای دریازی می توان بصورت طبیعی و بدون نیاز به دستکاری ژنتیکی برای زیست پالایی درجا (متکی بر میکروفلور بومی) فلزات و شبه فلزات سمی در شرایط سخت محیطی بهره جست (6). در این راستا، در این تحقیق نمونه گیری از سواحل دریای خزر و خلیج فارس انجام گرفت. جداسازی مخمرهای دریازی مقاوم از طریق غنی سازی و کشت مستقیم در محیطهای جامد حاوی سلنیت صورت گرفت. در مجموع 37 سویه مخمری با قابلیت تحمل پذیری 5 گرم در لیتر یون سمی سلنیت غربال گری شد. از میان سویه های مخمری جداسازی شده 14سویه مقاوم با قابلیت احیای سلنیت به سلنیوم عنصری به عنوان سویه های برتر انتخاب شدند. میزان مقاومت سویه های برتر در غلظتهای 6 تا 22 گرم در لیتر سلنیت، ارزیابی شد. سویه مخمری Cas se5 (جدا شده از دریای خزر) با بالاترین مقاومت (22 گرم در لیتر معادل 173میلی مولار) به عنوان سویه برتر مورد شناسایی مولکولی قرار گرفت و تحت تریکوسپورون با شماره دسترسی KT033396 در بانک ژنی ثبت شد. توانایی حذف سلنیت  توسط مقاوم ترین سویه مخمری Cas se5، از طریق اندازه گیری میزان سلنیت باقی مانده در محیط واکنش زیست تبدیلی تحت شرایط سلولهای در حال استراحت (سلولهای فعال از لحاظ متابولیکی و بدون قابلیت رشد) و در حضور فاکتورهای مؤثر بر فرآیند حذف میکروبی محاسبه گردید. براساس نتایج به دست آمده، پس از 72 ساعت گرماگذاری، مخمر بومی تریکوسپورون جداسازی شده توانست بیش از 93 درصد از سلنیت موجود در محیط واکنش زیست تبدیلی را تحت شرایط بهینه شده از طریق بهینه سازی تک عاملی حذف کند و میزان سلنیت اولیه را ازg/L  10 (معادل 78 میلی مولار) به حدودg/L  7/0 (معادل 5/5 میلی مولار) با نرخ حذفg/L/h  26/0(معادل 2 میلی مولار در ساعت) برساند. تاکنون فرآیند زیست پالایی میکروبی برای حذف آلاینده‌های فلزی و شبه فلزی در سویه های مخمری متعلق به جنسهایSaccharomyces ، Yarrowia ، Candida ، Rhodotorula ، Cryptococcus، Pichia، Schizosaccharomyces و Dekkera گزارش شده است (14). در مطالعاتی تحمل‌پذیری گونه های مخمری و قارچی آسکومیست و بازیدیومیست بررسی شد. یافته ها نشان داد به طور کلی گونه های آسکومیست مقاومت بالاتری به سلنیوم و ترکیبات آن دارند. در این بین،  رشد مخمرهایی از جمله Schizosaccharomyces pombe، Dekkera anomala ، Cryptococcus chernovii، Candida silvae و Pichia norvegensis و Rhodotorula yakutica در غلظتهای کمتر از 1 میلی مولار سدیم سلنات است. این در حالی است که گونه هایی مثل Candida maltosa، Cryptococcus curvatus، Yarrowia lipolytica  قادر به رشد در غلظت 10 میلی مولار  از سلنات بودند (9). مطالعاتی در ارتباط با الگوی تحمل پذیری بیوفیلمهای تشکیل شده توسط سویه های مخمری متعلق به جنسCandida  نشان داد که این بیوفیلمها قادر به تحمل غلظت 125 میلی مولار سلنیت می‌باشند. این مطالعه نشان داد تشکیل بیوفیلم این سویه های مخمری جهت حفاظت از میکروارگانیسم در برابر این ماده سمی است. فرآیند سم زدایی باعث بقای مخمر در شرایط غلظت بالای سلنیوم می‌شود (10). همچنین در گزارشی که توسط Ikram ارائه گردید چندین گونه از جنس Bacillus مقاوم به سلنیت (حداکثر مقاومت 20 گرم در لیتر) جداسازی شد و توانایی حذف و احیای سلنیت در سویه های جدا شده مورد سنجش قرار گرفت و در این بین بالاترین میزان حذف و احیاء توسط سویه Bacillus pumilus به میزان 97 درصد با غلظت اولیه 500 میکروگرم بر میلی لیتر سلنیت سدیم در مدت 144 ساعت گزارش شد (12). در مطالعه ایی که توسط Kuroda و همکاران در سال 2011 بر روی سویه Pseudomonas stutzeri NT-I انجام گرفت مشخص شد که این سویه توانایی حذف و احیای سلنیت را دارا بوده و می تواند در مدت زمان 18 ساعت 95 درصد از سلنیت را از محیط حذف کند (15). در مطالعه صورت گرفته توسط Rajashree و Muthukumar، حداکثر تحمل پذیری 75 میلی گرم در لیتر نسبت به سلنیت در سویه مخمری Saccharomyces cerevisiae I7 مشاهده شد. سویه مخمری مذکور قابلیت حذف 5/97 درصدی همراه با احیای یون سمی سلنیت را در غلظت بهینه 50 میلی گرم در لیتر دارا بود (20). بر اساس نتایج به دست آمده در این مطالعه و نتایج  پژوهشهای سایر محققان و با توجه به این موضوع که روش زیست پالایی میکروبی، روشی مؤثر و کم هزینه در حذف آلاینده های سمی از محیطهای طبیعی است و از آنجا که سویه مخمری تریکوسپورون جداسازی شده توانایی حذف سلنیت به صورت احیاء به سلنیوم عنصری را دارا می باشد، بنابراین پژوهش اخیر کاربرد دو منظوره از مخمر بومی مذکور را هم به عنوان یک کاتالیست بالقوه جهت حذف محیطهای آلوده سلنیتی و هم برای تولید توده زیستی مخمری غنی شده با سلنیوم به عنوان یک محصول خوراکی با ارزش افزوده بالا را پیشنهاد می کند.

تشکر و قدردانی

این پژوهش مستخرج از رساله کارشناسی ارشد خانم راضیه ارجمند تحت راهنمایی دکتر مراحم آشنگرف و با حمایت مالی و معنوی دانشگاه کردستان اجرا شده است که بدین وسیله، مولفین این مقاله مراتب تشکر و قدردانی خود را اعلام می دارد.

1. Aravindhan R, Madhan B, Rao JR, Nair BU, Ramasami T. (2004) Bioaccumulation of chromium from tannery wastewater: an approach for chrome recovery and reuse. Environ Sci Technol 38: 300-306.

2. Biswas KC, Barton LL, Tsui WL, Shuman K, Gillespie J, Eze CS. (2011) A novel method for the measurement of elemental selenium produced by bacterial reduction of selenite. J Microbiol Methods 86: 140-144.         

3. Chasteen TG, Bentley R. (2003) Biomethylation of selenium and tellurium: microorganisms and plants. Chem Rev 103: 1-25.

4. Cheung KH, GU J. (2007) Mechanism of hexavalent Chromium detoxification by microorganisms and bioremediation application potential: A review. Int Biodeterior Biodegradation 59: 8-15.

5. Chojnacka K. (2007) Bioaccumulation of Cr (III) ions by Blue Green alga Spirulina sp.  Part I. A comparison with biosorption. Am J Agric Biol Sci 2: 21 8-223.   

6. Dash HR, Mangwani N, Chakraborty J, Kumari S, Das S. (2013) Marine bacteria: potential candidates for enhanced bioremediation. Appl Microbiol Biotechnol 97: 561-571.

7. Dungan RS, Frankenberger WT. (1999) Microbial transformations of selenium and the bioremediation of seleniferous environments. Bioremediat J 3:171–188.

8. Geoffroy N, Demopoulos GP. (2011) The elimination of selenium (IV) from aqueous solution by precipitation with sodium sulfide. J Hazard Mater 185:148–154.

9. Golubev VI, Golubev NV. (2002) Selenium tolerance of yeasts. Mikrobiologiia 71: 455-459.

10. Harrison JJ, Rabiei M, Turner RJ, Badry EA, Sproule KM, Ceri H. (2006) Metal resistance in Candida biofilms. FEMS Microbiol Ecol 55: 479-91.

11. Hurlbut JA, Burkepile RG, Geisler CA, Kijak PJ, Rummel NG. (1996) Colorimetric determination of selenium in mineral premixes. J AOAC Int 80: 709–716.

12. Ikram M, Faisal M. (2010) Comparative assessment of selenite (SeIV) detoxification to elemental selenium (Se0) by Bacillus sp. Biotechnol Lett 32: 1255-1259.

13. Ilhan S, Nourbakh MN, Kilicarsl S, Ozdag H. (2004) Removal of chromium, lead and copper ions from industrial wastewaters by Staphylococcus saprophyticus. Turk J Biol 2: 50-57.

14. Kieliszek M, Błażejak S, Gientka I, Bzducha Wróbel A. (2015) Accumulation and metabolism of selenium by yeast cells. Appl Microbiol Biotechnol 99: 5373-5382.

15. Kuroda M, Notaguchi E, Sato A, Yoshioka M, Hasegawa A, Kagami T. (2011) Characterization of Pseudomonas stutzeri NT-I capable of removing soluble selenium from the aqueous phase under aerobic conditions. J Biosci Bioeng 112: 259–264.

16. Kurtzman, C.P and Fell, J.W. (2000) The yeasts: a taxonomic study (4th revised and   enlarged edition). Elsevier, Amsterdam, pp 1–525.

17. Lemly AD. (2004) Aquatic selenium pollution is a global environmental safety issue. Ecotoxicol Environ Saf 59: 44-56. 

18. Masuda K, Guo XF, Uryu N, Hagiwara T, Watabe S. (2008) Isolation of marine yeasts collected from the Pacific Ocean showing a high production of gamma-aminobutyric acid. Biosci Biotechnol Biochem72: 3265–3272.

19. Pedrero Z, Madrid Y. (2009) Novel approaches for selenium speciation in foodstuffs and biological specimens: a review. Analytica Chimica Acta 634: 135–152.

20. Rajashree K, Muthukumar T. (2013) Preparation of selenium tolerant yeast Saccharomyces cerevisiae. J Microbiol Biotechnol Res 3: 46-53.

21. Rauschenbach I, Narasingarao P, Häggblom MM. (2011) Desulfurispirillum indicum sp. nov., a selenate and selenite-respiring bacterium isolated from an estuarine canal. Int J Syst Evol Microbiol 61: 654-658.

22. Siddique T, Zhang Y, Okeke BC, Frankenberger WT. (2006) Characterization of sediment bacteria involved in selenium reduction. Bioresour Technol 97:1041–1049.

23. Tamura K, Stecher G, Peterson D, Filipski A, Kumar S. (2013) MEGA6: Molecular Evolutionary Genetics Analysis Version 6.0. Mol Biol Evol 30: 2725-2729.

24. White TJ, Bruns T, Lee S, Taylor JT. (1990) Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In: Innis, M.A. Gelfand, D.H. Sninsky, J.J. White TJ (eds) PCR protocols: a guide to methods and applications. New York; Academic Press.

 25. Wikler MA, Cockerill FR, Craig WA, Dudley MN, Hecht DW. (2006) Method for dilution antimicrobial test for bacteria that grow aerobically; approved standard. Clinical Laboratory Standards Institute 26: 9-16.